ID: 1156174522

View in Genome Browser
Species Human (GRCh38)
Location 18:34527500-34527522
Sequence CCTTCTCTGTAGGAGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156174522_1156174527 -6 Left 1156174522 18:34527500-34527522 CCCTGTGCCTCCTACAGAGAAGG 0: 1
1: 0
2: 3
3: 25
4: 247
Right 1156174527 18:34527517-34527539 AGAAGGTGAAATTGTTTAAGTGG 0: 1
1: 0
2: 2
3: 27
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156174522 Original CRISPR CCTTCTCTGTAGGAGGCACA GGG (reversed) Intronic
900529473 1:3145613-3145635 ACATCTCTGCAGGAGGCTCATGG - Intronic
900948450 1:5844299-5844321 AGTTCTCCGTAGGAGGCAGAGGG + Intergenic
903546846 1:24129690-24129712 CCTTCTCTTTTTCAGGCACATGG + Intronic
905225625 1:36477221-36477243 CCTACTCTGTACTAGGCACTGGG - Intronic
906023590 1:42653972-42653994 GCTTCTCTGAAGGAGACACATGG + Exonic
907799416 1:57750067-57750089 CCTTGACTGTAGGCAGCACAGGG - Intronic
907827256 1:58030699-58030721 CCTGCTCTCTTGCAGGCACAAGG - Intronic
909666056 1:78134687-78134709 ACTTCTCTGAACGAGCCACAAGG - Intronic
910170120 1:84368485-84368507 CCTTCTCTCTTGGACTCACAGGG + Intronic
913529056 1:119720440-119720462 CCTTCCCTGTATCAGGGACAGGG + Intronic
915138746 1:153752893-153752915 CCTTGTCGGGAGGAGGCACACGG - Intronic
916569125 1:166009396-166009418 CCTTCTCCGTGGGAGATACATGG + Intergenic
918641832 1:186850542-186850564 CCTAGTCTGTAGTAGGCACTGGG - Intronic
919990250 1:202704373-202704395 CCTACTCTGTAAAAGGCACCTGG - Intronic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
924611634 1:245578293-245578315 CATTCACTGTATGAGGCTCATGG - Intronic
1063734276 10:8734734-8734756 GCTGCTCTGTGGGAGGCACTGGG + Intergenic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1064600616 10:16988557-16988579 CCTTCTCAGTGAGAGTCACAAGG - Intronic
1065390254 10:25175402-25175424 TCTTCTCTCTGGGAGGCAGATGG + Exonic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1069818136 10:71211578-71211600 CCTTCCCTGTGCCAGGCACAGGG - Intergenic
1071479844 10:86056928-86056950 CCAGCTCTGCAGGAAGCACAAGG - Intronic
1072008937 10:91286739-91286761 CGGGCTTTGTAGGAGGCACAGGG - Intergenic
1072324970 10:94288761-94288783 CCTACACTGAAGGAGCCACATGG + Intronic
1072705118 10:97675507-97675529 CCTTGACTGTAGGAGCCAGAAGG + Exonic
1072800542 10:98389575-98389597 GCTGCTGTATAGGAGGCACAGGG - Intronic
1073119445 10:101112641-101112663 GCTTCTGTGCAGGAGGCACGTGG - Intronic
1074611430 10:115025720-115025742 CCTTATCTGTACCAGGCACATGG - Intergenic
1075632358 10:124008457-124008479 CCTTCTCTATAGCCGGCACTGGG - Exonic
1075912717 10:126139729-126139751 GCTTCTCTGGGGGAGGAACAGGG - Intronic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1077223503 11:1427531-1427553 CCTTCCCTGTGGGGGGCGCAGGG + Intronic
1077241901 11:1515072-1515094 CCTTTTCTGAAGGGGGCACTGGG - Intergenic
1078062784 11:8059221-8059243 CCTTCTCTGTAGCAGGCTCAGGG + Intronic
1078142713 11:8703439-8703461 ACTTCTCTGGGGGAGTCACAGGG + Intronic
1079326597 11:19498175-19498197 TCTTCTCTGGAGGAGCCACATGG - Intronic
1079746289 11:24135431-24135453 CCTTCTCTTTAAGAGTTACAAGG - Intergenic
1081003940 11:37710219-37710241 CCTTTTGTGTAGGAGGCAGATGG + Intergenic
