ID: 1156178196

View in Genome Browser
Species Human (GRCh38)
Location 18:34572468-34572490
Sequence CAAAAAGATGATAATAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1065
Summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 952}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156178196_1156178197 24 Left 1156178196 18:34572468-34572490 CCAATATTATTATCATCTTTTTG 0: 1
1: 0
2: 6
3: 106
4: 952
Right 1156178197 18:34572515-34572537 AGATTAAGTAACTCACTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156178196 Original CRISPR CAAAAAGATGATAATAATAT TGG (reversed) Intronic
902045763 1:13523046-13523068 CAAAATAATAATAATAATAGTGG + Intergenic
902559855 1:17270651-17270673 CCAAAAAATAATAATAATAAAGG + Intronic
903421830 1:23223342-23223364 TAAAATAATGATAATAATAATGG - Intergenic
904182006 1:28672548-28672570 AAAAATAATAATAATAATATTGG - Intronic
904308087 1:29603376-29603398 GATAAAGATTACAATAATATTGG + Intergenic
904398350 1:30238787-30238809 GAAAAAGAAGAAAAAAATATAGG - Intergenic
904764865 1:32837578-32837600 AAAAAAGATAATAAGCATATTGG + Intronic
905083127 1:35343203-35343225 TAAAAATATAATAATAAAATTGG - Intronic
905805927 1:40877681-40877703 CAAAATGAGGAAAAGAATATTGG + Intergenic
905845964 1:41232183-41232205 TAAAAAGGTGAGAATAAGATAGG - Intronic
906092845 1:43197376-43197398 ATAAAAAATAATAATAATATTGG + Intronic
906559448 1:46745482-46745504 CAAAAAGGAGATAATAAACTTGG - Intergenic
907075523 1:51574618-51574640 CAAAAAAAAAATAATAATAAAGG + Intergenic
907256884 1:53186018-53186040 AACAAAGATTATTATAATATTGG + Intergenic
907294914 1:53444615-53444637 AACAAAGATTATTATAATATTGG - Intergenic
907570929 1:55483011-55483033 AATAAAAATGAAAATAATATTGG + Intergenic
907728362 1:57041907-57041929 CAAAAACATGATAATAATAGTGG + Intronic
907921488 1:58918377-58918399 CAAACATATGTTAAAAATATAGG + Intergenic
908277505 1:62490679-62490701 CAAAAGAATTTTAATAATATAGG + Intronic
908373826 1:63512661-63512683 CATAAAGTTGATAATAACACAGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909066910 1:70946377-70946399 CAAATAGATGATAACAGAATTGG + Intronic
909132409 1:71754387-71754409 TAAAAAGACCATAATAATAATGG - Intronic
909712176 1:78664390-78664412 AAAAAAGAGGATTATAGTATTGG + Intergenic
910006664 1:82405426-82405448 CAGAAAGGTGATAGGAATATGGG - Intergenic
910249367 1:85179536-85179558 CAAAAGGATCAAGATAATATGGG + Intronic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
912069988 1:105797036-105797058 CAAAAATAGAAAAATAATATAGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912129040 1:106578673-106578695 CATAAGGATTATAATCATATAGG + Intergenic
912190224 1:107329908-107329930 AAAAAAAATGATGATAATGTGGG + Intronic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912367643 1:109148135-109148157 CAAAAAAATAATAATAAAATAGG - Intronic
913229164 1:116727273-116727295 AAAAAAGAGGAAAATAATAGAGG + Intergenic
913267985 1:117063810-117063832 CACAAACAGGATATTAATATTGG + Intronic
913304840 1:117417392-117417414 GAAAAGTATGATCATAATATAGG - Intronic
914138169 1:144920240-144920262 AAAAAAGAAGATAAAAAAATAGG - Intronic
914845017 1:151278471-151278493 CAAAATAATAATAATAATAGGGG - Intergenic
916248982 1:162717412-162717434 ATATAAGATGATAATAATAGGGG - Intronic
916266408 1:162894098-162894120 TAAAATGAGAATAATAATATAGG + Intergenic
916305875 1:163331794-163331816 CAATAACATTAAAATAATATGGG - Intronic
916455841 1:164970261-164970283 CACCAAGAGAATAATAATATTGG - Intergenic
916612905 1:166410372-166410394 CAAAAAGATAATAAGACCATAGG - Intergenic
916685932 1:167146386-167146408 CAAAAAGAAGATAGCAATGTTGG - Intergenic
916908293 1:169314488-169314510 CAAAAATAAGATAATAAAACAGG + Intronic
916995843 1:170299865-170299887 CAAATATATGTTAATAATATAGG + Intergenic
917016175 1:170533232-170533254 CATAAATATGAGAATAATCTAGG + Intronic
917068484 1:171123633-171123655 CATAAAAATGATAATAGTAAAGG + Intergenic
917096724 1:171405410-171405432 AACAAAGATTATTATAATATTGG + Intergenic
917211069 1:172632505-172632527 GGAAAGGATGATAATAATCTAGG + Intergenic
917745251 1:178000519-178000541 TAAAATGATGATAATAGTAATGG - Intergenic
918187228 1:182138862-182138884 CTAAAAAATGATAATTATTTAGG - Intergenic
918384901 1:183995876-183995898 TAAAAATATAATAATAAAATGGG - Intronic
918391257 1:184065297-184065319 CACAAAGATGTTAATAATAGGGG - Intronic
918509550 1:185295820-185295842 CTAAAATATGATTATTATATTGG + Intergenic
918629474 1:186699073-186699095 GCAAAAGATGAAAATAAAATTGG - Intergenic
918662666 1:187108550-187108572 TAAAAAAATAATAATAATAACGG + Intergenic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
918840685 1:189533597-189533619 CAAAAGCATTATTATAATATTGG + Intergenic
919037433 1:192332268-192332290 CAAAGAAATGAGAATTATATGGG + Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920368725 1:205463485-205463507 TATAAAGATGATAGTTATATTGG + Intergenic
920579512 1:207092531-207092553 AAAAAATATTAAAATAATATGGG - Intronic
921138347 1:212283332-212283354 CAAAAAGATGAAAAAAAAATGGG + Intergenic
921512561 1:216050319-216050341 TAAACAGATAATAATAATCTCGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922071123 1:222194437-222194459 CACAAAAATGATAATAAAAGAGG - Intergenic
922526030 1:226304891-226304913 CAAAAAGATTTAAAGAATATGGG + Intronic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923620050 1:235571488-235571510 GTAACAGATGATAATAATAGCGG - Intronic
923814982 1:237367538-237367560 TAAAAAGGTTGTAATAATATTGG + Intronic
923983810 1:239356727-239356749 CCAAAATATGTTAATAATAGGGG - Intergenic
924090404 1:240495231-240495253 CATAAAGATGATGATGATGTTGG - Intronic
924759610 1:246971670-246971692 AACAAAGATTATTATAATATTGG + Intronic
924870477 1:248038395-248038417 CAAAAAGATGAGAAGAATCATGG - Exonic
1062783883 10:243864-243886 CAAAAAAATAATAATAATAATGG + Intronic
1064382335 10:14857094-14857116 TAAAAAGACTATAGTAATATGGG - Intronic
1064505019 10:16019332-16019354 CACAAAGATGATATAGATATGGG + Intergenic
1064530208 10:16301011-16301033 AAAAAAGATTATAATTATAATGG - Intergenic
1064905933 10:20345670-20345692 CTAAAAAATAATAATAATAAAGG + Intergenic
1064969534 10:21050384-21050406 TAAAAAGAGGGAAATAATATAGG - Intronic
1065154551 10:22855908-22855930 CAAAAAAATAATAATAGTACGGG - Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065269639 10:24014979-24015001 CAAAAATATAATAATATTCTTGG + Intronic
1065393928 10:25213986-25214008 GAAAAACATGGTAATAATAAGGG - Intronic
1065747603 10:28856521-28856543 CAAAAACATAAAAATAATAAAGG + Intronic
1065764622 10:29016282-29016304 TAAACAGAAGATAATAAAATTGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066526183 10:36282437-36282459 CAAAACGATACTAATAATATAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068280520 10:54863044-54863066 AACATTGATGATAATAATATGGG - Intronic
1068501309 10:57842207-57842229 CAAAATAAAGATAATAATAATGG - Intergenic
1068508924 10:57938818-57938840 CAGAATGACGATAATAATAGCGG + Intergenic
1068878031 10:62018482-62018504 CGTAAAGATAATAATGATATTGG - Intronic
1069472047 10:68702254-68702276 AGAAAAGATGATAAAAAGATGGG - Intergenic
1069904098 10:71722278-71722300 AAAAAAAATAATAATAATCTAGG + Intronic
1070316311 10:75316520-75316542 CAAAAAAATTAAAATAATATTGG - Intergenic
1070849677 10:79553283-79553305 TAAAAAGAAAATAAAAATATAGG - Intergenic
1070986577 10:80694815-80694837 CAAAAAGATCATAGTAACAGAGG - Intergenic
1071127818 10:82355506-82355528 TAAAGAGATGCTAATAATTTTGG - Intronic
1071175407 10:82920719-82920741 TAAAAAAATGACAATGATATGGG + Intronic
1071230008 10:83575096-83575118 GAAAAAGCTAATAATAAAATAGG - Intergenic
1071754596 10:88522720-88522742 CAAAAAAATGATGAGAAAATTGG + Intronic
1071837223 10:89430060-89430082 CTACAAAATGATAATAATAGAGG + Intergenic
1072215719 10:93285789-93285811 CAAAATAATAATAATAATTTGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073721150 10:106173758-106173780 CAATAAGATTATAATATTATTGG + Intergenic
1073778277 10:106809891-106809913 CAAAAAGATGCTATTAATCATGG - Intronic
1073951307 10:108812800-108812822 CAAAAAGATGAGAAAAAGATTGG + Intergenic
1074407930 10:113195979-113196001 CAAAAAGACATTAATAACATAGG + Intergenic
1075034797 10:119055564-119055586 AATAAAAATAATAATAATATGGG + Intronic
1075347318 10:121692914-121692936 CAAAAAGATGGTTATAATACTGG + Intergenic
1075493908 10:122901322-122901344 TTAAAAAATAATAATAATATAGG + Intergenic
1075512100 10:123080985-123081007 CAAAAAGATGGATATAATCTAGG + Intergenic
1076134101 10:128032972-128032994 CAGAAAGTTGATGATAATGTTGG + Intronic
1076359575 10:129877862-129877884 CAAAAAGATGATATTTATTAGGG + Intronic
1076632815 10:131861762-131861784 CAAAAAAATAATAATAATAACGG + Intergenic
1076989532 11:264168-264190 CAAAATAATAATAATAATTTGGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078713183 11:13815015-13815037 TATAAAGATGATAACAATCTAGG + Intergenic
1078833492 11:15000858-15000880 AAAAAAGATGAAAATGTTATAGG - Intronic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079006627 11:16795788-16795810 CAACAAAATAATAATAATAAAGG + Intronic
