ID: 1156178422

View in Genome Browser
Species Human (GRCh38)
Location 18:34574470-34574492
Sequence CTAAGAAGGACAAACACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156178422_1156178431 28 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178431 18:34574521-34574543 ACCCTGCAGGAGGCATCGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 187
1156178422_1156178425 0 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178425 18:34574493-34574515 AGTCACAGTGAGCAATGGTCTGG 0: 1
1: 0
2: 2
3: 20
4: 160
1156178422_1156178424 -5 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178424 18:34574488-34574510 CTTAGAGTCACAGTGAGCAATGG 0: 1
1: 0
2: 2
3: 11
4: 185
1156178422_1156178428 18 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178428 18:34574511-34574533 TCTGGGCCACACCCTGCAGGAGG 0: 1
1: 1
2: 2
3: 39
4: 288
1156178422_1156178427 15 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178427 18:34574508-34574530 TGGTCTGGGCCACACCCTGCAGG 0: 1
1: 0
2: 1
3: 36
4: 330
1156178422_1156178433 29 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178433 18:34574522-34574544 CCCTGCAGGAGGCATCGCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 477
1156178422_1156178430 27 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178430 18:34574520-34574542 CACCCTGCAGGAGGCATCGCTGG 0: 1
1: 0
2: 1
3: 29
4: 184
1156178422_1156178426 1 Left 1156178422 18:34574470-34574492 CCAGAAGTGTTTGTCCTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1156178426 18:34574494-34574516 GTCACAGTGAGCAATGGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156178422 Original CRISPR CTAAGAAGGACAAACACTTC TGG (reversed) Intronic
902587880 1:17452177-17452199 CGAAGCAGGACAATCACTTCAGG + Intergenic
905716030 1:40150641-40150663 CTAAGGAGGTCAAACATTTTTGG - Intergenic
906008476 1:42500822-42500844 CAAAGATGGAGAATCACTTCAGG - Intronic
906198281 1:43943310-43943332 CTAAGGAGGACCAACATTTAAGG + Intergenic
907894521 1:58673572-58673594 CTTAGAAGGACAAACGTTTGAGG - Exonic
909060465 1:70873365-70873387 CTAAGAAATACAACCATTTCTGG - Intronic
909096963 1:71299355-71299377 TTAAGAAGAAAAAACACTTCTGG - Intergenic
910412985 1:86965721-86965743 CTAAGTAGCACAAGCCCTTCAGG - Intronic
910507853 1:87970668-87970690 CTAAGAAACACAAACAATTAAGG - Intergenic
913648676 1:120888065-120888087 CTCAGAAAGACAAACACTGAAGG + Intergenic
913998222 1:143668975-143668997 CTAGAAAGGAAAAACAATTCTGG + Intergenic
914087565 1:144466947-144466969 CTAGAAAGGAAAAACAATTCCGG + Intergenic
914193339 1:145429924-145429946 CTAGAAAGGAAAAACAATTCTGG + Intergenic
914311046 1:146467260-146467282 CTAGAAAGGAAAAACAATTCCGG - Intergenic
916483828 1:165239554-165239576 CTAAGAGCAACAAACAATTCCGG + Intronic
916585378 1:166145194-166145216 CTAAGGAGGCCAAGCACTGCAGG + Intronic
918015786 1:180631640-180631662 CTAAGAAGCTAAAACAGTTCAGG - Intergenic
918624881 1:186645904-186645926 CTAAAAAGGCCCAACATTTCTGG - Intergenic
919138687 1:193542805-193542827 CTACCAAGTGCAAACACTTCAGG - Intergenic
921256958 1:213350411-213350433 GTAAATAGGACAGACACTTCTGG + Intergenic
