ID: 1156182911

View in Genome Browser
Species Human (GRCh38)
Location 18:34626768-34626790
Sequence GAAGCTACACAGATGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156182910_1156182911 -3 Left 1156182910 18:34626748-34626770 CCAGTTGGCATTCTTCTTAAGAA 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG 0: 1
1: 0
2: 5
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156182911 Original CRISPR GAAGCTACACAGATGCAGCC TGG Intronic
900409776 1:2507344-2507366 AAGGCTACAGAGATGCAGGCTGG + Intergenic
900979842 1:6040137-6040159 GAAAGTACACAGATGCCCCCTGG + Intronic
902464471 1:16607585-16607607 GAAGCTACCCAGCTGCAGTTGGG + Intronic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
903156340 1:21446121-21446143 GAAGCTACCCAGCTGCAGCTGGG - Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
905106139 1:35564650-35564672 GGGGCTGCAGAGATGCAGCCTGG - Intronic
905711638 1:40109610-40109632 GAGGCTACAGAGCTTCAGCCTGG - Intergenic
907984401 1:59516409-59516431 TAAGCTACAAACATGCAGGCAGG - Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
909951110 1:81721652-81721674 GAAGCTGAAGAGCTGCAGCCCGG - Intronic
910110093 1:83673694-83673716 GAGGCTACAGAGAAGCTGCCTGG - Intergenic
910647742 1:89531676-89531698 GTATCTGCACTGATGCAGCCAGG - Intronic
913097850 1:115536446-115536468 GAATCTACATTGATGCAGCCAGG - Intergenic
913955526 1:143287806-143287828 GAATCTGCCCTGATGCAGCCAGG + Intergenic
913981906 1:143527635-143527657 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914076269 1:144354290-144354312 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914102909 1:144612206-144612228 GAATCTGCCCTGATGCAGCCAGG + Intergenic
914408516 1:147402100-147402122 GAATCTGCATTGATGCAGCCAGG - Intergenic
914712472 1:150227444-150227466 GCAGCAACATAGATGCAGCTGGG + Intronic
915559448 1:156677921-156677943 GAAGCTAGAGAGACGCTGCCTGG + Intergenic
920690392 1:208142152-208142174 GGAGCTAGAGAGAAGCAGCCGGG - Intronic
920935721 1:210432657-210432679 GAAGGTAAAAAGATGCAGTCAGG - Intronic
921155943 1:212438898-212438920 GAAGTGACACAGAAACAGCCAGG - Intronic
922022541 1:221718974-221718996 AAAGTTACACAGGTGAAGCCTGG + Intronic
923261548 1:232272656-232272678 GAATCTAAAGAGATGAAGCCAGG - Intergenic
924324808 1:242885051-242885073 GCAGCAACAAGGATGCAGCCTGG + Intergenic
1063964848 10:11338886-11338908 GCAGGCACACGGATGCAGCCAGG + Intergenic
1066715061 10:38277603-38277625 GAATCTAAATTGATGCAGCCAGG - Intergenic
1066779209 10:38924915-38924937 GAACCTACTTTGATGCAGCCAGG - Intergenic
1066783024 10:38973108-38973130 GAATCTAAATTGATGCAGCCAGG + Intergenic
1067299831 10:44998062-44998084 GAAGCTACCCAGGGGCTGCCAGG + Exonic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1071177582 10:82944207-82944229 GAAGCTAGTCAAATGTAGCCTGG - Intronic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1074895626 10:117775149-117775171 GAATCTCCAGAGGTGCAGCCTGG + Intergenic
1081305396 11:41505535-41505557 GAAGCTACACAGAAACAGGAAGG - Intergenic
1083694111 11:64431188-64431210 GAAGATACAAAGGTGAAGCCAGG - Intergenic
1086210872 11:84317106-84317128 CAAGCAACACAGCTGCAGCCGGG - Intronic
1088102219 11:106168000-106168022 GAATCTTCATTGATGCAGCCAGG - Intergenic
1088649164 11:111942189-111942211 CCAGCTAAACAGATGCACCCTGG + Intronic
1089728590 11:120505094-120505116 GAAGTTACAGAGAGGCGGCCGGG - Intergenic