1079162005 11:18003874-18003896 CTAAAATAAGATAATGATATTGG + Intronic
1079259160 11:18861246-18861268 CAAAACAATGAAATTAATATTGG - Intergenic
1079550074 11:21684520-21684542 CAAAGAGATTTTAATAACATAGG + Intergenic
1079552543 11:21717682-21717704 CAAAAAGAAGACAATAAGTTAGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080064620 11:27996699-27996721 ACAAAATATAATAATAATATTGG + Intergenic
1080071705 11:28096791-28096813 CAAAAATAAGATATTAATAATGG + Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080322274 11:31024789-31024811 CAAATAGTTGTTAATAGTATGGG - Intronic
1080347858 11:31344982-31345004 AAAAAATATGTTGATAATATAGG - Intronic
1080466577 11:32503160-32503182 CAGAAAGATGAATAAAATATGGG - Intergenic
1080482837 11:32670012-32670034 AAAAAAGATACTAATCATATTGG + Intronic
1080670698 11:34373855-34373877 CTTAAAGATGTTAATAATAGGGG - Intergenic
1080677030 11:34437838-34437860 CAAAAGTATGATAAGAATCTTGG - Intergenic
1080731278 11:34957075-34957097 CAAAAAGAAGATGATAATGATGG + Intronic
1080829111 11:35874907-35874929 CAAAGAGAAGATAACAAGATTGG - Intergenic
1080905557 11:36541445-36541467 CAAAAAGATGGAAAGAATATTGG - Intronic
1081106901 11:39081431-39081453 CAAAACCTTAATAATAATATTGG + Intergenic
1081509149 11:43751286-43751308 CCAAAAAATGAAAATATTATAGG + Intronic
1081782549 11:45723183-45723205 TAAAAAAATAATAATAATAGAGG + Intergenic
1082225222 11:49698077-49698099 AAAAATAATGATAATAATAATGG - Intergenic
1082241368 11:49874808-49874830 GAAAAAGAAAATGATAATATTGG + Intergenic
1082288069 11:50337823-50337845 CAATAAAATGATAGTAATGTTGG + Intergenic
1082646388 11:55731944-55731966 CAAAAAGATAATAAAAATTCAGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082946503 11:58766644-58766666 AAAAAAAATAATAAAAATATAGG + Intergenic
1082983550 11:59145620-59145642 CAAAAAAAGGAAAATAAAATGGG - Exonic
1083130343 11:60619020-60619042 AACAAAGATTATTATAATATTGG + Intergenic
1083927418 11:65816736-65816758 AAAAAAGATGAGAAGAAAATGGG - Intergenic
1084217779 11:67659725-67659747 AACAAAGATTATTATAATATTGG + Intergenic
1084838993 11:71830040-71830062 CAAAAAAATAATAATAATAAAGG + Intergenic
1085932245 11:81097801-81097823 GAAAAAGGTTACAATAATATTGG - Intergenic
1086149937 11:83597931-83597953 CAAAAGGAAGATGATAATATTGG - Intronic
1086184368 11:83996135-83996157 CAATAATATGATAAAAAGATGGG + Intronic
1086313165 11:85559141-85559163 AAAAAAAATAATAATAATAATGG - Intronic
1086535568 11:87840868-87840890 GCAAAAGATGTTATTAATATGGG - Intergenic
1086558763 11:88142778-88142800 CAGAAAGATGAGAAAAAGATAGG + Intronic
1086580093 11:88389735-88389757 TAAAAAGATGAGAAAAATTTAGG - Intergenic
1086586110 11:88453981-88454003 TGAAAAAATGATAATAATACAGG + Intergenic
1086608042 11:88720672-88720694 GAAAAAGTTAAAAATAATATTGG + Intronic
1086756907 11:90576250-90576272 GAAAAAGAAGATAATAGAATAGG + Intergenic
1087478173 11:98664481-98664503 AAAAAAAATCATAATAAAATAGG - Intergenic
1087533313 11:99411357-99411379 AAAAAATATGAAAATTATATGGG + Intronic
1087851473 11:103035114-103035136 CATTAAGATTAAAATAATATAGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088074923 11:105836290-105836312 CAAAAGGAGGGAAATAATATTGG + Intronic
1088088991 11:106015461-106015483 CAAAAATGTCACAATAATATTGG + Intronic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088582569 11:111330305-111330327 TAAAATGAGGATAATAATACTGG - Intergenic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1089381968 11:118039709-118039731 CAAAATAATAATAATAATAATGG + Intergenic
1089434782 11:118455656-118455678 AAAAAAAATAATAATAATAAGGG - Intronic
1090340391 11:126013797-126013819 AAAAAAGATCATAAAAATAAGGG - Intronic
1090589359 11:128248784-128248806 GAGAAAGTTGATAATAATATTGG - Intergenic
1090673892 11:128971163-128971185 TTGAAAGATGATAATACTATGGG + Intronic
1090841750 11:130495615-130495637 CAGAAAGAAGGAAATAATATAGG - Intergenic
1090880345 11:130827263-130827285 ACAAAAAATAATAATAATATGGG - Intergenic
1091098391 11:132845801-132845823 GAAAAAAATAATAATAATGTAGG - Intronic
1092066772 12:5596916-5596938 AAAAAAGATAATAATATAATAGG - Intronic
1092167560 12:6352235-6352257 CAAAATAATAATAATAATAATGG + Intronic
1092198406 12:6564075-6564097 CAAAGAAATGAAAATAAGATGGG + Intronic
1092570076 12:9711628-9711650 AAAAAAAATAATAATAATCTGGG - Intergenic
1092777505 12:11957036-11957058 CAAAAAGAGGGAAATAATAAAGG + Intergenic
1093519870 12:20036221-20036243 TAAAAAAAGGATAAAAATATGGG - Intergenic
1093645202 12:21578221-21578243 CAGAAAGAAGATGATAATGTAGG - Intronic
1093861131 12:24168970-24168992 AAAAAAAATAATAATAAGATAGG + Intergenic
1093962110 12:25285490-25285512 CAAAACCAAGATATTAATATTGG + Intergenic
1094109927 12:26851663-26851685 GAAAAAGATGATATTCATCTAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095328983 12:40934367-40934389 CCAAAGGATGCTGATAATATTGG + Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095634100 12:44411100-44411122 AATAAAGATGAAAATTATATTGG + Intergenic
1095698008 12:45162386-45162408 AAAAAAAATAATAATAAGATAGG - Intergenic
1096763313 12:53861811-53861833 CATAAAAAAGATAAAAATATAGG - Intergenic
1097113176 12:56677652-56677674 AAAAAAAATAATAATAATAATGG - Intronic
1097346310 12:58497223-58497245 AAAAATGATAATAATAATAACGG + Intergenic
1097405639 12:59185903-59185925 CAATTAGATGATAATGATCTTGG - Intergenic
1098074953 12:66719243-66719265 CTAGAAGATAATAATAATAACGG + Intronic
1098210467 12:68159255-68159277 CCAAAAGATGGGCATAATATGGG - Intronic
1098257731 12:68634574-68634596 AAAAAAAAAAATAATAATATAGG - Intronic
1098276606 12:68818240-68818262 TGAAAAGATGATAATTAAATGGG + Intronic
1098368991 12:69738216-69738238 AAAAAAAATAATAATAATAGAGG - Intergenic
1098555361 12:71812755-71812777 TAAAAAAATAATAATAAAATAGG - Intergenic
1098816650 12:75173700-75173722 CAGAAAGTTTATAATAATAAAGG + Intronic
1098938677 12:76509662-76509684 AAAAATGATGATGATAATAATGG + Intronic
1099098205 12:78402355-78402377 CTAAAAGATAATATAAATATAGG + Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099327349 12:81235214-81235236 CAAAAATCAGATGATAATATTGG + Intronic
1099465206 12:82976657-82976679 GAATAAGATGACAAAAATATTGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099638977 12:85259884-85259906 CAAATACAACATAATAATATTGG + Intronic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099684961 12:85873424-85873446 CAAAAAGAGCAGAAAAATATAGG + Intergenic
1100036715 12:90260450-90260472 CAAAAACATAATAAAAATAATGG + Intergenic
1100037127 12:90265635-90265657 AAAAAAAAAGATAAAAATATTGG + Intergenic
1100102720 12:91128426-91128448 CATATAAATGATAAGAATATAGG + Intergenic
1100479881 12:94967816-94967838 CACAAAGATGTTAATATTCTAGG + Intronic
1100725222 12:97401173-97401195 AAAAAAGAAGATAACAATCTTGG + Intergenic
1100832309 12:98528061-98528083 CAAAAAGGAGAAAATAATTTGGG - Intronic
1101127795 12:101655795-101655817 CAGAAAAAGGAAAATAATATAGG + Intronic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1102064718 12:109964741-109964763 CAAAAAGAAGTTAAGAATCTTGG + Intronic
1102203277 12:111072966-111072988 CAAAAAGAAGAAAATAAAAATGG + Intronic
1102338746 12:112105016-112105038 TAAAAAAATAATAATAATAATGG + Intronic
1102436697 12:112929793-112929815 CAAGAAGATGATAATGATGATGG + Intronic
1103582564 12:121926314-121926336 CAAAAAGAAAAAAATAATAAAGG - Intronic
1103599513 12:122045391-122045413 TAAAAAGTTAATAATAATACGGG + Intronic
1103985444 12:124764201-124764223 CAAAATAATAATAATAATAATGG + Intergenic
1104125897 12:125845575-125845597 CAGCAAGATGTTAATAATAGGGG - Intergenic
1105245150 13:18643337-18643359 CATTAAGATGATAATACTGTAGG + Intergenic
1105264551 13:18804452-18804474 CAACAAGATGAGGAAAATATTGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105652959 13:22400813-22400835 CAAAAACCTGATGATAGTATTGG + Intergenic
1105717345 13:23080725-23080747 CAAGAAGATAATCATAAAATAGG + Intergenic
1106161623 13:27205905-27205927 AAAAAAAATAATAATAATAATGG + Intergenic
1107801042 13:44108223-44108245 CAATAATATTATAGTAATATTGG - Intergenic
1108027157 13:46190018-46190040 AAAAAAGATGACAGTCATATTGG + Intronic
1108155474 13:47579714-47579736 AAAGAAAATAATAATAATATAGG + Intergenic
1108928269 13:55780593-55780615 CAAAAGGATGAAGAAAATATGGG + Intergenic
1109137003 13:58664882-58664904 CAAACAGATGTGAATAATAATGG + Intergenic
1109181779 13:59222555-59222577 CAACAAGAGAATCATAATATTGG - Intergenic
1109233223 13:59784379-59784401 TCAAAAAATAATAATAATATAGG - Intronic
1109419687 13:62095407-62095429 TAAAAAACTGATAAGAATATAGG + Intergenic
1109449117 13:62485320-62485342 AAAAAAAAAGATAATAATCTTGG - Intergenic
1109621593 13:64914508-64914530 CACAAAGATTCTAATAAAATAGG - Intergenic
1109978603 13:69874579-69874601 TAAAATGATGACATTAATATAGG - Intronic
1110014330 13:70381134-70381156 AAAAAAGATTATAAATATATTGG - Intergenic
1110477675 13:75936484-75936506 AAACAAGATGATAATATTAAGGG - Intergenic
1110963422 13:81659458-81659480 CAGAAACATGCTTATAATATAGG - Intergenic
