ID: 1156171764

View in Genome Browser
Species Human (GRCh38)
Location 18:34494069-34494091
Sequence CTGCTGCCGCGGCGCCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156171754_1156171764 13 Left 1156171754 18:34494033-34494055 CCGCCCTCGAAGGCCTTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171755_1156171764 10 Left 1156171755 18:34494036-34494058 CCCTCGAAGGCCTTCGCAGCGCC 0: 1
1: 0
2: 0
3: 8
4: 23
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171756_1156171764 9 Left 1156171756 18:34494037-34494059 CCTCGAAGGCCTTCGCAGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171751_1156171764 16 Left 1156171751 18:34494030-34494052 CCCCCGCCCTCGAAGGCCTTCGC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171757_1156171764 0 Left 1156171757 18:34494046-34494068 CCTTCGCAGCGCCGCAGCCCCTG 0: 1
1: 0
2: 0
3: 15
4: 222
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171752_1156171764 15 Left 1156171752 18:34494031-34494053 CCCCGCCCTCGAAGGCCTTCGCA 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1156171753_1156171764 14 Left 1156171753 18:34494032-34494054 CCCGCCCTCGAAGGCCTTCGCAG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG 0: 1
1: 0
2: 0
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156171764 Original CRISPR CTGCTGCCGCGGCGCCGCTC GGG Intronic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900287545 1:1908849-1908871 CTGCTGGCGAGGGGCCTCTCGGG + Intergenic
900610885 1:3544198-3544220 CTGATGCCGCTGCGACGCTGGGG - Intronic
901019801 1:6249849-6249871 AGGCTGGCGCGGCGCCGCTCGGG + Exonic
904086720 1:27914515-27914537 CGGCCGCCACTGCGCCGCTCTGG + Exonic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
905151420 1:35930993-35931015 CTCCTGCCCCGACGTCGCTCCGG + Intronic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
911601247 1:99850212-99850234 CAGCTGCCTCGGCGCTGCCCCGG + Intronic
912879135 1:113390975-113390997 GGGCGGCCGGGGCGCCGCTCCGG - Exonic
914242274 1:145859792-145859814 CGGCGGCCGCGGCTCCGCCCGGG + Intronic
915908909 1:159900133-159900155 CTGCCGCCTCGGCGCCGCCAAGG + Exonic
917502654 1:175599605-175599627 CTGCTGGGGCGACGCTGCTCCGG - Intronic
918043379 1:180926712-180926734 CGGCTGCAGGGGCGCCTCTCCGG + Intronic
921039528 1:211416646-211416668 CTGCTGCCTCGGCGTCCCCCGGG - Intergenic
922098833 1:222465464-222465486 CTGCAGGCGCAGCGCCGCTTCGG - Intergenic
922526547 1:226308819-226308841 CTGCTCCCCTGGCGCCACTCCGG - Intronic
924436831 1:244049322-244049344 CAGCTGCGGTGGCGCCTCTCGGG + Intronic
1065188867 10:23192950-23192972 CCGCAGCCGCCGCTCCGCTCAGG - Exonic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1066022744 10:31319464-31319486 GAGCGGCCGCGGCGCGGCTCCGG - Intronic
1067293733 10:44962574-44962596 CTGCTGCTGCAGGGCTGCTCTGG - Intronic
1069513823 10:69061882-69061904 CTGCTGCCTCGGTGCTGCTGAGG - Intergenic
1071573764 10:86711629-86711651 CGGCTGCGGCCGCGGCGCTCCGG - Intronic