1082181380 11:49124279-49124301 GCTGATCTGTAGGAGGCACCAGG - Intergenic
1083759452 11:64807721-64807743 CATTCCCTGAAGCAGGCACAGGG - Intronic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1087796417 11:102459073-102459095 TCTTCTCTGTAGGAGGCTATAGG + Intronic
1087902399 11:103656286-103656308 CCTACTCTGTACAAGGCACTGGG + Intergenic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1089681574 11:120121761-120121783 CCTGCTCTGTAGGAGACTGAGGG - Intronic
1090043778 11:123313413-123313435 CCTCCTCTGTAGAAGGCCCCGGG + Intergenic
1090616262 11:128518125-128518147 CTCTCACTGTTGGAGGCACAGGG - Intronic
1091060556 11:132457518-132457540 CCTTCTATGGAGGAGGCAGGTGG + Intronic
1093927060 12:24919518-24919540 CCTCCCCTGTAGGAGTCAAAAGG + Intronic
1096516707 12:52160139-52160161 CCCTCAGTGTAGGAAGCACATGG - Intergenic
1096803940 12:54128746-54128768 CCCTCTCAGCAGTAGGCACAAGG - Intergenic
1097137600 12:56871672-56871694 TCTTCTCCGTGGCAGGCACAGGG - Intergenic
1097637845 12:62144114-62144136 CCTTCTCTGCAGGAAACAAATGG + Intronic
1098544584 12:71697439-71697461 CCTGCTCTGCTGGAGACACATGG + Exonic
1099642259 12:85306104-85306126 GCTTTTCAGTAGGAGGCAAAAGG + Intergenic
1103009764 12:117449149-117449171 CCTTCTATGCAGTGGGCACAGGG - Intronic
1104514536 12:129412521-129412543 CCTTCTCTGTAGGAAGAATGAGG - Intronic
1104849420 12:131864224-131864246 CCTACTCTGTTCCAGGCACAGGG + Intergenic
1105432306 13:20348030-20348052 CATCCTCTGTGGAAGGCACATGG + Intergenic
1105557645 13:21461305-21461327 CCTTCTCGGCAGAAGGCAAAGGG - Intergenic
1106704088 13:32261973-32261995 TCTTCTCTGTAGGTTGCAGATGG + Intronic
1106950748 13:34880992-34881014 CCGTCACTGTAGGGGGAACATGG - Intergenic
1109025195 13:57146381-57146403 CCGTCTCTGTAAAAGACACAAGG + Intronic
1109026185 13:57152954-57152976 CCGTCTCTGTAAAAGACACAAGG + Intronic
1109027177 13:57159525-57159547 CCGTCTCTGTAAAAGACACAAGG + Intergenic
1109028163 13:57166090-57166112 CCGTCTCTGTAAAAGACACAAGG + Intergenic
1109029150 13:57172661-57172683 CCGTCTCTGTAAAAGACACAAGG + Intergenic
1109837285 13:67876827-67876849 CCTGCTCTGTACAAGTCACATGG - Intergenic
1114398815 14:22390626-22390648 CTTACTCTGTTGGAGGCACTGGG + Intergenic
1114649222 14:24273005-24273027 CCTTCTTTGCAGTAGGCACAGGG - Intergenic
1115805044 14:37041239-37041261 CCTTCTCTGTTAGAGGCACTTGG - Intronic
1117564505 14:56979195-56979217 CCTTCTCTGTGGCACGCACTTGG + Intergenic
1119465295 14:74852959-74852981 CCCTCTCTGTTGGAAACACATGG - Exonic
1119878819 14:78083255-78083277 TCTGCTCTGTAGGAGAGACAGGG + Intergenic
1119932807 14:78564563-78564585 CCTCCTCTCTAGGAGGTATATGG + Intronic
1120031548 14:79646938-79646960 TCATCTTTGTAGGAGGCAAAGGG + Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1122247832 14:100416825-100416847 ACTTTTCTGTAGCAGGCACTTGG + Intronic
1122483717 14:102064308-102064330 CCTTCTCTGGATCAGGCACCAGG + Intergenic
1122878865 14:104681003-104681025 GTTTCTGTTTAGGAGGCACATGG - Intergenic
1122992107 14:105241317-105241339 CATCCTCTGTAGGAGCCTCAGGG + Exonic
1123965335 15:25450172-25450194 TCTTCTCTGCTGGAGTCACATGG - Intergenic