1111072007 13:83182627-83182649 CAAAAATAAAATAATTATATTGG + Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111339512 13:86864887-86864909 CATAAAAATGTTAATATTATGGG + Intergenic
1111418547 13:87977996-87978018 TAAAAAGATAATAATAATAATGG - Intergenic
1111463578 13:88578019-88578041 AATAAAGATGATAGCAATATCGG + Intergenic
1111477543 13:88772138-88772160 AAAACAAATTATAATAATATAGG - Intergenic
1111598706 13:90444331-90444353 CAAAAAGATTTTAACAATAAAGG + Intergenic
1112062864 13:95758628-95758650 AAAAAAGTTAATAATAATAATGG + Intronic
1112181060 13:97081240-97081262 GAAAAACATGTTAATAATACAGG + Intergenic
1112666810 13:101584787-101584809 CAAAGAGATGATGAGAATAGTGG + Intronic
1112863370 13:103863011-103863033 CAAGAAGATAATAAATATATGGG - Intergenic
1113043553 13:106129600-106129622 CACAAATGTGATAATAATAAAGG - Intergenic
1113059294 13:106304115-106304137 CCAAAAGATGTAAATAATATGGG + Intergenic
1113210076 13:107967739-107967761 AAAAAAGATGTAGATAATATAGG - Intergenic
1113469240 13:110532675-110532697 CAAAAAAATAATAATTAAATAGG - Intronic
1114150778 14:20037114-20037136 AAAAAAAAAGAAAATAATATTGG - Intergenic
1114311279 14:21469930-21469952 AAAAAAGGGAATAATAATATCGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114805045 14:25825462-25825484 CAAAAGGACAAAAATAATATTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115008590 14:28517023-28517045 GAGAGAGATGATAATAGTATAGG - Intergenic
1115632949 14:35263691-35263713 AAAAATAATAATAATAATATTGG + Intronic
1115797445 14:36954690-36954712 CAAAAAAATGATAAATATGTGGG + Intronic
1115889831 14:38013816-38013838 TAAAAAGATGTTAATAATAGAGG + Intronic
1116065831 14:39981821-39981843 CAAAAAAATGATCATCATACAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116256057 14:42557605-42557627 AGAAAAGTTGATAATAAAATTGG - Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116728634 14:48594070-48594092 CCAAAAGATGAGAACAATAAAGG + Intergenic
1117686887 14:58262551-58262573 AAAAAAAATGGTAATAATTTAGG - Intronic
1117755810 14:58973020-58973042 CAGAAGGAAGATAATAAAATAGG - Intergenic
1117855944 14:60033706-60033728 CTAAAAGAAGATAAAATTATAGG - Intronic
1118061221 14:62139653-62139675 CAAAAACAAGATTATAGTATTGG + Intergenic
1118083770 14:62392900-62392922 CAAAGAGATGAAAATTATAAGGG - Intergenic
1118920835 14:70148685-70148707 CAAAAATATAATAATAATATCGG - Intronic
1119582564 14:75800371-75800393 TAAAAAAATAATAATAATACAGG - Intronic
1120059588 14:79966726-79966748 AAAGATGATTATAATAATATCGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120108923 14:80529645-80529667 GAAAAAAATGAAAATAATATGGG + Intronic
1120115874 14:80617203-80617225 AAAAAAGATGATATTCACATAGG - Intronic
1120238882 14:81926561-81926583 CAAACAGGTGAGAAAAATATGGG + Intergenic
1120374411 14:83683267-83683289 AAAAAAGATTACAATAATAAAGG + Intergenic
1120455156 14:84720089-84720111 GAAAAAGACAATAATATTATAGG + Intergenic
1120588629 14:86347777-86347799 CAAAAATAAAATAAAAATATGGG + Intergenic
1120625356 14:86818962-86818984 CAGAAAAATGAGAATAATATAGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120989959 14:90366666-90366688 AAAAAAAATAATAATAATAAAGG - Intergenic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1121476257 14:94207663-94207685 CAAAAAGATGCTAATAAACATGG - Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123146197 14:106132824-106132846 CTAGAAGATGATGATAATAGTGG + Intergenic
1202891912 14_KI270722v1_random:166971-166993 CAATAAGATGTTAATATTGTGGG - Intergenic
1123809705 15:23911081-23911103 GACACAGATGATGATAATATGGG + Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124692379 15:31835364-31835386 CTGGAAGATGATAATAATACGGG - Intronic
1125049558 15:35281111-35281133 CACAAATATGATATTAAAATAGG + Intronic
1125245942 15:37639627-37639649 AGAAAAAATAATAATAATATAGG + Intergenic
1125569336 15:40703836-40703858 CAGAAAGATGGAAATAATACAGG - Intronic
1125829518 15:42704209-42704231 CAAAGAGATTAAAATAATCTTGG - Intronic
1126103697 15:45134608-45134630 CAGAAACATGAAAATAATCTGGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126859613 15:52871182-52871204 CACAAAGATGTTGATAATAAAGG - Intergenic
1127406172 15:58649094-58649116 CAAATAGAAGATAATAAAATTGG - Intronic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1127496560 15:59518296-59518318 CAAAAAAATGGAAATAATAAAGG - Intronic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1128483343 15:68059308-68059330 CAAAAAAAGGAGAATAATCTGGG - Intronic
1129781592 15:78275673-78275695 CAAGAAGACGATAAAAACATTGG + Exonic
1129938267 15:79469419-79469441 CAATAATATAATAATAATAAAGG + Exonic
1130162108 15:81412003-81412025 CAAAAAGAGCAGAATAAAATTGG + Intergenic
1130225087 15:82050762-82050784 TAAAAATATTTTAATAATATAGG + Intergenic
1130234670 15:82123299-82123321 AAAATAGATAAAAATAATATGGG + Intergenic
1130431636 15:83853729-83853751 CAAATAGATGTTAATGACATTGG + Intronic
1131122786 15:89833343-89833365 AAAAAAGAAGATGATAACATTGG + Exonic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131711572 15:95061549-95061571 CAAAAATATTATAATATAATTGG - Intergenic
1131919656 15:97310488-97310510 CAAAAAGATGCTATTAAAAAGGG + Intergenic
1131945907 15:97620644-97620666 TACAAAGATAATAATTATATAGG + Intergenic
1133345145 16:5064873-5064895 CTAAAAGAGGATAATAATAATGG + Intronic
1133543803 16:6785741-6785763 GAAAATGATGATAACAATAGTGG - Intronic
1133993135 16:10726389-10726411 CATCAAGATGATAATATAATGGG - Intergenic
1134193231 16:12138526-12138548 CAAACAGAATATAATAATGTGGG - Intronic
1134846245 16:17443220-17443242 CTATAAAATGATGATAATATAGG - Intronic
1135093259 16:19539116-19539138 AAAAAAAATAATAATAATAAAGG + Intronic
1135234632 16:20743641-20743663 CAATAAGATGATAAAATTTTTGG - Intronic
1135346025 16:21689219-21689241 CAATATGATGATAACAATGTGGG + Intronic
1136030263 16:27497672-27497694 AAAAAAAGTGATAATAAAATGGG - Exonic
1136571807 16:31102458-31102480 AAATAAAATAATAATAATATAGG + Intergenic
1136869038 16:33786709-33786731 AAAAAACATGATAGTAATTTTGG + Intergenic
1137412218 16:48238613-48238635 CAAAAAAAAGATAATATTATCGG + Intronic
1138570129 16:57865471-57865493 CAAAATAATAATAATAAAATAGG + Intergenic
1138761714 16:59552303-59552325 TAAAAAGATGATAATTAGATAGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139117275 16:63971708-63971730 TAAAAGGTTTATAATAATATTGG - Intergenic
1139555233 16:67704406-67704428 TAAAATGAAGATAATAATAATGG - Intronic
1139738462 16:69014201-69014223 GAGAAAGATGAAAAGAATATGGG - Intronic
1139809319 16:69599570-69599592 CAAAAAGAATAAAATAATGTTGG + Intronic
1140784030 16:78323041-78323063 CAAAAAGAAGAAAATAAAACAGG + Intronic
1141975425 16:87512795-87512817 AAAAAAAATAATAATAATAAGGG - Intergenic
1142824585 17:2500763-2500785 CAAAATTATGATAACTATATGGG - Intronic
1142999079 17:3779969-3779991 TAAAAAAATAATAATAATTTTGG - Intronic
1143581336 17:7829016-7829038 AAAAAAAATAATAATAATAATGG - Intronic
1143666382 17:8364171-8364193 AAAAATAATGATAAAAATATTGG - Intergenic
1143725277 17:8840733-8840755 CACAAAAATAATAATAATAATGG - Intronic
1143753236 17:9046624-9046646 CAAAAAGATGAAAATTAGCTGGG + Intronic
1143755307 17:9062880-9062902 AAAAAAAATAATAATAATACAGG + Intronic
1143924374 17:10356957-10356979 CAAAAAAAAGAAAAAAATATTGG - Intronic
1144141862 17:12357148-12357170 GAAAATGGTGAGAATAATATTGG + Intergenic
1144552121 17:16249938-16249960 CACAAAAATAATAATAATTTAGG - Intronic
1146235803 17:31160797-31160819 CAAACAGAGGCCAATAATATCGG - Intronic
1146761185 17:35480982-35481004 AACAAAGATTATTATAATATTGG - Intronic
1148581775 17:48749015-48749037 AAAAAAGAAGAAAATAAAATTGG - Intergenic
1149040492 17:52182467-52182489 CATAAAGATGATGATGATATTGG - Intergenic
1149121800 17:53177337-53177359 CATATAGATGATATAAATATAGG + Intergenic
1149501470 17:57156097-57156119 AAAAATAATGATAATAATACAGG - Intergenic
1149572357 17:57682164-57682186 AAAAAAAATGCTAATAATTTTGG + Exonic
1149815618 17:59721035-59721057 CAAAAACATGATATAAAAATAGG + Intronic
1149900041 17:60467639-60467661 CATAAAGATGATAAAAAAGTAGG + Intronic
1150845482 17:68653430-68653452 CAAAATGAGGATAATAACGTCGG + Intergenic
1150890960 17:69149312-69149334 CAAAAGGATAATACTAAAATAGG - Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1151579007 17:74967547-74967569 AAAAAATATAATAATAATAATGG + Intronic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153127214 18:1809070-1809092 CATAATGATGTTAATAATACAGG - Intergenic
1153208593 18:2733381-2733403 CATAAATACTATAATAATATGGG + Intronic
1153315429 18:3716813-3716835 AAAAAAGTTTATAATAATATGGG - Intronic
1154276161 18:12962383-12962405 AAAAAAAATAATAATAATAGTGG + Intronic
1154423841 18:14257109-14257131 CAACAAGATGAGGAAAATATTGG + Intergenic
1154468073 18:14669146-14669168 CAAATAGCTGAGACTAATATAGG + Intergenic
1155756359 18:29501862-29501884 TCAAAGGAGGATAATAATATAGG + Intergenic
1155767527 18:29653580-29653602 CACAAAGATGGTAATTCTATGGG + Intergenic
1155901361 18:31394874-31394896 CACTAAGATGATAAGAACATAGG - Intronic