1089840292 11:121411368-121411390 GAATCTGCATTGATGCAGCCAGG - Intergenic
1090067844 11:123518781-123518803 GAAGCAAGACTGAGGCAGCCAGG - Intergenic
1091349821 11:134884164-134884186 GCAGGGACACAGATGGAGCCGGG - Intergenic
1092127485 12:6085115-6085137 GAAGCTGCTCAGATGCCTCCAGG - Intronic
1093569956 12:20655426-20655448 GCAGCAAGACAGAGGCAGCCGGG + Intronic
1095058846 12:37657147-37657169 AAAACTACACAGATGCATTCTGG + Intergenic
1095517290 12:43020816-43020838 AAAGCTCCACAAAGGCAGCCAGG + Intergenic
1096713930 12:53479489-53479511 GAAACTACACAGATGGATCATGG - Exonic
1097599052 12:61669576-61669598 GAATCTGCATTGATGCAGCCAGG - Intergenic
1098313208 12:69167963-69167985 GAATCTCCATTGATGCAGCCAGG - Intergenic
1098383916 12:69898396-69898418 GAACCCACAAAAATGCAGCCTGG - Intronic
1098845583 12:75531220-75531242 GCAGCAACACAGATGCAGCTGGG + Intergenic
1105327782 13:19385739-19385761 GAAGCTACACAGGGGCACACAGG + Intergenic
1106128987 13:26923885-26923907 GAAGTTAAACAGATGCAGAAAGG - Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1110784803 13:79511157-79511179 AAATCTACATTGATGCAGCCAGG - Intronic
1112519910 13:100086121-100086143 GGCACTACACAGAAGCAGCCTGG - Intergenic
1115356896 14:32457681-32457703 GAAGCTACACAGACGGTGCCTGG + Intronic
1115406431 14:33022072-33022094 GAGGCTACAGAGATGCAGCCTGG - Intronic
1116940162 14:50783423-50783445 TAAGAAACACAGATCCAGCCAGG + Intronic
1117974251 14:61281530-61281552 GGAGCCACTCAGAGGCAGCCCGG - Exonic
1118508581 14:66444396-66444418 GAAGATACACAGTAGTAGCCAGG + Intergenic
1118809693 14:69263930-69263952 GAATCTACACTGATGCACGCTGG + Intronic
1121026755 14:90621597-90621619 GAAGCCACACAGGTTCAGCTGGG + Intronic
1122741050 14:103871871-103871893 GAAGCCAAGCAGAGGCAGCCGGG + Intergenic
1122758420 14:104001261-104001283 GAAGCTGCAGAGATGAAGACGGG - Intronic
1122902655 14:104788195-104788217 GAAGCCACCTAGACGCAGCCTGG + Intronic
1123226112 15:17032910-17032932 AAAGCTACACATATGCATTCTGG + Intergenic
1126428924 15:48559968-48559990 GATGCTACACAGGAGAAGCCAGG + Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128611997 15:69081531-69081553 CCAGCCACACAGATGCAGCCTGG - Intergenic
1128931682 15:71709997-71710019 GAAGCTGCTCAGATCCAGGCTGG + Intronic
1129898312 15:79124989-79125011 GAAGCTACAAAGATGCATATGGG - Intergenic
1131457425 15:92593404-92593426 GAAAGCACACAGAAGCAGCCAGG - Intergenic
1131732123 15:95293194-95293216 AAGGCTACTCAGATGTAGCCTGG - Intergenic
1132464232 16:70409-70431 GACCCTACACACATGCACCCAGG + Intronic
1132553359 16:562247-562269 GAAGCCACCCAGATGGAGCTGGG + Intronic
1133836576 16:9373091-9373113 GAAGCTACACAGCTGGAGTGTGG + Intergenic
1134043577 16:11085655-11085677 GAAGCCACTCAGATCCAGACAGG - Intronic
1134688845 16:16177645-16177667 GAAGTTACACACATGTGGCCGGG + Intronic
1134794600 16:17023493-17023515 GCGACTACTCAGATGCAGCCAGG - Intergenic
1135201346 16:20440187-20440209 GAAGCAAAACAGCTGGAGCCTGG - Intronic
1135217763 16:20587677-20587699 GAAGCAAAACAGCTGGAGCCTGG + Intergenic
1137364251 16:47847112-47847134 GAATCTCCATGGATGCAGCCAGG + Intergenic
1138106231 16:54288299-54288321 GAAACTACTCAGATGCAGTCTGG - Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1139771891 16:69284410-69284432 TAAGACACACAAATGCAGCCTGG + Intronic
1140566386 16:76047738-76047760 GAAGCAACATAGATGCAGCTGGG - Intergenic
