ID: 1156160304

View in Genome Browser
Species Human (GRCh38)
Location 18:34350963-34350985
Sequence CCTGACTTTGGGCTCCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160295_1156160304 -4 Left 1156160295 18:34350944-34350966 CCCTGCTGCCTCTGCCCCTCCTG No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160294_1156160304 -3 Left 1156160294 18:34350943-34350965 CCCCTGCTGCCTCTGCCCCTCCT No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160292_1156160304 2 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160293_1156160304 -2 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160296_1156160304 -5 Left 1156160296 18:34350945-34350967 CCTGCTGCCTCTGCCCCTCCTGA No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160304 Original CRISPR CCTGACTTTGGGCTCCCCTC TGG Intergenic
No off target data available for this crispr