1156087208 18:33420352-33420374 AAAAAAAATAATAATAATAATGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156656619 18:39296169-39296191 CAAAAAGAAGATAATTTTTTTGG - Intergenic
1156943514 18:42798464-42798486 CCAATAGTTTATAATAATATTGG + Intronic
1157655906 18:49387885-49387907 CTAAAATAAGATAATAAAATAGG + Intronic
1157981867 18:52390950-52390972 CAAGAAGATGATAAGACTTTTGG - Intronic
1158594757 18:58806519-58806541 AAAAAAGAAAATAATAAAATTGG - Intergenic
1158693307 18:59680981-59681003 CAAAAACCTGATAATTATCTGGG + Intronic
1159096193 18:63905147-63905169 CAAAAAAATGAAAATTATAAGGG - Intronic
1159214924 18:65379744-65379766 CAAAAAGACCATAATAAGACAGG - Intergenic
1159706339 18:71693219-71693241 TAAAAGTATTATAATAATATTGG - Intergenic
1160809299 19:1006442-1006464 AAAAAAAATAATAATAATACGGG - Intronic
1160954746 19:1685560-1685582 CAAAAAAATAAAAAAAATATTGG + Intergenic
1161868142 19:6849611-6849633 CATAAAGATGGGAATAATATTGG - Intronic
1162037366 19:7948741-7948763 CAAAAAAATTTTAAAAATATTGG + Intergenic
1162159750 19:8702981-8703003 CAAAAATATGATAATTAGCTGGG - Intergenic
1162210253 19:9085656-9085678 CAAAATAATAATAATAATAATGG + Intergenic
1162236254 19:9312102-9312124 AACAAAGATTATTATAATATTGG - Intergenic
1162638685 19:11990033-11990055 AACAAAGATTATTATAATATTGG + Intergenic
1162868577 19:13568226-13568248 CTAAATGATAATAATAATAATGG + Intronic
1162890420 19:13728796-13728818 CAAAACTATGATATTAACATTGG + Intergenic
1162957986 19:14110316-14110338 CAAAAAAATAATAATACTCTGGG + Intronic
1164271917 19:23680302-23680324 CAAAAAAATAAAAATAAAATAGG + Intronic
1164894597 19:31861519-31861541 CAAAAAAATGATAAATATGTGGG + Intergenic
1165442433 19:35837520-35837542 CAGAAAGAAGAAAATAATAATGG - Intronic
1166101652 19:40575146-40575168 ACAAACAATGATAATAATATGGG - Intronic
1166583800 19:43927503-43927525 CACAAAGATGATATTATAATGGG + Intronic
1166794141 19:45416134-45416156 CAAAAAAATAATAATAAAGTGGG + Intronic
1166801682 19:45461574-45461596 TAAAAAAATAATAATAAAATAGG + Intronic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1167874662 19:52401781-52401803 CAAGCAGATGTTAATAATTTTGG - Intronic
1168039498 19:53746616-53746638 AACAAAGATTATTATAATATTGG + Intergenic
1168431316 19:56283245-56283267 AATAATGATGATAATAGTATTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925316132 2:2925471-2925493 AAAAAAGATAATAATTATCTGGG + Intergenic
925668584 2:6288563-6288585 CAAAAGAATGACAATAATTTAGG + Intergenic
926998033 2:18759407-18759429 CAAAATTATGATAACTATATTGG - Intergenic
927258399 2:21061070-21061092 AATAATGATGATAATAATAGGGG + Intergenic
927694027 2:25228283-25228305 AAAAAAAATAATAATAATAAAGG + Exonic
928497132 2:31844735-31844757 CAAAAGGGTAATAATAATACAGG - Intergenic
928941113 2:36728243-36728265 TAAAATAATGATAAAAATATAGG - Intronic
930415160 2:51081479-51081501 CAAAGATATGTTAATAATTTAGG - Intergenic
930462915 2:51706714-51706736 CAATAAGATGAAAGTAATCTGGG + Intergenic
930651192 2:53966568-53966590 AAAAAAAAAGATAATAATGTTGG + Intronic
930699040 2:54440623-54440645 CAAAAAGGAGACAACAATATAGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930947714 2:57095578-57095600 CCAAGAGGTGGTAATAATATGGG - Intergenic
931390011 2:61833445-61833467 AAATGTGATGATAATAATATAGG + Intronic
931592373 2:63899349-63899371 TAAAAAAATGATAATCATATTGG + Intronic
933457303 2:82532236-82532258 CAATAAGATGATATTCAGATAGG + Intergenic
933494875 2:83037579-83037601 CAAAATAATAATAATAATAAAGG + Intergenic
934068343 2:88360775-88360797 CACAAAGATGAGCATAACATAGG + Intergenic
935279523 2:101505568-101505590 CAAAAAAATAATAATAACACTGG + Intergenic
935798631 2:106670463-106670485 CAGAAAGATGAGAAAAAAATGGG + Intergenic
936126132 2:109790320-109790342 AAAAAAGATAATAATAATAAGGG + Intergenic
936144364 2:109969906-109969928 AACAAAGATTATTATAATATTGG - Intergenic
936181047 2:110267866-110267888 AACAAAGATTATTATAATATTGG - Intergenic
936200324 2:110401563-110401585 AACAAAGATTATTATAATATTGG + Intergenic
936218561 2:110581148-110581170 AAAAAAGATAATAATAATAAGGG - Intergenic
936645783 2:114368619-114368641 CAAAGACATGATAAAAATGTAGG - Intergenic
936653664 2:114459038-114459060 GAGAAAGAGGAGAATAATATAGG + Intronic
936654856 2:114473083-114473105 AAAAAAAATGATAATAAGCTTGG - Intronic
936821926 2:116531608-116531630 CAAAAACTTGAAAAGAATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
936948554 2:117953893-117953915 CAAAAAAATGAAAATAAAAGAGG + Intronic
937827704 2:126385957-126385979 CAAAAAGAAGACACTAACATAGG - Intergenic
938869640 2:135461755-135461777 CAAAAAAATGATTCAAATATAGG + Intronic
939287266 2:140148401-140148423 AAAGAAGATGTTATTAATATTGG - Intergenic
939326443 2:140696081-140696103 TAAAAACATGAAAATAATTTTGG + Intronic
939387461 2:141518950-141518972 CAAAAAAATAAAAATAAAATAGG + Intronic
939462207 2:142511706-142511728 CAAATACATAATAATAATATTGG - Intergenic
940232837 2:151476380-151476402 TAAAAAGATGAAACAAATATGGG - Exonic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940462864 2:153989462-153989484 CCAAAAGAGGAAAATTATATTGG - Intronic
940631011 2:156238781-156238803 AAAAAAAATGATTATAATGTTGG - Intergenic
940650110 2:156434001-156434023 GAAAAAAATGATAAAAATATTGG + Intergenic
940759805 2:157725476-157725498 CAAAAGGATGCTTATAATAGAGG + Intergenic
940807113 2:158200140-158200162 AAAAAAGATGATCATTATCTAGG + Intronic
940900424 2:159121666-159121688 CAAAAAGATGTTAATGGTTTAGG + Intronic
941101312 2:161298627-161298649 AATAAAGATGAAAATAATTTGGG - Intergenic
941206420 2:162578862-162578884 GAAAATAATAATAATAATATTGG - Intronic
941222159 2:162796065-162796087 AAACAAGATGCAAATAATATTGG - Intronic
941511949 2:166422546-166422568 CACTAAGATGAAAATAATCTTGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941780860 2:169443316-169443338 CAAAAGGAAGAAAATAATAAAGG + Intergenic
942443710 2:176063238-176063260 TAAAGAAATAATAATAATATGGG + Intergenic
942979745 2:182066095-182066117 CAAAAAGCTGATAAGATTTTGGG - Intronic
943174933 2:184459660-184459682 CAAATCCATTATAATAATATGGG - Intergenic
943494557 2:188605264-188605286 AAAAAAGATACTAATAATAGGGG + Intergenic
943818504 2:192287807-192287829 GAAAAAGAAGATAATAGCATAGG - Intergenic
943948191 2:194094290-194094312 CAAAAAGAATATAATAAAAAAGG + Intergenic
944029887 2:195222770-195222792 TGAAAAGATGACAATGATATGGG + Intergenic
944298901 2:198100262-198100284 TAACAAGATGGAAATAATATAGG + Intronic
944559864 2:200925435-200925457 CAAAAAGATTATTTTAATAATGG - Intronic
944691183 2:202159842-202159864 CAAAAAAATAATAATAATACTGG + Intronic
944762048 2:202825963-202825985 GAAAAAAATGATAAATATATGGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945569474 2:211447444-211447466 CAAAGATATGAAAATAAAATGGG + Intronic
945651522 2:212566914-212566936 TGAAAATATAATAATAATATAGG + Intergenic
945704877 2:213217718-213217740 CATTTAGCTGATAATAATATTGG - Intergenic
945869826 2:215214975-215214997 CAAAATAATAATAATAATAAAGG + Intergenic
946151322 2:217773568-217773590 GAAAAAGAGGAAAATAATTTTGG - Intergenic
946232185 2:218298490-218298512 AAAAAGGGTGGTAATAATATAGG + Intronic
946305054 2:218851750-218851772 AAAAAAAATAATAATAATAGGGG - Intergenic
946543369 2:220710467-220710489 CAAAAATAGCATAATGATATTGG - Intergenic
946882366 2:224189254-224189276 GAAATAGATGATAAGAATAGTGG - Intergenic
946916993 2:224533356-224533378 CTATAAAATGAAAATAATATTGG - Intronic
947129041 2:226903034-226903056 TGAAAAGAATATAATAATATTGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947606313 2:231488229-231488251 CAAGAAGAAGCCAATAATATTGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948119630 2:235519768-235519790 AATAATGATAATAATAATATTGG - Intronic
1168861644 20:1049884-1049906 AAAAAAAATAATAATAATAAAGG - Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170129665 20:13005476-13005498 CATAAAGAAGAAAATAACATGGG + Intergenic
1170278642 20:14621114-14621136 AAAAATGAGGATAATAATACTGG + Intronic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170447924 20:16449049-16449071 TAAATAGATGAAAATAATGTAGG + Intronic
1170819674 20:19745960-19745982 CAAAACGATGTAAATAATCTTGG - Intergenic
1171069310 20:22050878-22050900 ATACAAGATGATAATAATAATGG - Intergenic
1171418846 20:25003466-25003488 CCAAAAAATGATAAATATATGGG + Intergenic
1172352668 20:34255623-34255645 AACAAAGATTATTATAATATTGG - Intronic
1173399641 20:42713057-42713079 GAAAAAGAAGATAATATGATGGG + Intronic
1173683459 20:44904939-44904961 CATAAAGATGAAAATATTAAAGG - Intronic
1174460229 20:50677339-50677361 CAAGAAAATAATAATAATAATGG - Intronic
1174679834 20:52395454-52395476 AAAAAAAATAATAATAATAATGG + Intergenic
1175088940 20:56485894-56485916 CAAACAGATGGTAAAGATATTGG + Intronic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1175578404 20:60079756-60079778 TAAAAAGAGGAAAATAATATTGG - Intergenic
1176452291 21:6874630-6874652 CATTAAGATGATAATACTGTAGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176691098 21:9910671-9910693 CAGAAAGAAGAAAATAATAAAGG + Intergenic