923238755 1:232060251-232060273 CTAAGAAGGACAAACAGGGCAGG - Intergenic
923369968 1:233300012-233300034 CAAAGAAGTACAAGCACTTTGGG - Intergenic
923480790 1:234381435-234381457 CTCTGTAGGACAAACAGTTCAGG + Intronic
924019268 1:239763861-239763883 CTAAGAAGGAGGATCACTTGAGG + Intronic
924386252 1:243500601-243500623 CTGAGAATGACAAACACTAAAGG + Exonic
924825346 1:247532462-247532484 CCCAGGAGGACAAAGACTTCTGG + Exonic
1065623022 10:27602500-27602522 CTCACAAGGACAAAAACTTTTGG + Intergenic
1066075688 10:31873824-31873846 CCAACAAGGACAAACATATCTGG - Intronic
1069076687 10:64044745-64044767 CGAAGAAGGAAAAATACTTTTGG - Intergenic
1069640865 10:69954705-69954727 GCAAGAAGGACAAACCCTTTAGG - Intronic
1070883639 10:79870865-79870887 CTAAGGGGGAAAAAGACTTCTGG + Intergenic
1071650198 10:87387175-87387197 CTAAGGGGGAAAAAGACTTCTGG + Intergenic
1073271566 10:102269068-102269090 CTTAGATGGACAAGCACTTCTGG + Intronic
1073791993 10:106949816-106949838 CTAAGATAGACAGACACTGCAGG + Intronic
1073833075 10:107409201-107409223 CAAAAAAGGACAAACATCTCTGG - Intergenic
1074454303 10:113583965-113583987 CCAGGAAGGAGTAACACTTCAGG - Intronic
1074543148 10:114382950-114382972 ATAAAAATGATAAACACTTCAGG + Intronic
1075290689 10:121228062-121228084 GTAAGAAGGACATGCACTTTTGG - Intergenic
1077860094 11:6170274-6170296 CCAGGAAGGACAAAAACTGCAGG + Exonic
1079909926 11:26297357-26297379 CTAACACAGACAAACACTTGTGG + Intergenic
1080616442 11:33948779-33948801 CTAAGCAGGACAAACAAACCTGG + Intergenic
1081981260 11:47268774-47268796 CTGAGAAGGGCAAACATTCCTGG + Exonic
1082950521 11:58810231-58810253 CTCAGAAAGACAAATGCTTCAGG - Intergenic
1087323654 11:96694717-96694739 TTAAGAGTGACTAACACTTCAGG + Intergenic
1089144840 11:116319088-116319110 CTACCAAGGCAAAACACTTCTGG + Intergenic
1090447273 11:126775125-126775147 CTAAGAAGGGGAAACTGTTCTGG - Intronic
1090900286 11:131025070-131025092 CTGAGAAGCACAAAGAATTCTGG + Intergenic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1093711816 12:22336040-22336062 CTAAGTAGGACAGAGATTTCTGG - Intronic
1094668137 12:32542091-32542113 CTAAGTAGGAAAAACTCCTCAGG - Intronic
1096426553 12:51508854-51508876 CTAAGAAAGAAAAACACATCGGG - Exonic
1096874925 12:54621210-54621232 CTAAGGAGCACCAAAACTTCAGG - Intergenic
1097970612 12:65629363-65629385 CTCAGAAGGACAAAGACAACAGG + Intergenic
1098191243 12:67951295-67951317 CTTAGAAGGGTAAACCCTTCAGG - Intergenic
1099361141 12:81703309-81703331 CTAAGAAGGAGAAAAAATTGGGG - Intronic
1101417208 12:104518644-104518666 CTTTGCAGGAAAAACACTTCAGG + Intronic
1101838082 12:108308971-108308993 ATAAGGAAGACAAACACATCTGG + Intronic
1110261777 13:73492838-73492860 ATAAAAAGGAAAAACTCTTCAGG + Intergenic
1111103176 13:83613044-83613066 CTGGGAGGGACAAACAATTCTGG - Intergenic
1111385043 13:87514529-87514551 CTGCGAGGAACAAACACTTCGGG + Intergenic
1111725563 13:92004121-92004143 ATAAGAAGAATAAACACTTTGGG - Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115038641 14:28892366-28892388 ATAAGTAGGACAGAGACTTCTGG + Intergenic
1116491436 14:45507979-45508001 CTGAGAAGAACAAGCATTTCAGG - Intergenic
