ID: 1156160300

View in Genome Browser
Species Human (GRCh38)
Location 18:34350958-34350980
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160300_1156160316 12 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160316 18:34350993-34351015 AGCTAATGGGAGGTTGAGGGTGG No data
1156160300_1156160311 -2 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160311 18:34350979-34351001 CCTCTGGAAGGGGAAGCTAATGG No data
1156160300_1156160313 2 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160313 18:34350983-34351005 TGGAAGGGGAAGCTAATGGGAGG No data
1156160300_1156160314 8 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160300_1156160315 9 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160315 18:34350990-34351012 GGAAGCTAATGGGAGGTTGAGGG No data
1156160300_1156160317 16 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160317 18:34350997-34351019 AATGGGAGGTTGAGGGTGGCTGG No data
1156160300_1156160318 17 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160318 18:34350998-34351020 ATGGGAGGTTGAGGGTGGCTGGG No data
1156160300_1156160312 -1 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG No data
1156160300_1156160319 23 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160319 18:34351004-34351026 GGTTGAGGGTGGCTGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160300 Original CRISPR GGGGAGCCCAAAGTCAGGAG GGG (reversed) Intergenic
No off target data available for this crispr