1176704231 21:10099171-10099193 TAAAATGATAATACTAATATTGG - Intergenic
1176806442 21:13488504-13488526 CAAATAGCTGAGACTAATATAGG - Intergenic
1176830463 21:13739679-13739701 CATTAAGATGATAATACTGTAGG + Intergenic
1176849629 21:13902899-13902921 CAACAAGATGAGGAAAATATTGG - Intergenic
1176913180 21:14593143-14593165 TAATAACATGTTAATAATATTGG + Intronic
1176988016 21:15460526-15460548 CAAAAAAATTATAATCCTATTGG - Intergenic
1177031648 21:15987539-15987561 AAAAAAAATAATAATAATCTAGG + Intergenic
1177295731 21:19172677-19172699 AAAAAATATGATCAAAATATAGG - Intergenic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177393545 21:20506358-20506380 CAAGAAGAAGAAAAGAATATCGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177697542 21:24592796-24592818 ATAAAATATGATAATAATATTGG + Intergenic
1177818643 21:26005421-26005443 GAAAAAAATAATGATAATATAGG + Intronic
1177851608 21:26355404-26355426 CTATAAGATGATAATCATAGGGG + Intergenic
1177986987 21:27988736-27988758 GAAAATCATGATTATAATATTGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178256777 21:31060373-31060395 AAAAAAAATTATAATAATAAAGG + Intergenic
1178783655 21:35632320-35632342 CTCATAGATGATATTAATATTGG - Intronic
1179045517 21:37841446-37841468 CAAAAAAAGTATAATAATAGTGG - Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179203560 21:39250336-39250358 CAAAAATATGATGATAAAAAAGG + Intronic
1179911584 21:44452355-44452377 CAGAAAGTGGATGATAATATGGG + Intergenic
1180202905 21:46237401-46237423 AAAAAAAATAATAATAAAATTGG - Intronic
1182409624 22:30172583-30172605 TACAAAGATGATGAAAATATTGG + Intronic
1182788827 22:32931608-32931630 AAGAAAGATGAAAATAATATCGG - Intronic
1183914481 22:41105879-41105901 ATAAAAGATGATAATTATACAGG - Intronic
1184020183 22:41815647-41815669 AAAAAAAATAATAATAATGTAGG - Intronic
1185090467 22:48766031-48766053 CAGAAAGAAGAAAATAATAAAGG - Intronic
1185350531 22:50334419-50334441 AACAAAGATTATTATAATATTGG + Intergenic
1185355701 22:50368495-50368517 AACAAAGATTATTATAATATTGG + Intronic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
949331392 3:2927132-2927154 CACTAAGAAAATAATAATATGGG + Intronic
950636066 3:14315789-14315811 AAAAAAAATAATAATAATAAGGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951011339 3:17684019-17684041 CAAATATATGTTAATAATAGGGG + Intronic
951236556 3:20242773-20242795 CAAAAAGATTATGATCAAATAGG + Intergenic
951325282 3:21295372-21295394 CAAAATAATAATAATAATAATGG - Intergenic
951482574 3:23177357-23177379 AAAAAAAATAATAATAATTTAGG + Intergenic
951843502 3:27060856-27060878 CACAAAGAAAGTAATAATATAGG + Intergenic
951870207 3:27353571-27353593 CAAAAATATGACAAATATATTGG - Intronic
952112577 3:30141120-30141142 CAAAATGATAAGAAAAATATGGG + Intergenic
952179603 3:30903763-30903785 CAATAATATGAAAATAAAATTGG + Intergenic
952643745 3:35630745-35630767 TAAAAAGACAATAATCATATGGG + Intergenic
953159190 3:40402616-40402638 CAATAATATGATAATAATAATGG - Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955882928 3:63566861-63566883 CATAAAGCTGATAAAAATAATGG - Intronic
955923863 3:63986552-63986574 CAAAAAGTTTATAAAAATAATGG - Intronic
956024249 3:64965436-64965458 AAAAAAAATAATAATAATGTTGG - Intergenic
956049092 3:65228349-65228371 TTAAAAAATAATAATAATATGGG + Intergenic
956064842 3:65386691-65386713 AAAAAAAGTGATATTAATATTGG - Intronic
956787147 3:72652201-72652223 CAGAAAGAAGATGATAAAATTGG + Intergenic
956838868 3:73118420-73118442 CAAAAAGATAATAGTAATAATGG - Intergenic
956909743 3:73805412-73805434 CAATAAAATTATAGTAATATTGG - Intergenic
957009477 3:74987018-74987040 CAAAATGAAGACATTAATATTGG - Intergenic
957161314 3:76612714-76612736 AAAAATAATAATAATAATATTGG + Intronic
957273214 3:78057714-78057736 CAAATAGATTAGAATAAAATGGG + Intergenic
957751455 3:84422177-84422199 TAAAAAAATAATAATAATAATGG + Intergenic
957816596 3:85307881-85307903 CAAAATGAAGATATTAAAATAGG + Intronic
957825029 3:85430516-85430538 TCAAAAAATAATAATAATATTGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958421283 3:93934210-93934232 TAAAAAAATAATAATAATAATGG + Intronic
958464319 3:94439725-94439747 AAAAAAAATGGTAATAATTTGGG + Intergenic
958534030 3:95372628-95372650 AAACAAAATGATAACAATATGGG - Intergenic
958574793 3:95935098-95935120 AGAAAATATGGTAATAATATAGG - Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959235827 3:103720148-103720170 CAAAAATATGAAAATAATAATGG - Intergenic
959528981 3:107410196-107410218 CAAAAGAATTTTAATAATATAGG + Intergenic
959665437 3:108915860-108915882 CAAATAAATCAGAATAATATAGG - Intronic
959714311 3:109416195-109416217 CAAAATAATAATAATAATAAAGG - Intergenic
960015563 3:112884341-112884363 CAAAAACTTCATAATACTATTGG - Intergenic
960109738 3:113834176-113834198 CAAAATAATAATAATAATAATGG - Intronic
960218300 3:115070991-115071013 AAAAAAAAAGATAATAATAATGG + Intronic
960322857 3:116258253-116258275 TAAAAAAAAGATTATAATATAGG - Intronic
960850618 3:122049481-122049503 CAGCAACATGATAATAATAGAGG - Intergenic
961759037 3:129151628-129151650 CAAAAAAAAGAAAATTATATAGG + Intronic
961989183 3:131169083-131169105 GAAAAAGATGAAATAAATATAGG + Intronic
962279230 3:134037720-134037742 GAAAAATATGATAGTAATAATGG - Intronic
962487963 3:135863228-135863250 CTAAAACAGGATGATAATATAGG + Intergenic
962508046 3:136068287-136068309 CAACAAAATGATGATAGTATAGG + Intronic
962551477 3:136496950-136496972 CATAAAGTTGGTCATAATATTGG - Intronic
962680466 3:137794387-137794409 AATAATGATGATAATAATAATGG - Intergenic
962773611 3:138637314-138637336 CATAAAGATAAAAATCATATAGG - Intergenic
962895364 3:139709160-139709182 TATAAAGATGACTATAATATAGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963238755 3:142982174-142982196 TAAAAAGGAGATAATTATATTGG - Intronic
963321377 3:143813184-143813206 CAAACAGAAAATGATAATATTGG + Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963685839 3:148432841-148432863 AAAAACCATGATAACAATATTGG + Intergenic
963875390 3:150469348-150469370 CATTAAGATGATAACAAAATTGG - Intergenic
963877885 3:150497207-150497229 CACAAAAATGAGAAAAATATGGG + Intergenic
964071116 3:152634488-152634510 TAAAATGAAGATGATAATATGGG - Intergenic
964105367 3:153034069-153034091 TAAAATAATAATAATAATATTGG - Intergenic
964228196 3:154431614-154431636 AGAAATGATGATAATAATAGGGG - Intergenic
964243030 3:154617836-154617858 CAAAAAAAAGAAAATAACATAGG + Intergenic
964502490 3:157363818-157363840 AAAAGAAATAATAATAATATTGG + Intronic
964583880 3:158273736-158273758 TTAAAACATGATAATAATCTTGG + Intronic
965267717 3:166567291-166567313 CACAAAGAGAATAATACTATTGG - Intergenic
965365623 3:167795688-167795710 CAAAAAGATAATGTTATTATGGG - Intronic
965683951 3:171281989-171282011 CCAAAAAATAATAATAATAATGG + Intronic
965742346 3:171889305-171889327 CAAAAAAATGCTAACAATAAAGG - Intronic
965852471 3:173045310-173045332 CAAAAAGCTGAGAAGATTATGGG + Intronic
965967446 3:174510711-174510733 CAGAAAGAAGAAAATAATAAAGG - Intronic
966075355 3:175930269-175930291 CAAACAAATAATAATAATAACGG - Intergenic
966396027 3:179504084-179504106 GAAAAAGATTATAATACTAAAGG - Intergenic
966598622 3:181751583-181751605 TAAAAAAATAATAATAATAAGGG - Intergenic
966621656 3:181971015-181971037 AAAAAAAATAATAATAATAATGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966985342 3:185174962-185174984 TAAAACGGTGATAATAATACTGG + Intergenic
967099477 3:186204405-186204427 CAAAATAATAATAATAATAATGG + Intronic
967454710 3:189671196-189671218 CAAAAATATGATTTTAATAATGG + Intronic
968080243 3:195841318-195841340 CTAAAAAATAATAATAATAAGGG - Intergenic
968418491 4:461872-461894 CAAAAAAATAAAAATAGTATTGG + Intronic
968846763 4:3047430-3047452 AACAAAGATTATTATAATATTGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969253273 4:5984363-5984385 CAAAGAGATGATCCAAATATTGG + Intronic
969780413 4:9397537-9397559 AAAAAAAATAATAATAATAAAGG + Intergenic
970322916 4:14893205-14893227 CAAAACGATGATGATATTAATGG - Intergenic
970325069 4:14915499-14915521 CAAATAGATGATACTATTGTGGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971024814 4:22578766-22578788 CAAAAGGAGGATAATAGTTTTGG + Intergenic
971160629 4:24130149-24130171 AAAAAAAATAATAATAATAATGG + Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971872057 4:32253883-32253905 AAAAAAGATTCTAATATTATAGG - Intergenic
971892144 4:32538588-32538610 CAAAAATGTGATATTAATTTAGG - Intergenic
971949459 4:33325926-33325948 CCAAAATATAATAATAATAATGG - Intergenic
972013216 4:34210378-34210400 CAAAAAAATGATAAATATTTAGG + Intergenic
972140216 4:35950014-35950036 CAAAAACATGGGAATAATATTGG - Intronic
972388493 4:38590614-38590636 TAAAAAGGTAATGATAATATAGG + Intergenic
972521610 4:39863156-39863178 TAAAAAGAAGATAATTATATGGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972916625 4:43888910-43888932 CAAAAATGTGATAATAGTAATGG - Intergenic
972926209 4:44011948-44011970 CAAAAGTATCATAATATTATTGG + Intergenic
973178075 4:47232859-47232881 AAAAATGATGATCATAATCTGGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973726080 4:53777352-53777374 CAAAAAGATGATAAGACCAAAGG + Intronic