1117633158 14:57714540-57714562 GCAAGAAAAACAAACACTTCAGG - Intronic
1118979454 14:70704474-70704496 CTGAGAAAAACATACACTTCTGG + Intergenic
1120164844 14:81186714-81186736 CTAGGCGGGACAATCACTTCAGG + Intronic
1120242999 14:81971972-81971994 CTAAGAAGGTTAAAAACTGCTGG - Intergenic
1121487929 14:94332859-94332881 GTCAGAAAGACAAATACTTCAGG - Intergenic
1128137395 15:65274051-65274073 CTATGCAGGAGAATCACTTCGGG - Intronic
1128504324 15:68256019-68256041 CGAAGAAGGAGGATCACTTCGGG - Intronic
1129355207 15:74986273-74986295 CTAAGAAGAGTAAACATTTCTGG + Intronic
1131245240 15:90786281-90786303 CCAAGAAGTAGAAACACATCGGG - Intronic
1135654109 16:24232829-24232851 CTAAGAAGGTCAAACATGTAGGG - Intergenic
1138475005 16:57265328-57265350 TGAAGGAGAACAAACACTTCGGG + Intronic
1142909572 17:3076546-3076568 CAAAGAAAGACAAAAACTGCAGG - Intergenic
1142924926 17:3227268-3227290 CAAAGAAAGACAAAAACTGCAGG + Intergenic
1149624165 17:58067869-58067891 CTAGGAAGGACAAACAGCACTGG - Intergenic
1150376486 17:64685794-64685816 CGAAGAAGGACGGACACTACTGG + Intergenic
1151588693 17:75028705-75028727 CTCAGAAGGACAAGCATTACTGG + Intergenic
1152906483 17:82973362-82973384 CTATGAAGGACAAACTTTTAAGG + Intronic
1153939013 18:9960839-9960861 AAAAGAAGGACAAAAATTTCAGG - Intergenic
1156178422 18:34574470-34574492 CTAAGAAGGACAAACACTTCTGG - Intronic
1156675263 18:39520392-39520414 CTTCAAAGGACAAACACATCTGG + Intergenic
1157719116 18:49909982-49910004 CGAAAAAGGACAAACACATCTGG + Intronic
1161783449 19:6308900-6308922 ATAAAAAGGACAAACTCTGCTGG + Intronic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1166012175 19:39950641-39950663 CAATGAAGGCCTAACACTTCTGG - Intergenic
1167603189 19:50466323-50466345 TCAAGAAGGACAGACACTCCAGG - Intergenic
925214842 2:2085489-2085511 CAAAGAAGGAGAAACTATTCTGG - Intronic
930282236 2:49383780-49383802 CTTATAAAGACAAACATTTCTGG + Intergenic
931329012 2:61260067-61260089 GCAAGAATGAAAAACACTTCAGG + Intronic
933401863 2:81808829-81808851 CTCAGACCGACAAACACTTAGGG - Intergenic
935371213 2:102348865-102348887 GTAAAAAGGAGAAACACTTTGGG + Intronic
938798312 2:134737146-134737168 ATAAGAAGGACACACAGCTCTGG - Intergenic
941753541 2:169160654-169160676 ATAAGTAGCACAAACAATTCGGG - Intronic
943080554 2:183254162-183254184 CTAAGAAGGACAGATGCGTCAGG - Intergenic
944151417 2:196562660-196562682 CTAAGATGGAGAAATACTTTGGG - Intronic
944155231 2:196600722-196600744 CTAAGAAGGAGAAACAGGCCAGG + Intergenic
945914816 2:215692257-215692279 GGAAGATGGAAAAACACTTCAGG + Intergenic
947863800 2:233381876-233381898 CTTAACAGAACAAACACTTCTGG - Intronic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1170015193 20:11772608-11772630 AAAAGACTGACAAACACTTCTGG + Intergenic
1174785380 20:53427723-53427745 GTATGAAGGACAAACATTCCCGG - Intronic
1176650532 21:9542630-9542652 CTAAGAAGGACAACCACCCTGGG - Intergenic
1181559275 22:23690675-23690697 CCAAGAAGCACCAACCCTTCAGG - Intronic
1183828901 22:40407796-40407818 CTCAGAAGGACGAGCACTGCTGG + Exonic
949146639 3:709068-709090 CTAAATAAGAAAAACACTTCGGG - Intergenic