1141337249 16:83167895-83167917 GCAGCAACATGGATGCAGCCAGG + Intronic
1142407874 16:89901232-89901254 GAAGCTACCCAGATGCAGTCAGG - Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1145708510 17:26945583-26945605 GAATCTACTTTGATGCAGCCAGG - Intergenic
1145905450 17:28513853-28513875 GAAGGTGCCCAGAGGCAGCCAGG + Intronic
1146620080 17:34390396-34390418 GAAGCTACATGAAGGCAGCCTGG - Intergenic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1151563755 17:74885513-74885535 GAAGCTACGCAGATCCAGCCCGG + Intronic
1152701737 17:81822976-81822998 GCAGCTTCAAAAATGCAGCCAGG + Intronic
1153350913 18:4080526-4080548 GAATCTGCATTGATGCAGCCAGG + Intronic
1153602531 18:6795427-6795449 GAAGGCACACAGCTGCAGCCTGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1158092977 18:53737135-53737157 GCAGCAACATAGATGCAGCTGGG - Intergenic
1159149075 18:64496914-64496936 GAAGCAACATGGATGCAGCTGGG - Intergenic
1159206117 18:65255214-65255236 GAATCTGCACTAATGCAGCCTGG + Intergenic
1160446555 18:78932406-78932428 CAAGCGAGACAAATGCAGCCAGG + Intergenic
1163156227 19:15441083-15441105 GAACCAAGACAGAAGCAGCCTGG - Intronic
1163184868 19:15630461-15630483 GCAGCAACATAGATGCAGCTGGG - Intronic
1164348697 19:27303315-27303337 AAAACTACACAGATGCATTCTGG + Intergenic
1164348707 19:27303485-27303507 AAAACTACACAGATGCATTCTGG + Intergenic
1166292661 19:41873048-41873070 CAAGCAACCCAGCTGCAGCCTGG + Intergenic
1167438991 19:49497393-49497415 GAAGCCACTTAGATGCAGGCAGG - Intronic
1168172868 19:54600807-54600829 GAAGCCTCTGAGATGCAGCCGGG + Exonic
926592231 2:14751837-14751859 CAAGCACCACAGGTGCAGCCTGG + Intergenic
929180319 2:39030999-39031021 GAAGCTAGGCAGAGGCAGCAGGG + Intronic
929931849 2:46263416-46263438 AAACATACACAGATGCGGCCTGG + Intergenic
933369174 2:81393558-81393580 GAATCTGCATAGATGAAGCCAGG - Intergenic
934847021 2:97668051-97668073 GAAGCAAAAGAGATGGAGCCCGG + Intergenic
935112692 2:100106654-100106676 GAAGCTTCCCAGCTGCAGCCAGG - Intronic
936986100 2:118312365-118312387 CAATCTACACAGATGAAGACAGG + Intergenic
937085954 2:119171945-119171967 GAATCTTCTCAGATGCAGGCAGG - Intergenic
938137525 2:128771210-128771232 GAATCTGCATCGATGCAGCCAGG + Intergenic
940071976 2:149698849-149698871 GAAGGGATACAGAAGCAGCCAGG + Intergenic
941391807 2:164924162-164924184 GCAGCTACATGGATGCAGCTTGG + Intronic
942051888 2:172147739-172147761 GAATCTGCATTGATGCAGCCAGG - Intergenic
942343333 2:174973611-174973633 GAAGTTACACATTTTCAGCCAGG + Intronic
943044680 2:182846016-182846038 GAAGCTACTCTGAGGCAGCAAGG - Intronic
943952140 2:194144647-194144669 AAATCTACATTGATGCAGCCAGG + Intergenic
1171027127 20:21641028-21641050 GCAGGTGCTCAGATGCAGCCTGG - Intergenic
1172293464 20:33791871-33791893 GAGGCTACCCAGAGGCAGCCTGG - Exonic
1172672545 20:36644313-36644335 GAGGCCACACAGCTCCAGCCAGG - Intronic
1172776867 20:37412912-37412934 GAACCCACACACATACAGCCAGG - Intergenic
1174186552 20:48710201-48710223 GAAGCAACACAAAGGCAGGCAGG + Intronic
1176291445 21:5047327-5047349 GAATCTCCACGAATGCAGCCAGG + Intergenic
1177664808 21:24141024-24141046 GCAGCAACATGGATGCAGCCAGG + Intergenic
1178926082 21:36776317-36776339 GAAGCTACACAGACGCATATAGG - Intronic
1179122102 21:38557391-38557413 GAAGCTACACAGTTGGCCCCTGG + Intronic
1179865810 21:44216314-44216336 GAATCTCCACGAATGCAGCCAGG - Intergenic