974185845 4:58445111-58445133 TAAGAAGATGAGAATGATATTGG - Intergenic
974393007 4:61297687-61297709 CAAAAATAAGAGAATAATTTAGG - Intronic
974532392 4:63125559-63125581 CAAAAGTATAAAAATAATATGGG - Intergenic
974629842 4:64473509-64473531 CAAAAACGTGGAAATAATATGGG + Intergenic
974692470 4:65315190-65315212 CAAAAAGAAGATAATAATCTTGG + Intergenic
974698423 4:65405624-65405646 AAAACAGCTGTTAATAATATTGG - Intronic
974731497 4:65872323-65872345 CAAAATAATAATAATAATAATGG + Intergenic
974869679 4:67625136-67625158 GAAAAAGATGATGATCATAATGG - Exonic
975329262 4:73095689-73095711 CAAAAAAAAAATAATAATAAAGG - Intronic
975432711 4:74313973-74313995 CAAAAATATAATAATAATAAGGG + Intronic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975842978 4:78495755-78495777 CAAAATAATAATAATAATAAAGG - Intronic
976010945 4:80488035-80488057 CCAAAAGTTAATAATAATCTTGG + Intronic
976113972 4:81706874-81706896 TAAAATGAGGATAATAATAGTGG - Intronic
976386020 4:84459520-84459542 CAAAGAGATGATTATAGCATAGG - Intergenic
976450423 4:85183409-85183431 CAAAAAGAGGACAATAACTTGGG - Intergenic
976562995 4:86523130-86523152 CATAAAGGTAATAATAATAAAGG - Intronic
976954486 4:90878922-90878944 CAAAAAAATGCCAATAATAGTGG - Intronic
977365259 4:96059722-96059744 CATAAAGACGCTACTAATATGGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977420205 4:96789948-96789970 GAAAAAGATGAAAATATTCTAGG - Intergenic
978086209 4:104658402-104658424 CAAAAAGATGAACATAGTATTGG + Intergenic
978478006 4:109154132-109154154 CATAAAGATGATAATCATAAAGG - Intronic
979089577 4:116465140-116465162 AAAAAAAATAATAATAATAATGG - Intergenic
979752880 4:124301177-124301199 CAAAAACATTACAATAAAATGGG + Intergenic
979815075 4:125090863-125090885 CAAAAAGATGACAAGGATAAGGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980737652 4:136912146-136912168 GAAAAAAATGATAAAAACATTGG - Intergenic
980786727 4:137565762-137565784 CAAAAAAATTATAAGAAAATAGG + Intergenic
981092264 4:140744095-140744117 CTTAAAGTTGATAATAATAATGG + Intronic
981168441 4:141591303-141591325 CTAAAATTTTATAATAATATTGG + Intergenic
981469769 4:145118595-145118617 AATCAAGTTGATAATAATATGGG + Intronic
981659796 4:147152870-147152892 CTAAAACATGAAAACAATATCGG - Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982539745 4:156653828-156653850 CATATAAATAATAATAATATAGG + Intergenic
982762100 4:159297182-159297204 CTAAAACATTATCATAATATAGG + Intronic
982929159 4:161380087-161380109 CATAAAAATTATTATAATATAGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983790247 4:171787858-171787880 GATAATGATGATAATAATGTTGG - Intergenic
983977206 4:173950248-173950270 CAAAAACAAAATAAGAATATGGG - Intergenic
984010286 4:174362729-174362751 CAAATATATGATATTAATAATGG + Intergenic
984032918 4:174626989-174627011 AAAAATGATGAAAATAATCTTGG - Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984519266 4:180782254-180782276 CCAAAAGAAGATAATAATGCAGG - Intergenic
984537563 4:180995790-180995812 CAAAAATAAAATAATAATAACGG - Intergenic
984711602 4:182890111-182890133 TAATAAGATTTTAATAATATTGG + Exonic
984990400 4:185375077-185375099 CCAAAAGAAGAAAATAATATTGG + Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986357263 5:6941039-6941061 CAAAGAGCTCATAATAACATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
986916893 5:12631681-12631703 AAAAAAGTTGATTAAAATATTGG + Intergenic
987577068 5:19743599-19743621 CAAAAAGTTGATGATATTATAGG - Intronic
987738225 5:21871944-21871966 CAAGTAGATAATAATGATATTGG + Intronic
987954855 5:24726110-24726132 GAAAAAAATGATAAAAATGTTGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988052461 5:26048797-26048819 TATAAAGAAAATAATAATATAGG - Intergenic
988091519 5:26546377-26546399 CAATAACAAGTTAATAATATCGG + Intergenic
988235829 5:28542786-28542808 GAACAAGTTGATAATGATATAGG - Intergenic
988430139 5:31109759-31109781 CAAACAAATGATAAAAATCTAGG - Intergenic
989208807 5:38838873-38838895 CTAAAAGATGATGTAAATATTGG + Intergenic
989234315 5:39127278-39127300 TAATAACATGATTATAATATAGG - Intronic
989456082 5:41646098-41646120 CAAATAGAGGATAATAAAAATGG + Intergenic
989589492 5:43100318-43100340 AAAAAAGATTTTGATAATATTGG - Intronic
989760636 5:45011966-45011988 GAAAAAGAAGGTAATAATTTTGG + Intergenic
989783219 5:45295235-45295257 CAAAAAGGTGACAACCATATTGG - Intronic
990251491 5:53920197-53920219 CAAAAATAAAATAATAATTTGGG - Intronic
990372529 5:55135285-55135307 CTAAAATATCAGAATAATATAGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990551487 5:56884451-56884473 CAGAAAAATGACAAAAATATTGG - Intronic
990807621 5:59683699-59683721 ATAAAAGAAGATAAAAATATAGG - Intronic
991223465 5:64242685-64242707 GAAAAAGATGTAAATAATACAGG + Intronic
991638105 5:68726341-68726363 AGAAAAGATGATAATGAGATGGG - Intergenic
991708532 5:69383679-69383701 TAAAAAAATGATAATAATAATGG - Intronic
992977145 5:82132236-82132258 AAAAAAAATAATAATAATAATGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993072298 5:83180266-83180288 AAAACAGATGATCATAGTATAGG + Intronic
993103513 5:83571246-83571268 TGATAAGATGAAAATAATATTGG - Intronic
993107943 5:83621366-83621388 CAACAACATCATGATAATATAGG - Intergenic
993234257 5:85282402-85282424 GAAGAATATGTTAATAATATAGG + Intergenic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993350141 5:86839783-86839805 ATAAAAAATGGTAATAATATTGG + Intergenic
994051947 5:95372266-95372288 GCAAAAGATGAAAATAATACAGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994368571 5:98944450-98944472 CAACAAGTTGCTAAAAATATTGG + Intergenic
994414583 5:99453063-99453085 CAAAGAAATGATAAATATATGGG + Intergenic
994627915 5:102243882-102243904 CAAAAAGACTGAAATAATATTGG + Intronic
994947236 5:106410565-106410587 CTAAAAGGTAATAATAATAATGG + Intergenic
995136710 5:108686731-108686753 TAAAAAGAAAAAAATAATATTGG + Intergenic
995166404 5:109048280-109048302 GATAAAGATGATAATGATCTAGG - Intronic
995467663 5:112467222-112467244 CAGAAAGAGTATAATAATACTGG - Intergenic
995516157 5:112955793-112955815 AAAAAAAATAATAATAATAATGG + Intergenic
996283790 5:121764881-121764903 CAAAAAGACCATATTATTATAGG + Intergenic
996625525 5:125566148-125566170 AAAAAAAATAATAATAATAATGG - Intergenic
996686390 5:126285965-126285987 AAAGAAGATGATAAACATATGGG - Intergenic
996871311 5:128196215-128196237 CAAGAAGATGATTAGAATTTGGG - Intergenic
996918706 5:128741637-128741659 CAGAAAGATAATAATCATAGAGG + Intronic
996946975 5:129082220-129082242 CAATAATATGATAAGAGTATGGG + Intergenic
997166448 5:131664815-131664837 CATAAAGAGTATAAAAATATGGG + Intronic
997700530 5:135895230-135895252 CAAAGAAATGTTCATAATATAGG + Intronic
998833854 5:146185631-146185653 CAAAGAGATGAAAATAGTACTGG - Intergenic
999010680 5:148035464-148035486 CAATAAAATAATAATAACATAGG + Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999488097 5:152020421-152020443 AAAAAAGATAAAAATAATAACGG - Intergenic
999533326 5:152487195-152487217 CAAAATGATGATGATACCATTGG + Intergenic
999887966 5:155944913-155944935 AAAAAAAATAATAATAATAAGGG + Intronic
1000487271 5:161863009-161863031 CAAAAAGATGAGATTAGTACTGG - Intronic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1001066641 5:168540064-168540086 CAGAAAGATGAAAATATTAATGG - Intergenic
1001203435 5:169740274-169740296 AAAAAAGAAGTTAACAATATGGG - Intronic
1002256210 5:177960081-177960103 CAAGATGATGATAAGAAAATTGG - Intergenic
1003216169 6:4114746-4114768 CAAAATGAAGATAAAAATCTAGG - Intronic
1003613458 6:7633890-7633912 CAAAAACACAATAATAATAATGG - Intergenic
1003724276 6:8742221-8742243 AAAAAAAATAATAATAATAATGG + Intergenic
1003786070 6:9488382-9488404 GAATAATATGAGAATAATATTGG - Intergenic
1003989157 6:11468800-11468822 AAACAAAATGCTAATAATATGGG + Intergenic
1004094533 6:12539437-12539459 CAAAGAAATGATAAGAATAGGGG - Intergenic
1004306147 6:14503586-14503608 TAAAATGAAGGTAATAATATAGG - Intergenic
1004663732 6:17732289-17732311 CTAAAAAATAATAATAATAAGGG - Intergenic
1004673071 6:17815644-17815666 AACAAAGATTATTATAATATTGG + Intronic
1004845006 6:19631641-19631663 CAAAAAGAGAAAAAAAATATAGG + Intergenic
1005122301 6:22403078-22403100 AAAAAAGATTATAATCATGTGGG - Intergenic
1005143914 6:22665499-22665521 TAAAAAGATGAAAATAAGGTAGG - Intergenic
1005389255 6:25316708-25316730 AAAAAAAATTATAATAATAATGG - Intronic
1005922105 6:30411472-30411494 AACAAAGATTATTATAATATTGG - Intergenic
1006119969 6:31798070-31798092 AAAAAAAATAATAATAATAATGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007435757 6:41809524-41809546 CAAAAAGAAAATAATAAAATAGG + Intronic
1007537576 6:42607501-42607523 CAACAAAATGATAATAATACAGG - Intronic
1008195094 6:48509001-48509023 CAAAAAGAAGATAATAACTAAGG + Intergenic
1008309251 6:49945428-49945450 TATAAAGATGATATTACTATCGG + Intergenic
1008313372 6:50006850-50006872 CAAAATAATGATAATACTCTGGG - Intergenic
1008314361 6:50021792-50021814 AAAAAATATGATAATAACATAGG - Intronic
1009215653 6:60917023-60917045 CAAAATGGGTATAATAATATTGG - Intergenic
1009416677 6:63423343-63423365 CAAAAAAATAATAATAATCTGGG + Intergenic
1009485016 6:64210498-64210520 CAAAATGATGCTATTAGTATGGG - Intronic
1009502189 6:64428749-64428771 TTAAAACAAGATAATAATATAGG - Intronic
1009504397 6:64456969-64456991 AAAAAAGGTCATAATAACATTGG - Intronic
1009535537 6:64878231-64878253 AGAAAATATGATAATAATAATGG + Intronic
1009611785 6:65953537-65953559 CATAAAAATAATAATAGTATGGG + Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010293875 6:74172965-74172987 CAAGCAGATAATAATTATATTGG + Intergenic
1010391243 6:75340427-75340449 CAAAAAGATGACTATGATAATGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010881609 6:81181148-81181170 TAACAAGATTATAAAAATATTGG + Intergenic
1010965765 6:82206064-82206086 CCAAAAGCTTATAATAATCTAGG + Intronic
1010967959 6:82234325-82234347 AAAAAAAATAATAATAAAATAGG - Intronic
1011240374 6:85266023-85266045 AAAAAAGATGAAAAAAATAATGG - Intergenic
1011471745 6:87715046-87715068 CACCAAGAGGATAATAGTATAGG + Intergenic
1011592142 6:88980413-88980435 CAAAAAAGTAATAATAAAATAGG - Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012366503 6:98447128-98447150 GAAGACCATGATAATAATATTGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012631599 6:101476645-101476667 CAAAAATATAATTATCATATAGG - Intronic
1012635707 6:101537590-101537612 CAAAGAGAAGGTAATATTATTGG + Intronic
1012737601 6:102970436-102970458 CAGAGAAATGATTATAATATTGG - Intergenic
1013240020 6:108236361-108236383 AAAAATAATAATAATAATATAGG - Intronic
1013651778 6:112202311-112202333 CAAAAAAGTAATAAAAATATTGG + Intronic
1013691208 6:112646803-112646825 CAAAAAGATGGTTAGAATAGAGG + Intergenic
1013720252 6:113017336-113017358 CACAAAGATGAAAATAACAAAGG - Intergenic
1013827974 6:114238048-114238070 CAAAAAGATAATCATGATAGTGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014126180 6:117779636-117779658 CAAAAAAAAAAAAATAATATTGG - Intergenic
1014223713 6:118824293-118824315 CTAAAAGATGAGAATAAGTTAGG + Intronic
1014266880 6:119288764-119288786 AAAAAACATGCTAAGAATATGGG + Intronic
1014498109 6:122152854-122152876 CTAAAAGATGATACAAATCTTGG - Intergenic
1014512924 6:122346752-122346774 AAAAAAAATGACAAAAATATAGG - Intergenic
1014531681 6:122566551-122566573 CAAAAATAATAAAATAATATAGG + Intronic
1014884856 6:126767328-126767350 AAGAAAAATGATACTAATATTGG - Intergenic
1014967411 6:127772755-127772777 TATAAACATCATAATAATATCGG - Intronic
1015234276 6:130952886-130952908 CAAAAATATAAAAATAATAGAGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015307477 6:131725841-131725863 AAAAATAATAATAATAATATTGG - Intronic
1015435703 6:133184554-133184576 CAAAAAGAACATAAAAATGTCGG + Intergenic
1015721942 6:136251397-136251419 AGAAAAGATGATAATGATTTGGG + Intergenic
1016102662 6:140121944-140121966 AAAACAAATAATAATAATATAGG - Intergenic
1016427417 6:143949269-143949291 CAGAAGGATGATAATGATTTGGG - Intronic
1016531437 6:145062090-145062112 ATAAAAGATTATAATAACATAGG - Intergenic
1016694267 6:146974474-146974496 CAAGATGAAGATAATAATGTAGG + Intergenic
1017329213 6:153176131-153176153 CATCAAGATCATAATAATATTGG - Intergenic
1017553446 6:155537039-155537061 GAAAAAAATGATAATAGTAAGGG + Intergenic
1017640296 6:156487282-156487304 CAAGAAGATGATTAGAATTTTGG + Intergenic
1018347379 6:162915256-162915278 AAAAAAGATTATTTTAATATTGG - Intronic
1018353373 6:162986690-162986712 CAAAAATATGATAATTAGATAGG + Intronic
1018486885 6:164249666-164249688 CAAGGAGATGATAATGAGATAGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020258469 7:6516366-6516388 GACAAAGATTATTATAATATTGG - Intronic
1020472109 7:8549599-8549621 CAAAAAGCAGAGATTAATATTGG - Intronic
1020581050 7:10002833-10002855 GCAAAAGAAGATAATAAAATGGG + Intergenic
1020625373 7:10571685-10571707 CATAAAAATGAAAATATTATTGG - Intergenic
1020770824 7:12391935-12391957 CAAAAAGTGTATAATTATATAGG + Intronic
1020998863 7:15301716-15301738 AAAAATGACTATAATAATATTGG + Intronic
1021340922 7:19461634-19461656 CACACAGATAATAATAATAAAGG - Intergenic
1021522398 7:21550944-21550966 CAAAAAGGTGATTATAAAACAGG - Intronic
1021607632 7:22424810-22424832 TGAAGAGTTGATAATAATATGGG + Intronic
1021863878 7:24935279-24935301 CAAAAACAGGAAATTAATATTGG + Intronic
1022168219 7:27794847-27794869 GAAAAATATGAGAATAATAGGGG - Intronic
1022250351 7:28601155-28601177 AAAAAAAATAATAATAATAAGGG - Intronic
1023139743 7:37090120-37090142 CAGAAAGATGAAAATAACTTGGG + Intronic
1023280679 7:38565846-38565868 CAAAAAGCTGATAAAACTAGGGG - Intronic
1024172186 7:46801159-46801181 CAGAAAGAAGGAAATAATATAGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024863540 7:53875595-53875617 TAAAAAGATAATAATAATGATGG + Intergenic
1025637217 7:63332963-63332985 CAATAGGTTGATAATAATAGGGG + Intergenic
1025645478 7:63415136-63415158 CAATAGGTTGATAATAATAGGGG - Intergenic
1025716009 7:63956270-63956292 CAATAGGTTGATAATAATAGGGG - Intergenic
1025922155 7:65923412-65923434 AAAAAAGATGATAGTAATTGGGG + Intronic
1027428599 7:78086627-78086649 AAAAAAAATAATAATAATAATGG - Intronic
1027583892 7:80032898-80032920 CAAAAAGATGGTGATAAAACTGG - Intergenic
1027719183 7:81717152-81717174 CTAAAAGTTGTAAATAATATAGG - Intronic
1027889886 7:83958658-83958680 AAAAAAGATGTAAATAATTTGGG - Exonic
1028257219 7:88613830-88613852 GGAAAAGATGATAATATTACAGG - Intergenic
1028550676 7:92060172-92060194 CAAAATCATGATAATACTAAAGG - Intronic
1029381519 7:100218268-100218290 AACAAAGATTATTATAATATTGG + Intronic
1029400952 7:100345581-100345603 AACAAAGATTATTATAATATTGG + Intronic
1030465530 7:109898632-109898654 CAAAGAGATGATATTTATGTAGG + Intergenic
1030660779 7:112217080-112217102 TACAAAGATGAGAATAACATTGG + Intronic
1030760946 7:113350540-113350562 CATAAAGATGACAATTAGATAGG - Intergenic
1030925536 7:115449151-115449173 TAAAAAAATAATAATAATAAAGG - Intergenic
1030976312 7:116127701-116127723 AAAAAAAAAGATAAGAATATTGG + Intronic
1030994776 7:116346658-116346680 ACAAAAGAAGATAATGATATAGG - Intronic
1031108133 7:117571024-117571046 GAAAAAGATGAAGATAATTTGGG - Intronic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031277571 7:119748900-119748922 CTCAAAGATCATAATAATAGTGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031309079 7:120171721-120171743 GAAAGAGATGAAAATAATAAAGG + Intergenic
1031331237 7:120467189-120467211 CAATATGATGAGAATAATATAGG + Intronic
1032313437 7:130811108-130811130 TAAAGATATGACAATAATATTGG - Intergenic
1032510994 7:132472395-132472417 TAAAAATATGATAATCATAAGGG - Intronic
1032609679 7:133398953-133398975 CTAAATGAGGATAATAATAATGG - Intronic
1033001994 7:137515825-137515847 TAAAAATATAATAATAATAATGG - Intronic
1033356326 7:140602982-140603004 AATGAAGATCATAATAATATGGG + Intronic
1033846701 7:145442420-145442442 CAAAAAAATGAAAACAAAATTGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034852273 7:154505327-154505349 ATATAAGATGATAATAATAGGGG - Intronic
1034917027 7:155048660-155048682 TAAAAATATGAGAATAATTTGGG - Intergenic
1035348161 7:158221688-158221710 CACTAACATGAGAATAATATGGG + Intronic
1035387842 7:158485932-158485954 CAAAAAGTTGTTAATAACGTCGG - Intronic
1035983974 8:4404930-4404952 CCAAAAGAGGATAATCATATCGG - Intronic
1036277839 8:7371480-7371502 CAAAAAAATAATAATAATAAAGG + Intronic
1036951702 8:13146595-13146617 AATAAAGTTGATATTAATATTGG - Intronic
1037382352 8:18299990-18300012 CAAAAAAATGAAAAGAAAATCGG - Intergenic
1037455032 8:19054373-19054395 CAAAAAGATGATCATAAACCAGG - Intronic
1038058424 8:23884799-23884821 AGAAAAGATGAAAAAAATATTGG + Intergenic
1038099577 8:24358278-24358300 ATTAAAGCTGATAATAATATTGG - Exonic
1038154470 8:24975537-24975559 CAAAAACATGAAAATAATAAAGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039811660 8:41054486-41054508 CAAAAAGAAGAAAAAAATATTGG - Intergenic
1040398841 8:47026851-47026873 GAAAAAGAAGATAGAAATATAGG - Intergenic
1041568485 8:59308474-59308496 CAAAAAAATGAAAATATTAAAGG - Intergenic
1042410033 8:68454761-68454783 CAAAAGGATGAAAATAGTAAAGG - Intronic
1042896055 8:73669238-73669260 CAAAAAGGTAAAAAGAATATCGG - Intronic
1043063191 8:75530727-75530749 CAAAGAGATGGTAATCATAAAGG + Intronic
1043102456 8:76063107-76063129 CAAAAAGATCATGATCATATGGG + Intergenic
1043225987 8:77730791-77730813 CAAAAATATGTTAATAATTATGG + Intergenic
1043230864 8:77799503-77799525 CAGAAACACAATAATAATATAGG - Intergenic
1043296638 8:78671661-78671683 GAAATATATGATAATCATATAGG - Intronic
1043390640 8:79788091-79788113 CAAAAAGTTGATAGCAACATGGG + Intergenic
1043446312 8:80322843-80322865 AAAAAAAATAATAATAATATTGG - Intergenic
1043459269 8:80442920-80442942 CAAATAAATGATAAGAATAATGG - Intergenic
1043665867 8:82812434-82812456 CAAAAATATGAAATTAACATTGG - Intergenic
1043862447 8:85335732-85335754 CAAAAAGATAATACTAATTTAGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044304861 8:90627446-90627468 TAAAGAGATGAAAAAAATATGGG + Intronic
1044690430 8:94871486-94871508 AAAAATGATAATAATAATTTGGG + Intronic