1126326762 15:47486882-47486904 CCTTGACTGTAGGATGCTCAGGG - Intronic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1128346281 15:66854509-66854531 CCTCCTCTGTTGCAGGCACAGGG - Intergenic
1128645359 15:69374817-69374839 CCTTGTATGTAAGAGGGACATGG - Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129787180 15:78317203-78317225 CCTGCGTTGTAGGAGGCTCACGG - Intergenic
1131599524 15:93832211-93832233 CCTTCTTGGTGGGAGGCAGAGGG - Intergenic
1133374480 16:5273092-5273114 CGTTCTCTTTAAGAGGCAGAGGG + Intergenic
1133491079 16:6268814-6268836 TGTTCTCTGTTGGAGGAACAGGG - Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134541047 16:15065851-15065873 CCTTTACTGAAGGAGGGACACGG + Intronic
1135436499 16:22430395-22430417 CCTTTACTGAAGGAGGGACATGG + Intronic
1135732619 16:24907331-24907353 CCTACTGTGTACCAGGCACAGGG + Intronic
1136263758 16:29101520-29101542 CCTTTACTGAAGGAGGGACAAGG - Intergenic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1139291559 16:65863212-65863234 CATTCTCTGTAGCAGGCAGTAGG - Intergenic
1139423145 16:66861664-66861686 CTTTCAGTTTAGGAGGCACATGG - Intronic
1139440866 16:66966164-66966186 CCCTCTCTGTGGGAGGCAGAAGG + Intronic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142231570 16:88902542-88902564 CCTGCTCTCTGGGTGGCACAAGG - Intronic
1142348534 16:89569469-89569491 CCTTCTCTGGAGGTGGCCCAGGG + Intergenic
1143334760 17:6163876-6163898 CCTTCTGTGGAGCAGGCACCAGG + Intergenic
1143660611 17:8322370-8322392 CCCTGACTGCAGGAGGCACAGGG + Exonic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1144771351 17:17761404-17761426 CCTACTCTGTGCCAGGCACAGGG + Intronic
1146268627 17:31470008-31470030 CCTGCTCTGTGTCAGGCACATGG - Intronic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1150212671 17:63450001-63450023 CCTTCTCTGTGCCAGGCACTAGG + Intergenic
1152550997 17:81030176-81030198 CCTTCTGTGTGGGCTGCACATGG - Intergenic
1152631790 17:81413810-81413832 CCTTCTCTGGATGGGGCGCAGGG + Intronic
1155800672 18:30099124-30099146 CCAGCTCTTTAGGAGGCAGAGGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156394858 18:36690359-36690381 CCTCCTCTGTGGGAAGCACCGGG - Intronic
1156939864 18:42754239-42754261 CCTTCTTTGTGGTAGGCAGAAGG + Intronic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1161595499 19:5149106-5149128 CCATCCCTGGAGGAGTCACAGGG + Intronic
1161767569 19:6215910-6215932 CCTTTTCCCCAGGAGGCACAGGG - Intronic
1164829452 19:31309328-31309350 CCTTGCCTGAAGGAGGAACATGG + Intronic
1164833984 19:31345338-31345360 CGTTCTCTCTTGGAAGCACATGG - Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165384156 19:35500676-35500698 CCTTCTCTATAGGTAGCACGTGG - Intronic
1165403276 19:35615210-35615232 CCGTGTCTGTGGGAGGAACAGGG - Exonic
1165421465 19:35724057-35724079 TCTTTTGTGTAGGAGGGACAAGG + Intronic
1167034116 19:46983387-46983409 CTTACTCTGTATGAGGCACACGG - Intronic
1168578432 19:57533499-57533521 CCCTCTCTGCTGGAAGCACAAGG + Intronic
1168679717 19:58305664-58305686 CATTCTGTGTTGGAGGCAGAAGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926064938 2:9831067-9831089 TCTTCTCTCTAGCAGGAACATGG + Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927972723 2:27315937-27315959 CCTTCTCTCAAGGAGGACCAAGG + Intronic