1072189135 10:93066351-93066373 CGCCTGCCGCGGCGGCGCCCAGG + Intronic
1074772411 10:116742536-116742558 CCGCGTCCGCGGCGGCGCTCGGG + Exonic
1076622787 10:131803243-131803265 GTGCTGCTCCGGCCCCGCTCCGG - Intergenic
1077281762 11:1749204-1749226 CTGCAGCCGCGCGGCCGGTCTGG - Intronic
1083940130 11:65891242-65891264 CTGATCCCCCGGCGCCGCTGGGG - Exonic
1090174621 11:124637562-124637584 CAGCTGCTGCTGCTCCGCTCTGG + Intronic
1091381914 12:67252-67274 CTGCTGCCAGGGCCCCGCTGGGG - Exonic
1094107846 12:26832842-26832864 CTTCTGCCGCGGCGGCTCCCTGG - Exonic
1096101233 12:48971607-48971629 CGGCGGCCGCGGCGGCGCTGGGG - Exonic
1096284130 12:50283519-50283541 CTGCTCCTGCGGCCCCGCCCCGG + Intronic
1096983787 12:55743630-55743652 CTGCTGCAGCGGCGGCGCCTTGG - Exonic
1098255399 12:68610940-68610962 CTGCCGCTGCCGCGCCGCTCCGG - Exonic
1100330116 12:93573435-93573457 CTGCAGCCGCAGCTCCGCCCGGG - Intronic
1101466841 12:104958093-104958115 CCGCTGCCGCCGCCGCGCTCCGG - Intronic
1102913594 12:116737261-116737283 CTTCTGCAGCGGCGCCGCCGGGG - Intronic
1103074157 12:117968908-117968930 CTGCTGCCGCCGCCGGGCTCCGG + Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103930067 12:124445327-124445349 CGGCTGCCCCGGCCCCGCCCCGG + Intronic
1108350296 13:49585456-49585478 CTGCTGCCGCGCCGTCCCGCGGG + Exonic
1110730853 13:78877123-78877145 CTGCTGCCTCAGCCCCCCTCTGG - Intergenic
1112461444 13:99606733-99606755 CTGCGGCGGCGGCGCTGCTGAGG + Exonic
1112580702 13:100674602-100674624 CTCCTCCAGCAGCGCCGCTCTGG + Intronic
1115119913 14:29927372-29927394 CTCCTGTCGCGGCCCCGGTCGGG - Exonic
1117913108 14:60652935-60652957 CTGCTGCTCCGGCGCCACGCCGG - Intronic
1119092638 14:71799109-71799131 CTGCTGCCTGGGCTCCTCTCTGG - Intergenic
1122768360 14:104086112-104086134 GTGCTGCCGCTGCGCCCCTGAGG + Intronic
1123735594 15:23180051-23180073 CTGCTGCCGGGGCGGGGGTCTGG + Intergenic
1124286310 15:28403034-28403056 CTGCTGCCGGGGCGGGGGTCTGG + Intergenic
1124296393 15:28508602-28508624 CTGCTGCCGGGGCGGGGGTCTGG - Intergenic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1132613421 16:828834-828856 CTGCTGCTCCGGGGCCGCTGGGG + Intergenic
1132841407 16:1979996-1980018 GTGCTGCTGCGGCACCCCTCAGG - Exonic
1132887576 16:2189390-2189412 CCGCTGCCCCGCCCCCGCTCGGG + Intronic
1134164035 16:11915853-11915875 CTGCTGCCGCGGCGACGCCGGGG - Exonic
1138655245 16:58487707-58487729 CTGCTGCGGCGGGGACGCCCGGG - Intronic
1139917836 16:70439126-70439148 CGGCGGCGGCGGCGGCGCTCGGG - Intronic
1140454808 16:75098794-75098816 CTGCTGCCTCGGAGCTGCACGGG + Intronic
1142271791 16:89093787-89093809 CCGCCGCCACGGCGCCGCGCCGG + Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1146057675 17:29589379-29589401 CTGCGGCCGCGTCGCCGCTGAGG - Exonic
1147393346 17:40122866-40122888 CTGCTGCCCGGGGGCCGCCCCGG - Intronic
1149296375 17:55265604-55265626 GCGCTGCCGCGGCCCCGCTCCGG + Intronic
1151582444 17:74988000-74988022 GTGCTGCGGCGGCGCAGCTCAGG - Exonic