1044759388 8:95501821-95501843 CAAAGAACTGATAATAATATAGG - Intergenic
1045489939 8:102660431-102660453 CAAAAAGATGATTATAGGCTGGG - Intergenic
1045581146 8:103481971-103481993 AAAAAAAATGGAAATAATATTGG + Intergenic
1045714436 8:105025256-105025278 CAAAAAAATAATAATAACAAAGG - Intronic
1046026889 8:108735179-108735201 CATAAAGCTGCTAATAAAATTGG - Intronic
1046123868 8:109880079-109880101 CCAAAAGATGATTATGATTTGGG - Intergenic
1047457408 8:125028560-125028582 TAAAAAGATGCTAATAATAGTGG - Intronic
1047527288 8:125644414-125644436 CAAAATGACGATAATAATTCTGG - Intergenic
1047764424 8:127978785-127978807 AAAAAAAATTATAATAATAATGG - Intergenic
1048422462 8:134291037-134291059 CACACAGATGATAAAAGTATAGG + Intergenic
1048645754 8:136417544-136417566 AAAAAAAATAATAATAATAGAGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048776957 8:137957416-137957438 TAAAAAGTTGATAATATCATTGG + Intergenic
1048831007 8:138477459-138477481 CAAACAGATGATGAAAACATAGG - Intronic
1048859725 8:138715135-138715157 TACAAAGAAGATAATAGTATTGG - Intronic
1049044397 8:140137973-140137995 TAATAAGATGACAGTAATATTGG - Intronic
1049946475 9:601660-601682 GAAAATAATGATGATAATATTGG - Intronic
1050070250 9:1803414-1803436 ACATAAGATGATAATAATAGGGG + Intergenic
1050585914 9:7111445-7111467 TAAAAAGATAATAATAGTACAGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050747589 9:8894580-8894602 CAAAAATTAGATAAAAATATAGG - Intronic
1050773964 9:9237188-9237210 CAAACAAATGATAATACAATTGG + Intronic
1050797908 9:9568062-9568084 CACAAAGATGAAAAGAACATAGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051004763 9:12329689-12329711 AACAAAGATTATTATAATATTGG + Intergenic
1051545442 9:18269588-18269610 CAATTAGATCATAATAATCTTGG + Intergenic
1051588848 9:18755341-18755363 CAACAAGCTACTAATAATATGGG - Intronic
1051877337 9:21806355-21806377 CAAAAAGATGATGATACTGGTGG + Intronic
1051983606 9:23055405-23055427 CAAAAAGATGAAATAAATCTTGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052264847 9:26560319-26560341 CAAAAAGCTGATTATAAGATAGG - Intergenic
1052569564 9:30201998-30202020 CAAAAGGAAGATAATCCTATGGG + Intergenic
1052847009 9:33345665-33345687 CAAAAATATAATAATAAGAGTGG - Intronic
1052964920 9:34332951-34332973 AAAAAAGATGATGATGATGTGGG + Intronic
1053165030 9:35838311-35838333 CAAAAAGAAAAGAGTAATATAGG - Intronic
1053530435 9:38875949-38875971 CAAAAAGATGATGAAGAGATGGG + Intergenic
1053555788 9:39135821-39135843 AAAAAAGAAAATAATAATAATGG + Intronic
1053627895 9:39895488-39895510 CAGAAAGAAGAAAATAATAAAGG + Intergenic
1053641494 9:40086194-40086216 TAAAATGATAATACTAATATTGG - Intergenic
1053744562 9:41181631-41181653 CAAAAAGAAAATAATGGTATGGG + Intronic
1053764642 9:41379280-41379302 TAAAATGATAATACTAATATTGG + Intergenic
1053778167 9:41570837-41570859 CAGAAAGAAGAAAATAATAAAGG - Intergenic
1053819907 9:41956078-41956100 AAAAAAAAAAATAATAATATTGG + Intronic
1054202660 9:62100379-62100401 CAAAAAGATGATGAAGAGATGGG + Intergenic
1054215993 9:62355214-62355236 CAGAAAGAAGAAAATAATAAAGG - Intergenic
1054322373 9:63683445-63683467 TAAAATGATAATACTAATATTGG - Intergenic
1054349831 9:64011524-64011546 CAAAAAGAAAATAATGGTATGGG + Intergenic
1054360463 9:64109364-64109386 CAAAAAGAGGAAAAAAATAAAGG - Intergenic
1054482709 9:65683579-65683601 CAAAAAGAAAATAATGGTATGGG - Intronic
1054543257 9:66290437-66290459 TAAAATGATAATACTAATATTGG + Intergenic
1054635702 9:67487986-67488008 CAAAAAGATGATGAAGAGATGGG - Intergenic
1054671488 9:67800135-67800157 CAGAAAGAAGAAAATAATAAAGG + Intergenic
1054683783 9:68249619-68249641 CAAAAAGAAAATAATGGTATGGG - Intronic
1055012341 9:71580575-71580597 GAAAAAAATGATAAGAATAAAGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055235632 9:74119338-74119360 CAAAAAGGTGATGATATTACTGG - Intergenic
1055869527 9:80857560-80857582 CCAAATGATGAAAATATTATGGG - Intergenic
1056259910 9:84837914-84837936 TAAAATAATGGTAATAATATAGG - Intronic
1056608698 9:88110884-88110906 CAAAAAAAACATAATAAGATGGG - Intergenic
1056652475 9:88479099-88479121 CAAAAAAATGAAAGTAATATAGG + Intergenic
1057956484 9:99412494-99412516 CATGATGATGATAATAATACTGG + Intergenic
1058046241 9:100360087-100360109 AAAAAAAATAATAATAATAAAGG + Intergenic
1059008369 9:110429068-110429090 CAAAAAAATTAAAATAAAATAGG + Intronic
1059521877 9:114950419-114950441 CAAAAAAATGATAATAATAAAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059593255 9:115687846-115687868 CAAAAACAAGACAAAAATATGGG - Intergenic
1059905591 9:118981628-118981650 CTACCACATGATAATAATATAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060537827 9:124405678-124405700 CAAAAAAATAATAATAATGGGGG - Intronic
1060701416 9:125752837-125752859 ACAAAAGATGATAATTATATTGG - Intronic
1060884982 9:127144997-127145019 ATAAAAAATAATAATAATATAGG + Intronic
1060935904 9:127515835-127515857 CAAAATAATAATAATAATAATGG + Intronic
1061455512 9:130694618-130694640 TAAAAAAATAATAATAATAAAGG - Intronic
1062098295 9:134714080-134714102 CATAAAGATGAAAAAAATCTGGG - Intronic
1202789267 9_KI270719v1_random:69272-69294 TAAAATGATAATACTAATATTGG - Intergenic
1203516890 Un_GL000213v1:9885-9907 CATTAAGATGATAATACTGTAGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185608162 X:1379141-1379163 CATAACAATAATAATAATATGGG - Intronic
1185871643 X:3669723-3669745 CTAATAGATGATATTAAGATAGG - Intronic
1185958242 X:4516047-4516069 CATAAATATGTTAATTATATCGG - Intergenic
1186060782 X:5703927-5703949 CAAAAAGCTCACAATTATATGGG + Intergenic
1186219962 X:7340132-7340154 CAAAAAGATCAGAATAAGCTGGG - Intronic
1186323518 X:8454582-8454604 CAAAATGAAGATATTAACATTGG - Intergenic
1186614938 X:11176434-11176456 CAAAAAGAAGAAAATATTCTTGG - Intronic
1186842361 X:13496495-13496517 CAAAAAGCTGATTACAATTTTGG - Intergenic
1187010283 X:15271421-15271443 CAAAAAAAAAAGAATAATATAGG - Intergenic
1187196459 X:17090034-17090056 CAAAAAGATAATAATAAGTGTGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188135769 X:26492720-26492742 CAAAGAGCAGAGAATAATATAGG + Intergenic
1188140862 X:26548859-26548881 GATAAAGATGATAATAAGTTGGG - Intergenic
1188466490 X:30487385-30487407 CTAAAACATGATAAACATATTGG + Intergenic
1188596088 X:31901924-31901946 TAAAAAAATGATAAGAATGTGGG - Intronic
1188682987 X:33034447-33034469 TAGAATAATGATAATAATATCGG + Intronic
1188802087 X:34544930-34544952 CAACAAGATGACAATACAATGGG + Intergenic
1188955735 X:36433445-36433467 AACAAAGATTATTATAATATTGG + Intergenic
1189183876 X:39034183-39034205 GAAATACATAATAATAATATAGG - Intergenic
1189297382 X:39928704-39928726 AAAAAAGATGATGATGCTATGGG + Intergenic
1189370181 X:40421699-40421721 TAAAACGAGGATAATAATAGCGG - Intergenic
1189528175 X:41848694-41848716 TAAAAAAATGACAATATTATGGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189816147 X:44825940-44825962 GAAAAAAATAATAATAATACTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192002419 X:67168286-67168308 AATAAAGATGTTAAAAATATGGG - Intergenic
1192016983 X:67341763-67341785 AAAAAAGATGACAATTATTTGGG - Intergenic
1192223052 X:69210413-69210435 CAAAATGGGGATGATAATATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192718408 X:73667219-73667241 CAAAAATATGCTAAAAATAAAGG - Intronic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193364544 X:80616045-80616067 CTAAAAAATGAAAAAAATATTGG - Intergenic
1193534498 X:82696473-82696495 AAAAAAGTTGATAATAAAACTGG - Intergenic
1193559907 X:83005859-83005881 CAATAAGATCATAGAAATATAGG + Intergenic
1193611417 X:83635559-83635581 AGAAAAGATTATTATAATATTGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1195044232 X:101041802-101041824 CAGAAAGAAGATACTAATCTGGG - Intronic
1195230773 X:102844747-102844769 CTAAATGATGATATTATTATAGG + Intergenic
1195525000 X:105877422-105877444 CAAAATGAAGAAATTAATATTGG - Intronic
1196277762 X:113788039-113788061 CACAAAGTTGTTAATAATAATGG + Intergenic
1196532868 X:116809566-116809588 AAAAGAAATGAGAATAATATAGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197411231 X:126118869-126118891 CAAAAATGTGAAAATAACATTGG + Intergenic
1198059946 X:133035611-133035633 GAAAAAAATAATAATAATAAAGG - Intronic
1198381001 X:136083176-136083198 CCAAAAGATGATTATTCTATGGG + Intergenic
1198418959 X:136449720-136449742 CAAGAGGGTGATCATAATATTGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198864743 X:141109626-141109648 GAAAAAAATAATAATAATCTTGG - Intergenic
1198897947 X:141477766-141477788 GAAAAAAATAATAATAATCTTGG + Intergenic
1199325728 X:146495591-146495613 CAAAAAAAAAATAATAATAATGG + Intergenic
1200799484 Y:7373122-7373144 CAAAAAGAAGAAAATAATTCAGG - Intergenic
1201518862 Y:14850137-14850159 CAAAATTATGCTATTAATATAGG + Intergenic
1201853022 Y:18509067-18509089 AGAAAATGTGATAATAATATTGG + Intergenic
1201880299 Y:18811317-18811339 AGAAAATGTGATAATAATATTGG - Intronic
1202345320 Y:23917220-23917242 AGAAAATGTGATAATAATATTGG - Intergenic
1202525450 Y:25752869-25752891 AGAAAATGTGATAATAATATTGG + Intergenic