928871534 2:35986825-35986847 CCTGCTCTGTAGGAAGCAAAGGG + Intergenic
929479949 2:42296184-42296206 CCTACTCTGAAGGAAGTACATGG - Intronic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
930663587 2:54080209-54080231 CCTTATCCGTAGGCTGCACATGG + Intronic
930747510 2:54900272-54900294 GCTTCTGTGTGGCAGGCACAGGG + Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931785066 2:65611086-65611108 CCTTCTTTGGAGGATGCCCATGG + Intergenic
932358096 2:71083294-71083316 CCTTCTTTGGGGGAGGGACAGGG - Intergenic
932370435 2:71182861-71182883 CCTTCTTTGGGGGAGGGACAGGG - Exonic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
938152468 2:128899398-128899420 GCTTCTCAGCAGGATGCACAGGG + Intergenic
938811684 2:134859485-134859507 GCTTCACTGTGGGAGGGACAGGG + Intronic
939029690 2:137056769-137056791 CCTGTTCTGTAGGAGGCTGAAGG - Exonic
940169831 2:150816364-150816386 CCTTCTCTTGGGGAGGGACAGGG - Intergenic
945505993 2:210641034-210641056 CCTTCCTTATAGGAGGCACAAGG - Intronic
947750557 2:232529922-232529944 CGTTCTCTGAGGGCGGCACATGG - Exonic
948903858 2:240968702-240968724 CCTTCTGTGTCTGAGCCACATGG - Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169026009 20:2372121-2372143 ACTTCTCAGCTGGAGGCACAGGG - Intergenic
1169436162 20:5593547-5593569 CCTACTCTGTAGCAGGCAATGGG + Intronic
1169776584 20:9261920-9261942 CCTTGTCTCAAGGAGGCAGAAGG + Intronic
1169883107 20:10368603-10368625 CCTTCTAAGTAGGAGGTAAATGG - Intergenic
1171284779 20:23928211-23928233 ACTTGCCTGCAGGAGGCACAAGG - Intergenic
1171361414 20:24588922-24588944 CCTTCTCTGGGGGAGGCATCTGG + Intronic
1172237946 20:33390687-33390709 CCTTCACTGTAGAAGCCTCAGGG - Intronic
1172310429 20:33913730-33913752 CCTTTTCTGGAGGTGGCCCATGG - Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173961319 20:47074465-47074487 GCTTCTCTGAAGGAGGGACCTGG + Intronic
1174988759 20:55486205-55486227 CCTTCTCTGTGCTAGGCACTTGG - Intergenic
1175000638 20:55625957-55625979 CCTTCTGTGTAGGTGACAAAAGG + Intergenic
1175507513 20:59496246-59496268 CCTTATCCGAAGGAGGCAGAGGG - Intergenic
1176100026 20:63360647-63360669 CCTTTTCTGCAGGAAGGACAAGG - Intronic
1179571605 21:42281906-42281928 CCTTCTCCGTATGGGGCACTGGG + Intronic
1181370102 22:22409084-22409106 TCTTCCCTCTAGGAGGCCCAGGG - Intergenic
1182875086 22:33684753-33684775 CCATCGCTGTAAGAAGCACATGG - Intronic
1183653947 22:39174498-39174520 CCTTCTCAGAAGGAGGCTCCCGG - Intergenic
1183697275 22:39430534-39430556 CCTGCTCTGTAGGAGGCTGCTGG - Exonic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185109961 22:48895317-48895339 ACTTCTGTGTAGGAGGCAGGAGG + Intergenic
1185125590 22:49009001-49009023 TCTGCTCTGTAGGATGCACCTGG + Intergenic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
949903627 3:8839994-8840016 TCTTCTCTGTCGGAGACAGATGG + Intronic
950425676 3:12923672-12923694 GCTTCTCCCTAGGAGGCAGAGGG - Intronic
951810836 3:26697837-26697859 CCTTCTATGTACAAGGCACAGGG - Intronic
951926251 3:27911897-27911919 CCTACTATGTATCAGGCACAGGG - Intergenic
954030391 3:47815382-47815404 CCTGCTGTGTAGGAGACACTAGG + Intronic