1151969873 17:77452059-77452081 CTGCTGCTACAGCGCAGCTCTGG + Intronic
1152345335 17:79747679-79747701 CTGCAGCCCCCGCGCCGCTGCGG - Intergenic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152596215 17:81239010-81239032 TGGCTGCCGCGCCGCCGCTACGG - Exonic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1157794216 18:50559973-50559995 CTGCTGCGGCGGTGGCGCTGGGG - Intergenic
1160025332 18:75211468-75211490 CTCCTCCCGGCGCGCCGCTCCGG - Intronic
1160453475 18:78980232-78980254 CTGATGCCGCTGCCCCGCGCGGG + Intergenic
1161089154 19:2351688-2351710 CTGCGGCCGCGACGGGGCTCAGG + Intronic
1166373104 19:42313346-42313368 CTCCGGCCCCGGCTCCGCTCCGG - Exonic
1167145816 19:47680465-47680487 GGGCTGCGGCGGGGCCGCTCCGG - Exonic
1168654701 19:58118486-58118508 CTGCGGCCACGGCCCCGCCCCGG - Intergenic
927180997 2:20446842-20446864 CTGCTGCCGCTGCGGGGCTCTGG - Intergenic
934933173 2:98445008-98445030 CTGCTGCTGCTGCGGGGCTCTGG + Exonic
935237633 2:101151535-101151557 CGGCTCCCGCGGCGCCTCCCGGG + Intronic
937042638 2:118834071-118834093 CCGCTGCCAGGGCGCCGCCCGGG + Intergenic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
944696153 2:202202002-202202024 CTGCGGCGGCAGCGCCACTCAGG - Intergenic
946395347 2:219441572-219441594 CTCCTCCCGCGGGGCCTCTCTGG - Intronic
947418567 2:229921952-229921974 CCGCCGCCGCCGCGCCGCTGGGG - Exonic
1170629769 20:18056956-18056978 GTGCTGCCGCCGCCCCGCCCCGG + Intronic
1176283288 20:64327581-64327603 CTGCTGCCAGGGCCCCGCTGGGG + Intergenic
1180252318 21:46597623-46597645 CTGCTGCCGGGGGGCAGCTCTGG - Intergenic
1182355309 22:29720172-29720194 CAGCGGGGGCGGCGCCGCTCTGG - Exonic
1182903854 22:33920448-33920470 CTCCTGCCCCGCCGCCGCGCCGG - Intronic
1184067744 22:42129893-42129915 CTGCAGTTGCGGCGCCGCTTCGG - Exonic
1184070479 22:42143565-42143587 CTGCAGTTGCGGCGCCGCTTCGG - Intergenic
1185051495 22:48556577-48556599 CTGCTGCCCCAGCGCCTCTTCGG - Intronic
1185278593 22:49960568-49960590 CGGCGGGCGCGGGGCCGCTCCGG - Exonic
949969961 3:9396603-9396625 CGGCGGCCGCGGCTCCGCCCCGG - Intergenic
950023624 3:9806289-9806311 CTGCCGCCGCCGCGCTGCTCGGG - Exonic
950084622 3:10248648-10248670 CAGCTCCCGAGGGGCCGCTCGGG + Exonic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968623349 4:1614569-1614591 CTGCTGCGGTGACGCTGCTCTGG - Intergenic
968818497 4:2833793-2833815 CTGCTGCTGCGGCACCCCTACGG + Exonic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
969075564 4:4575291-4575313 CGGCTGGCGCGGCCCCGCCCGGG + Intergenic
972158880 4:36198600-36198622 CTGCTGCCTCAGCCCCACTCTGG - Intronic
982110087 4:152045875-152045897 CGGCTGCAGCGGCTCCGCGCGGG - Intergenic
984928324 4:184825864-184825886 CTGCTCCCGCGGCGGTGCCCGGG - Intronic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
992374416 5:76174300-76174322 CTGCCGCTGCCGCGCCGCTCCGG + Intronic
1002046287 5:176543353-176543375 CGCCTGCCGCGGCCCCTCTCCGG + Intronic
