ID: 1156160314

View in Genome Browser
Species Human (GRCh38)
Location 18:34350989-34351011
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160301_1156160314 7 Left 1156160301 18:34350959-34350981 CCCTCCTGACTTTGGGCTCCCCT No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160293_1156160314 24 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160296_1156160314 21 Left 1156160296 18:34350945-34350967 CCTGCTGCCTCTGCCCCTCCTGA No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160298_1156160314 14 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160302_1156160314 6 Left 1156160302 18:34350960-34350982 CCTCCTGACTTTGGGCTCCCCTC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160300_1156160314 8 Left 1156160300 18:34350958-34350980 CCCCTCCTGACTTTGGGCTCCCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160294_1156160314 23 Left 1156160294 18:34350943-34350965 CCCCTGCTGCCTCTGCCCCTCCT No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160303_1156160314 3 Left 1156160303 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160295_1156160314 22 Left 1156160295 18:34350944-34350966 CCCTGCTGCCTCTGCCCCTCCTG No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160292_1156160314 28 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160314 Original CRISPR GGGAAGCTAATGGGAGGTTG AGG Intergenic
No off target data available for this crispr