954535210 3:51354757-51354779 CCTTCTCTGTATCAGGCCCTGGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955834834 3:63043503-63043525 CCTTCTTTCTTGGAGGCACCAGG + Intergenic
957910438 3:86614369-86614391 CTATCGCTGTAGGAGGCACCAGG - Intergenic
958892578 3:99796814-99796836 CCTTCTCTGTACCAAGCACTGGG + Exonic
959869587 3:111311050-111311072 CCATATCTGAAGGGGGCACAGGG + Intronic
963635335 3:147787712-147787734 CCATGTCTCTAGGAAGCACAAGG - Intergenic
967231691 3:187343620-187343642 AGTTCTCTGTAAGAGGCTCATGG - Intergenic
967442907 3:189529847-189529869 CCTTCTCTGTAAGCCCCACAGGG - Intergenic
970307363 4:14747581-14747603 CCTTCTCTGTTTCAGGAACATGG + Intergenic
976361581 4:84185049-84185071 TCTTCTCTGATGGAGGCAGAAGG + Intergenic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
978177094 4:105745491-105745513 CCTTCTCTGTGTGATGAACAAGG + Intronic
979323427 4:119351055-119351077 CCTTATCTGTTGGTGGCCCAAGG - Intergenic
981633069 4:146843807-146843829 CTTTCTCTGTAAGAAGCAAAGGG + Intronic
982361491 4:154523987-154524009 CCTTCTTTGGGGGTGGCACAGGG - Intergenic
982404423 4:155004065-155004087 TCTTCTCTGATGGAGGCTCAAGG + Intergenic
984883883 4:184432962-184432984 CCTTCTCTGTTGGTTGCTCAGGG - Intronic
985559223 5:574070-574092 CCTGCTCTGGAGGATGCACAGGG - Intergenic
986651370 5:9966531-9966553 CCTTTGCTGTAGGAGGCAGATGG - Intergenic
993004055 5:82412136-82412158 CCATCACTGGAGGAGGCACCAGG + Intergenic
993593331 5:89823196-89823218 TCCTCTCTGTAGGAGGCTCTGGG - Intergenic
999569417 5:152901841-152901863 CCTCATCTGTTAGAGGCACACGG + Intergenic
999728430 5:154456536-154456558 CCTACTGTGTACAAGGCACAGGG - Exonic
1000323055 5:160150207-160150229 CCTTCTATGTGGTAGGCACTGGG + Intergenic
1000654240 5:163856701-163856723 TCTTCACTGTAGGAGGCCCAGGG - Intergenic
1002599901 5:180348148-180348170 CCTAATCTCTAGGAGGCTCATGG - Intronic
1003463580 6:6355147-6355169 CCTTCTCTGAATGAGCCTCATGG + Intergenic
1005186959 6:23173332-23173354 CTTTTTCAGTAGGAGGCACTAGG + Intergenic
1005620103 6:27612163-27612185 CCTTCTTTGTAGGATGAAAAGGG - Intergenic
1005667058 6:28068364-28068386 CCTTCCCCCTGGGAGGCACAAGG - Intergenic
1006471882 6:34234257-34234279 CCTACTCTGTAGCAGGAACTGGG - Intergenic
1009360788 6:62810038-62810060 TCATCTCTGTAGGAAACACATGG - Intergenic
1011503984 6:88021296-88021318 CCTTCTTTGTAGGAAGCTCTAGG + Intergenic
1012056226 6:94414242-94414264 CCTTTTCTGTAGAAGACATATGG + Intergenic
1012195019 6:96330737-96330759 CCTTCTCTGAAGGTGACACTGGG + Intergenic
1012225919 6:96703322-96703344 CCTTCTTTCTAGGAGGCCCTGGG - Intergenic
1018732072 6:166658860-166658882 CCTGCTCTGTACAAGACACATGG + Intronic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1020132840 7:5569410-5569432 CCTGCTCTGTAGGAAACACCTGG - Intergenic
1021347610 7:19547701-19547723 TCTTCTCATCAGGAGGCACAGGG + Intergenic
1022206557 7:28169985-28170007 CCTTCTCTGTGGATGGCACCAGG + Intronic
1022619943 7:31972786-31972808 CTTCCCCTGTAGGAGGCACCAGG + Intronic
1022971277 7:35519717-35519739 CCTTATCTGTGCCAGGCACAGGG - Intergenic
1023364372 7:39449140-39449162 GCAATTCTGTAGGAGGCACAAGG + Intronic
1023714110 7:43025904-43025926 CCTTGTGTGTAGGGTGCACATGG - Intergenic