1002929543 6:1624033-1624055 CTGCTGCCGCTGCGCTGTCCCGG - Exonic
1003139057 6:3456443-3456465 CGGCGGCCTCGGCGCCCCTCGGG - Exonic
1004193920 6:13487485-13487507 CCGCTGCCGCGCTGCAGCTCGGG - Exonic
1005775790 6:29129841-29129863 CTGCTGCCTGAGCCCCGCTCTGG + Intergenic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1007286921 6:40754618-40754640 CTGCTGACGCGGGGCTGCCCTGG + Intergenic
1007600164 6:43076382-43076404 CTGCTGCGGCGCCCGCGCTCCGG + Intronic
1014272492 6:119349660-119349682 CCGCAGCCCCGGCGCGGCTCAGG + Exonic
1016272265 6:142302245-142302267 CTGCTGCCGCTGCTCCACCCAGG - Exonic
1018788981 6:167131584-167131606 CTGCAGCAGGGGCGCGGCTCTGG - Intronic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1020034936 7:4959074-4959096 CTGCCGCCGCCGCGCCCCCCAGG - Exonic
1022739707 7:33109375-33109397 CAGCCCCCGCAGCGCCGCTCGGG + Exonic
1023984826 7:45088488-45088510 CTGCTGGGGCTGGGCCGCTCTGG - Intronic
1024965356 7:55019034-55019056 CTGCTGCGGCCGCGCTGCGCCGG - Intronic
1025019391 7:55468662-55468684 CAGCTGACGCGGCCCCGCCCAGG - Intronic
1028621429 7:92833337-92833359 CGCCCGCCGCGGCGCCGCTGGGG + Exonic
1029367630 7:100126939-100126961 CTACCTCCGCGGCGCCGCTTCGG + Exonic
1033390725 7:140924837-140924859 CTCCGCCCGCGGCGCCGCCCGGG - Intergenic
1034499349 7:151439966-151439988 CTGCTGGCTCAGCGCCGCCCCGG + Exonic
1034578930 7:152025936-152025958 CTGCGGCGGCGGCGGCGCGCGGG + Intronic
1034979447 7:155466900-155466922 CTGCCGCCGCGGAGCCGGCCGGG + Intergenic
1038484177 8:27921876-27921898 CTGCTGCTGAGGCGCCACGCGGG - Exonic
1039873563 8:41567195-41567217 CCGAGGCCGCGGCGCCCCTCGGG - Intergenic
1040423405 8:47260953-47260975 CGGCTGCCGCGGGGCATCTCCGG - Exonic
1041428367 8:57749162-57749184 CAGCTGCCACTACGCCGCTCTGG - Intergenic
1041739004 8:61139241-61139263 CTGCCCCCGCGGCGCCTCGCGGG - Intronic
1044839157 8:96323265-96323287 CTGCTGCCACTGCTCCTCTCTGG + Intronic
1047951563 8:129939704-129939726 CTGCCGCCGCTCCCCCGCTCCGG - Exonic
1049565316 8:143334999-143335021 CTGCTGCCGCAGCCCCGTGCAGG - Intronic
1052799573 9:32955701-32955723 CTGCGGCCGCTGCTCCGCCCAGG - Intergenic
1052970935 9:34376867-34376889 AAGCTGCCGCCGCGCCGCGCGGG + Intergenic
1055030566 9:71768729-71768751 CTGTTGTCGCGGGGACGCTCAGG - Exonic
1058058644 9:100473555-100473577 CAGCCGCTGAGGCGCCGCTCCGG + Exonic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1060209082 9:121699423-121699445 CGGCGGCGGCGGCGGCGCTCCGG - Exonic
1061299683 9:129697493-129697515 GATGTGCCGCGGCGCCGCTCTGG + Intronic
1061514223 9:131079255-131079277 CTGCTGCCCAGGCGACGCTACGG + Exonic
1061987149 9:134136335-134136357 CCGCTGCAGCGGCCCCGCCCGGG + Intronic
1062022768 9:134326964-134326986 CAGCTGCAGCCGCGCCGCACAGG + Intronic
1187363694 X:18649978-18650000 CCGCCGCCGCCGCCCCGCTCAGG + Intronic
1187648425 X:21374576-21374598 CTGCCTCCGCCGCTCCGCTCCGG - Intronic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic