ID: 1156188367

View in Genome Browser
Species Human (GRCh38)
Location 18:34689910-34689932
Sequence AAGCCACTGGGAGTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156188367_1156188374 27 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1156188374 18:34689960-34689982 TACTCAAGCCTCAGTAATGGTGG 0: 377
1: 1425
2: 1153
3: 673
4: 763
1156188367_1156188370 -5 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1156188370 18:34689928-34689950 GGCTTTGTTTACACTGTGAGAGG 0: 327
1: 433
2: 266
3: 152
4: 195
1156188367_1156188372 24 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1156188372 18:34689957-34689979 ACCTACTCAAGCCTCAGTAATGG 0: 224
1: 1946
2: 1882
3: 1130
4: 1039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156188367 Original CRISPR AAGCCACTGGGAGTTCAGAC TGG (reversed) Intronic
900962967 1:5937376-5937398 AAGCCACTGGAAAGTCATACAGG + Intronic
904412460 1:30332730-30332752 AAGCCACAGGGAAGACAGACAGG - Intergenic
904945200 1:34193991-34194013 AACCCACCGTGAGTTCAGAATGG + Intronic
905251396 1:36651049-36651071 AAGCCACTAGAAGCTGAGACAGG + Intergenic
907492563 1:54817470-54817492 AAGCCACTGAGAGCCGAGACTGG - Intronic
907516421 1:54996139-54996161 AAGGCAGTTGGAGTTCTGACGGG - Intergenic
908394640 1:63714298-63714320 AAGCCACTGAGATTTCAGAGTGG - Intergenic
908484067 1:64572887-64572909 AGGCCAGTGGAAATTCAGACTGG + Intronic
908786207 1:67736779-67736801 AAACCACTCCGAGTTCAGTCTGG - Intronic
910189535 1:84581464-84581486 AAAGCACTGGGACCTCAGACAGG + Intergenic
910831677 1:91467728-91467750 AAGACTGTGGGAGTTCAGTCAGG + Intergenic
912975376 1:114324505-114324527 GAGCCACTGGGAGGTCCGAGTGG - Intergenic
918163377 1:181921109-181921131 AAGCCTCTGGAAGTTCAGACTGG + Intergenic
919827542 1:201514125-201514147 AGAGCACCGGGAGTTCAGACAGG + Intergenic
919882401 1:201909177-201909199 AAGCCACCGAGAGGTCAGGCAGG - Intronic
921258691 1:213366069-213366091 GAGCCACTGGGAGCTCCTACTGG + Intergenic
921383425 1:214547778-214547800 AAGCCACTGAGAGATTAGAAGGG - Intronic
921631363 1:217437608-217437630 AAGCTGCTGGGAGTTCCAACTGG + Intronic
922594150 1:226800820-226800842 GAGCCAGTGGGGGATCAGACAGG - Intergenic
923514315 1:234681685-234681707 AAGGAACTGGGAGTCCAGAGAGG + Intergenic
924479797 1:244418581-244418603 AAAGCACTGGGATTACAGACAGG + Intronic
1063658520 10:8015589-8015611 AATCCACTGTGATTTCAGCCAGG + Exonic
1065155155 10:22862185-22862207 AAGCCACTGGGAGGTCCTGCAGG - Intergenic
1065962115 10:30742200-30742222 ATGCCACTGGGACCTCAGAAGGG - Intergenic
1066392672 10:34990877-34990899 AAAGCACTGGGATTACAGACAGG - Intergenic
1067143114 10:43672710-43672732 AATCAGCTGGGATTTCAGACAGG - Intergenic
1068165951 10:53333148-53333170 ATGCCAAGGGGAGTTCAGCCAGG + Intergenic
1069236136 10:66076587-66076609 AACCCACTGGGTGTTAAGAGGGG - Intronic
1070643057 10:78182793-78182815 CAGCCCCTGGGAGCTCACACGGG - Intergenic
1074404228 10:113166997-113167019 ATCCCACTGGGAGTTCAAAGGGG - Exonic
1074583675 10:114745516-114745538 ACGCCACTGGCATTTCAGCCTGG + Intergenic
1075467766 10:122664444-122664466 AAGCCTCTGGGGATACAGACTGG - Intergenic
1076430501 10:130398647-130398669 ATGCCAAGGGGAGTTCAGCCGGG - Intergenic
1080775053 11:35378231-35378253 AAGCCACTGTGATTTGAGCCTGG - Intronic
1083158597 11:60840974-60840996 AAACCACTGGAATGTCAGACGGG + Intergenic
1085325857 11:75606175-75606197 ACGGAACAGGGAGTTCAGACGGG - Intronic
1085728998 11:78980420-78980442 AAGTCATTAGGAGTTCAGAGTGG - Intronic
1088201287 11:107338099-107338121 TAGCCACTGGTACTTCAGCCTGG - Intronic
1089199280 11:116714132-116714154 ATGCAGCTGGGAGTTCTGACAGG - Intergenic