1026988293 7:74568738-74568760 CCTTCTCTCAGGGAGGGACAGGG + Intronic
1028828647 7:95303203-95303225 CATTTTGAGTAGGAGGCACAGGG - Intronic
1029982382 7:104890931-104890953 CCTACTCTGTTGCAGGCACGAGG - Intronic
1031965539 7:128025648-128025670 CCTCCTCTGTAGCAGGCACTTGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035666378 8:1383493-1383515 CCTTCGCTCAAGGAGGCAAATGG + Intergenic
1037974413 8:23199668-23199690 CCTGGGCTGTAGGAAGCACAGGG + Intronic
1038918292 8:32052184-32052206 CCATCTCTGTAAGAGCCATATGG + Intronic
1039822507 8:41146368-41146390 CCTTATCTGCAGAAAGCACAAGG - Intergenic
1040525583 8:48221282-48221304 ACTTCTCTGGAGAAGGCATATGG + Intergenic
1040974291 8:53172768-53172790 CCTACTCTGTGCCAGGCACAGGG + Intergenic
1042531511 8:69820581-69820603 CCATCACTTTAGGAGGCTCAGGG + Intronic
1043107857 8:76137437-76137459 CCTGCTATGTATGAGGCACGGGG - Intergenic
1043525839 8:81095712-81095734 CCTAGTATGTAGCAGGCACAGGG - Intronic
1043684384 8:83068287-83068309 CCTTCTCTGTAGCAGAAAAAAGG + Intergenic
1044400113 8:91760452-91760474 CCTTCTCTAGAGGATGCTCAGGG - Intergenic
1045622757 8:104001549-104001571 ACTTCTGTGAAAGAGGCACAAGG - Intronic
1046584992 8:116140278-116140300 CCTTCTCTGAAGAATGCACTTGG - Intergenic
1047218079 8:122895179-122895201 CCTTCTTTAAAGGGGGCACACGG + Intronic
1047766452 8:127993905-127993927 CTTTCTCTGAAGGAATCACAGGG + Intergenic
1047998863 8:130360010-130360032 ACTTCTGTGTAGCAGGCCCAAGG - Intronic
1048428327 8:134343199-134343221 CCTTCAATGTAGGAAGTACAGGG - Intergenic
1048620554 8:136128369-136128391 CCTTCTCTGGAGGAGGCCAGTGG - Intergenic
1048919590 8:139215828-139215850 CCTTCTCCTTAGGAAGAACAGGG - Intergenic
1049391227 8:142372710-142372732 CCTTCTCAGGAGGAGGCCCTTGG - Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1050053765 9:1630779-1630801 CCTTCATCTTAGGAGGCACAGGG - Intergenic
1050801013 9:9614969-9614991 CTTTCTCAGTAGAAGGCACTGGG + Intronic
1051681323 9:19610935-19610957 CCTGCTCTGTTGGAGGAATAAGG + Intronic
1055520453 9:77075590-77075612 ACATCTCTGTAGTAGGTACATGG - Intergenic
1055931003 9:81559850-81559872 CCTTCTCTGTAGGGAGGAGAGGG - Intergenic
1056539010 9:87555358-87555380 CCTTCTCTGTCACAGACACAAGG + Intronic
1058256024 9:102764912-102764934 CCTTTCCTGTAGGAAGTACAAGG + Intergenic
1059172154 9:112135792-112135814 CCTTTTCTGCACTAGGCACAGGG + Intronic
1059251172 9:112889421-112889443 CCTGCTACCTAGGAGGCACAAGG - Intronic
1060795656 9:126510908-126510930 CCTTCTCTGGAGCGGGCACAGGG + Intergenic
1060912904 9:127364740-127364762 CTTTATCTGTTGGAGGCAGAAGG + Intronic
1061706905 9:132460253-132460275 CCTCCACTTTATGAGGCACAGGG + Intronic
1061926750 9:133809692-133809714 CCTGCTCTGGAGGAGGCTCCAGG - Intronic
1062101131 9:134729075-134729097 CCCACCCTGTACGAGGCACAGGG + Intronic
1062158802 9:135068557-135068579 CCTGCGCTGGAGGAGGCACCTGG + Intergenic
1188835271 X:34947699-34947721 CCCCCTCTGTAGGAGTCACTGGG - Intergenic
1192148721 X:68698699-68698721 CCAACTCTGTAGTAGGCCCACGG - Intronic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1199684427 X:150254006-150254028 CCTCCTTTCTAGGAGGCAGATGG - Intergenic
1199929939 X:152507681-152507703 CCTCCACTGTGGGAGGGACATGG - Intergenic