950934518 3:16824922-16824944 CAAAGAAGGTCAAATGCTTCTGG - Intronic
951077382 3:18412235-18412257 CTAGGAAGGATAATCCCTTCTGG + Intronic
952766697 3:36960506-36960528 CTAAGCAGGTGAAACACTTGAGG + Intergenic
953012971 3:39046025-39046047 CTAAGCAGGAGGAACACTTGAGG + Intergenic
953882316 3:46696955-46696977 CTAAGAAGCAGAAACAGTACTGG + Intergenic
955764394 3:62326084-62326106 GTAAGCTGGACAAACACTCCGGG + Intronic
956133209 3:66074035-66074057 CTAAGAAGTAAAAACTCTTTGGG - Intergenic
956369621 3:68544456-68544478 CAAAGAAAGACAGACATTTCAGG - Intronic
957591378 3:82203885-82203907 CTAAGAAAGAAAAACAAATCAGG + Intergenic
963780500 3:149481550-149481572 TTAAGAAGAAAAAACACTTCAGG + Intronic
966089165 3:176109438-176109460 TTAACAAGTATAAACACTTCAGG + Intergenic
972226580 4:37019951-37019973 CTAAGAAGGAGAAACAAATGAGG + Intergenic
972920563 4:43936126-43936148 CTTAGAAGGTAAAACTCTTCTGG + Intergenic
974869909 4:67628541-67628563 CTAAGAAGGAAAAATACAACAGG - Intronic
975533434 4:75424305-75424327 CTAAGAAACAGAAACAATTCAGG + Intergenic
975984476 4:80189820-80189842 AGAAGAAGGACCAACAATTCAGG - Intronic
976230420 4:82836933-82836955 CAAAGAATGACAAACGCTTGAGG + Intronic
981593244 4:146388798-146388820 CTAGGAAAGAAAAACTCTTCTGG + Intronic
981964762 4:150586406-150586428 TTAAAAAGGAAAAACACTGCAGG + Intronic
983018534 4:162645189-162645211 CTAAGGATGCCAACCACTTCTGG - Intergenic
983605491 4:169578433-169578455 CTAAAAAGTAAGAACACTTCTGG - Intronic
983897115 4:173092941-173092963 CAAAGCAGGATAAAGACTTCTGG - Intergenic
985029391 4:185773540-185773562 CTAAGAAGGACAAACGCAAGTGG - Intronic
986474263 5:8110321-8110343 CAAAGAAGGTCAAAGACATCAGG + Intergenic
986892402 5:12324971-12324993 ATACAAAGGACAAACGCTTCAGG + Intergenic
986951140 5:13086490-13086512 CAAATAAGCATAAACACTTCTGG - Intergenic
987217137 5:15748890-15748912 CAAGGAAGGACAATCACTTGAGG - Intronic
987269380 5:16290416-16290438 CTAAGCATGACAGACACTTAGGG + Intergenic
989260582 5:39415440-39415462 TTAAGAAGTACAAGCAATTCAGG + Intronic
989508086 5:42250975-42250997 CTGAGAAGGGAACACACTTCTGG + Intergenic
990330161 5:54717934-54717956 CACAGAAGGACAAATATTTCAGG + Intergenic
992381081 5:76238445-76238467 CTCAGAAGGACAGACACTACAGG - Intronic
995448306 5:112271641-112271663 CTATGAAGGACACACAATACAGG + Intronic
996548197 5:124703531-124703553 CCAAGAAGGAGTATCACTTCAGG + Intronic
1000512946 5:162206277-162206299 CTAAGATGGGCAAAAACTTGAGG - Intergenic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1004661957 6:17718465-17718487 CTTATAAGTACGAACACTTCTGG - Intergenic
1007374695 6:41448479-41448501 ATAAGGAGGAAAAACACTCCAGG - Intergenic
1008313814 6:50013773-50013795 CTTAGAAGCTAAAACACTTCTGG - Intronic
1009458585 6:63886541-63886563 CTCAAAATGAAAAACACTTCAGG + Intronic
1010014444 6:71087908-71087930 CTGAGATGGAAAAAAACTTCAGG + Intergenic
1011909186 6:92413827-92413849 ATATGAAGGACAAACCCTTAAGG + Intergenic
1013848284 6:114481723-114481745 ATAAGAAGGAAAGTCACTTCAGG + Intergenic
1014195255 6:118549819-118549841 CTAAAAAGTACACATACTTCTGG + Intronic
