ID: 1156171686

View in Genome Browser
Species Human (GRCh38)
Location 18:34493795-34493817
Sequence AAGCGGGCGGAGAGCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156171681_1156171686 -3 Left 1156171681 18:34493775-34493797 CCGAGCAAAGTCAAGAGTGGAAG No data
Right 1156171686 18:34493795-34493817 AAGCGGGCGGAGAGCGCCGGCGG No data
1156171679_1156171686 4 Left 1156171679 18:34493768-34493790 CCGCGCACCGAGCAAAGTCAAGA No data
Right 1156171686 18:34493795-34493817 AAGCGGGCGGAGAGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156171686 Original CRISPR AAGCGGGCGGAGAGCGCCGG CGG Intronic