1180399967 22:12406506-12406528 AAAGCTACACAGACGCATTCTGG + Intergenic
1181345584 22:22218113-22218135 GAAGCAACATGGATGCAGCAGGG - Intergenic
1182558477 22:31141538-31141560 GAAGAGACTCAGATGGAGCCTGG - Intergenic
1184838241 22:47036704-47036726 GAAGCTCCACAGACCCAGGCTGG - Intronic
1185403232 22:50629306-50629328 GAATCTACACTGATGCGGCCAGG + Intergenic
1185404499 22:50639910-50639932 GAATCTACACTGATGCGGCCAGG + Intergenic
1203290655 22_KI270735v1_random:34927-34949 GAATCTACTTTGATGCAGCCAGG + Intergenic
949402014 3:3674916-3674938 GAATTTACACAAAGGCAGCCTGG - Intergenic
951278997 3:20724207-20724229 GAAGTTACACAGAGTCACCCAGG - Intergenic
954717068 3:52532224-52532246 GAGGCTCCAAAGATGCAGGCAGG + Intronic
955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
956403845 3:68907569-68907591 GAGGGAACACAGATGCAGACTGG - Intronic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
961788243 3:129360269-129360291 CAATCTACACAGATAAAGCCAGG - Intergenic
970930404 4:21504663-21504685 GAAGCTAGAAAGGTTCAGCCTGG - Intronic
975883428 4:78938516-78938538 GAAGCTACTAAGGTGTAGCCTGG - Intronic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
977984893 4:103371609-103371631 GAAGATACAGAAATGCATCCAGG - Intergenic
978496246 4:109362264-109362286 GCAGCAACATAGAAGCAGCCTGG + Intergenic
978840775 4:113209368-113209390 GAATCTGCATTGATGCAGCCAGG - Intronic
983574586 4:169247421-169247443 GAAGCCACAGAGCTGCAGGCAGG + Intronic
983649046 4:170020592-170020614 GAGGCTCCAGAGATGCAGTCAGG - Intronic
983649067 4:170020646-170020668 GAGGCTCCAGAGATGCAGTCAGG - Intronic
984247082 4:177287553-177287575 GAAGCCACACAGGGACAGCCAGG - Intergenic
985024487 4:185726839-185726861 GAAGCTATGGAGATGCATCCGGG + Intronic
986509457 5:8488690-8488712 GAATCTGCAGTGATGCAGCCAGG - Intergenic
986589124 5:9350543-9350565 GAAGTCAACCAGATGCAGCCTGG - Intronic
987827639 5:23054354-23054376 GAAGGTATCCAGATGCAGCCTGG + Intergenic
992553330 5:77880153-77880175 GAGGATTCACTGATGCAGCCAGG + Intergenic
993206987 5:84894826-84894848 GAAGGTACAGAGATGCTGCCTGG + Intergenic
993930985 5:93938681-93938703 GAAACTAAACAAATGCATCCTGG + Intronic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
1000784976 5:165532029-165532051 GAACATATACAGATGCACCCAGG - Intergenic
1001007282 5:168064136-168064158 GAAGCTACAGAAATGCACCAGGG - Intronic
1001556450 5:172640852-172640874 GAACTTACACAGAGGCAGACGGG - Intergenic
1002207018 5:177569864-177569886 CCAGCTACTCAGATGCACCCAGG + Intergenic
1002783240 6:382803-382825 TAAGCTACACAGACGTAACCGGG - Intergenic
1003146337 6:3513419-3513441 GCAGGTACACAGAAGGAGCCAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1004078488 6:12367645-12367667 GGAGCTACACAGGTGCAGGGTGG + Intergenic
1005223315 6:23613344-23613366 GAAGATATACAGAGGGAGCCAGG + Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1006624435 6:35387264-35387286 GAAGCCACGCAGATGCTGCATGG - Intronic
1018154987 6:160977404-160977426 GAAGAGACACAGCTGCAGACAGG + Intergenic
1018722871 6:166587057-166587079 GGAGCTACAAAGAAGAAGCCTGG + Intronic
1018988066 6:168652928-168652950 GAAGGAACACAGATGCCGTCAGG - Intronic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019530348 7:1500007-1500029 GAGGCTACACAGAGCCTGCCAGG + Exonic
1020018841 7:4849485-4849507 GTAGCCTCACAGCTGCAGCCTGG - Intronic
1024534795 7:50421253-50421275 CAAGCTGCCCAGGTGCAGCCAGG + Intergenic
1025023214 7:55496062-55496084 GCAGCTCCACAGAAGCTGCCAGG + Intronic
1026646712 7:72177209-72177231 GGGGCTACACAGTTGCAGCAGGG - Intronic
1026664023 7:72326369-72326391 GAAGAAACAGAGATGTAGCCAGG - Intronic
1030116109 7:106063477-106063499 GAATCTGCATTGATGCAGCCAGG - Intergenic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1033075506 7:138246568-138246590 GAATCAACATTGATGCAGCCAGG + Intergenic
1033164570 7:139028798-139028820 GCAGCTTCAAAGATGCAGCATGG + Exonic
1033339824 7:140483311-140483333 AAATCTACACTGAGGCAGCCCGG + Intergenic
1034076433 7:148235978-148236000 AAAGCTGCACAGCTGTAGCCAGG - Intronic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1036377143 8:8210302-8210324 CAAGCTACACACAGGCTGCCTGG - Intergenic
1037953461 8:23034791-23034813 GAATCACCACAGATGCATCCTGG - Intronic
1038896272 8:31786231-31786253 TAAGCCACACATATGCAGCATGG - Intronic
1041693131 8:60709221-60709243 CAAGCTACACAAATGCACCTGGG - Intronic
1042490534 8:69392695-69392717 GAAGCTAGAAAAATGCAGCATGG + Intergenic
1042987756 8:74603219-74603241 GAAACTACACAGATGGATCATGG + Intronic
1045894607 8:107199676-107199698 CCAGCTACAGAGATGGAGCCTGG + Intergenic
1046488875 8:114920902-114920924 GAGGCTACAGAGATGAAGCTAGG - Intergenic
1048172694 8:132122917-132122939 AAAGCTACAAAGAAGCAGACAGG - Exonic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048439270 8:134447948-134447970 GAAGGTACAGAGATCCAGCTGGG - Intergenic
1049149699 8:141026704-141026726 GCAGCTTCTCAGGTGCAGCCAGG - Intergenic
1050163962 9:2745264-2745286 CTAGGTTCACAGATGCAGCCAGG - Intronic
1050640601 9:7663288-7663310 GATGCTGCACAGATACAGCCTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054523887 9:66100662-66100684 GCTGCAACACAGATGCAGCATGG + Intergenic
1055342536 9:75299932-75299954 GTAGCAACACAGATGCAGTTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1061285829 9:129621935-129621957 GAAGCGGCCCAGAGGCAGCCGGG - Intronic
1062185994 9:135218825-135218847 GAAGCTCCAGAGGCGCAGCCAGG - Intergenic
1203412538 Un_KI270589v1:2506-2528 GAAACTACACAGAAGCATTCAGG + Intergenic
1203685815 Un_KI270757v1:57061-57083 GAAACTACACAGAAGCATTCAGG - Intergenic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187419205 X:19120990-19121012 GAATCTGCACGGATGTAGCCAGG + Intronic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1188236666 X:27739950-27739972 GAACCCACAGAGAGGCAGCCAGG - Intronic
1188361162 X:29255753-29255775 GCAGCAACACGGATGCAGCTGGG - Intronic
1191728488 X:64307199-64307221 GAAGCTACAGAGCTACAGACTGG - Intronic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192231493 X:69268170-69268192 GAATCTGCATTGATGCAGCCAGG - Intergenic
1192239305 X:69316742-69316764 GAATCTGCATTGATGCAGCCAGG + Intergenic
1192790974 X:74381584-74381606 GAATCTGCATTGATGCAGCCAGG + Intergenic
1194483453 X:94456158-94456180 GAATCTATATTGATGCAGCCAGG - Intergenic
1195173626 X:102293974-102293996 GACTCTACACAGCTGCACCCAGG + Intergenic
1195185239 X:102393118-102393140 GACTCTACACAGCTGCACCCAGG - Intronic
1196222227 X:113124936-113124958 GAATCTGCATAGATACAGCCAGG - Intergenic
1196366237 X:114927443-114927465 GAATCTACATTGATGCAGCCAGG - Intergenic
1196917920 X:120557999-120558021 AAAACTACACAGATGAAACCTGG - Exonic
1201222342 Y:11784045-11784067 GCAGCAACATGGATGCAGCCTGG + Intergenic