1015689056 6:135900379-135900401 CTAAAAAGGACAAAGAGTTGAGG - Intronic
1015709675 6:136126223-136126245 CTAAGAAGGCGAACAACTTCTGG + Intronic
1018652589 6:166004625-166004647 CACAGAAGGACAAACCCTGCAGG - Intergenic
1021399581 7:20194398-20194420 CTAGAAAGAACAAACACATCAGG - Intronic
1021424286 7:20481903-20481925 GTAAGAAGGACAAAAATTTGGGG + Intergenic
1022840101 7:34156082-34156104 CTAAGAATCACTAACTCTTCAGG + Intergenic
1023656556 7:42428470-42428492 TTTAGAAAGACAAACAATTCTGG - Intergenic
1025277212 7:57593595-57593617 CTAAGAAGGACCACCACCCCGGG - Intergenic
1025830668 7:65046458-65046480 CTTAGAAGGCAAAACACTCCAGG - Intergenic
1029963900 7:104718055-104718077 CACAGAAGGACAAACACTTCAGG + Intronic
1031603741 7:123745396-123745418 CTAAGAAGGAGATACAGTTGGGG - Intronic
1032298435 7:130664427-130664449 CTAAAAAGCACACAGACTTCTGG - Intronic
1032940503 7:136783708-136783730 CTAAGAAGGAAAATGACTTCTGG + Intergenic
1033665270 7:143435354-143435376 AAAACAAGGACAAACACTTGTGG - Intergenic
1033882868 7:145908215-145908237 CTATGAAGGACTAACATTTAAGG - Intergenic
1036150247 8:6290379-6290401 CAAAGAAGTACAAACACATCAGG + Intergenic
1037048392 8:14338140-14338162 CTAAGAAGGTCAATAGCTTCTGG - Intronic
1039775320 8:40730703-40730725 CAAAGAAGGGCAAACAAATCTGG + Intronic
1040613522 8:49010697-49010719 CTAAGAAAAACAAATTCTTCAGG - Intergenic
1043256255 8:78140953-78140975 TTAAGTAGAACAAACACTTTGGG - Intergenic
1043662743 8:82765598-82765620 CTATGAAGTACAAACAATTTTGG + Intergenic
1044772177 8:95647800-95647822 CCAAGAAGGAGAAACACTCATGG - Intergenic
1045625189 8:104037576-104037598 TTAAAAAAGACAAACACTTGGGG - Intronic
1047001172 8:120574113-120574135 CACACAAGGACAAACACTACAGG + Intronic
1052248472 9:26368150-26368172 TTAAGGAGGAAAAACACTTCAGG - Intergenic
1052729688 9:32270863-32270885 GTGAGAAGGACATACACTACAGG + Intergenic
1056231816 9:84554243-84554265 CTAATAAGGAAAAATAATTCTGG + Intergenic
1056278729 9:85018935-85018957 CAAATAGGGACAAAAACTTCTGG - Intronic
1058799752 9:108534101-108534123 CTAAGAAGCACAAAGCCTACTGG + Intergenic
1060444080 9:123671295-123671317 CTGAGATGGACAGACACTCCTGG + Exonic
1203628272 Un_KI270750v1:46184-46206 CTAAGAAGGACAACCACCCTGGG - Intergenic
1186309123 X:8298274-8298296 CTAACAAGGAGAAACACTGGAGG + Intergenic
1186395508 X:9205012-9205034 CTAAGAGTGACAGACAGTTCAGG + Intergenic
1186568989 X:10694657-10694679 ATAAGAGAGACAAACACTTGGGG + Intronic
1188392997 X:29644361-29644383 CCAGGAAGGACCAAGACTTCTGG - Intronic
1188677365 X:32958726-32958748 GTAGGGAGGAAAAACACTTCTGG - Intronic
1190219065 X:48499301-48499323 CAAAGAAAGAAAAAGACTTCAGG + Intergenic
1195447935 X:104975203-104975225 CCCAGAAGGGCAAACTCTTCTGG - Intronic
1195521974 X:105841503-105841525 CTAAGAAGGACAAACCCAAAAGG - Intronic
1195655471 X:107327819-107327841 CTAACACACACAAACACTTCAGG - Intergenic
1197454304 X:126658980-126659002 CTAAAATGGACTAACACTTGAGG + Intergenic
1198802699 X:140463597-140463619 CTAAGAAGTACTAACATTCCTGG + Intergenic
1201794935 Y:17885290-17885312 AAAAGAAGCACAAACACTTACGG - Intergenic
1201806620 Y:18020695-18020717 AAAAGAAGCACAAACACTTACGG + Intergenic