1091006678 11:131960132-131960154 AAGTCACAGGGTGTTCAGAAGGG + Intronic
1091182320 11:133617958-133617980 AAGGGACTGAGAATTCAGACAGG - Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091623501 12:2106468-2106490 AAGCCACTGGGAGCCCACCCCGG + Intronic
1091623534 12:2106574-2106596 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091623584 12:2106734-2106756 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091623597 12:2106787-2106809 AAGCCACTGGGTGCTCACCCCGG + Intronic
1091623718 12:2107163-2107185 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091623749 12:2107288-2107310 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091623780 12:2107395-2107417 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091623811 12:2107502-2107524 AAGCCACTGGGTGCTCACCCTGG + Intronic
1091650676 12:2306883-2306905 CAGCCACTGGCAGTGCAAACAGG - Intronic
1091970202 12:4780340-4780362 TGGCTACAGGGAGTTCAGACTGG - Intronic
1094031288 12:26014070-26014092 AAGGCACTGGCAGCTCAGGCAGG - Intronic
1094084473 12:26574759-26574781 AAGGCACAGGGAGAGCAGACGGG + Intronic
1095434416 12:42171456-42171478 TAGCCACTGGCATTTCAGACTGG + Intronic
1095729738 12:45493476-45493498 AAACCAGTGAGATTTCAGACAGG + Intergenic
1098348279 12:69529171-69529193 GAGAGACTGGGAGATCAGACAGG + Intronic
1099599306 12:84712473-84712495 AAGCAACTGGGATTACAGGCAGG + Intergenic
1101826867 12:108227191-108227213 AAGCCACTGGGAGTGCATCTGGG - Intronic
1102495883 12:113319400-113319422 CAGCCAATGGGAGGCCAGACAGG + Intronic
1102742650 12:115221922-115221944 AAGTAACTGGAAGTTCAGAAAGG - Intergenic
1103182277 12:118923871-118923893 AAGTAACTGGGACTACAGACAGG - Intergenic
1103999472 12:124851256-124851278 AAGCCACTGGCAAGTGAGACTGG + Intronic
1106568637 13:30907367-30907389 AAGCCCCTGGAAGTCCAGCCCGG + Intronic
1107641946 13:42452934-42452956 AACCACCTGGAAGTTCAGACTGG - Intergenic
1107824331 13:44313878-44313900 AAGCCACTGAGGGATCAGACTGG + Intergenic
1110545351 13:76749582-76749604 AAGGTCCTGGGAGTACAGACAGG + Intergenic
1110942046 13:81362922-81362944 AAGCCACCAGGAGTTCGAACTGG + Intergenic
1112381718 13:98897159-98897181 AAGCCACTGCAAGTGCAAACAGG - Intronic
1114671881 14:24415847-24415869 AAACCACTGGGAGTGGGGACTGG - Exonic
1116379556 14:44248257-44248279 TACCCACTGGGAGCTCAGATGGG - Intergenic
1117023649 14:51597820-51597842 GGGCCACTGAGAGTTCTGACTGG + Intronic
1118544733 14:66873638-66873660 AAGCAGCTGGAAGTTCGGACTGG + Intronic
1119303894 14:73591804-73591826 AAGCCCCTGGGACTTCAGACCGG - Exonic
1120488544 14:85146926-85146948 TAGCCAGTGGGATTCCAGACTGG - Intergenic
1121521950 14:94592142-94592164 TAGCCTCTGAGAGTTCAGGCGGG - Exonic
1121572326 14:94956382-94956404 AAGCCAGTGGGACTTTAGACAGG + Intergenic
1122126623 14:99581923-99581945 AAGCCAAGGGGGGTTCACACCGG - Intronic
1122823920 14:104360475-104360497 CAGCCCCTGGGATCTCAGACTGG + Intergenic
1123721639 15:23066210-23066232 AGGCCGCTGGGAGCTGAGACCGG - Intergenic
1124318656 15:28694279-28694301 AGGCCACGGGGAGCTGAGACCGG - Intergenic
1125972797 15:43925731-43925753 AAGCCTTGGGGAGTTCAGAACGG - Intronic
1126857061 15:52848721-52848743 AAGCCACTGAGAGAACAGACTGG + Intergenic
1127613797 15:60663067-60663089 ATGCCACAGGGAGATCAGAGTGG - Intronic
1128221451 15:65971587-65971609 CTGCCACAGGGAGTTCAGTCCGG - Intronic
1129874704 15:78966070-78966092 AAGCCACTGGGGGTACAGAATGG - Intronic
1131426442 15:92348938-92348960 TGGCCTCTGGGATTTCAGACAGG - Intergenic
1133628097 16:7591063-7591085 AGGCCACTGAGAGTCCGGACAGG + Intronic
1133983598 16:10651453-10651475 TAGGCACTGGGAATTCAGAAGGG - Intronic
1134226428 16:12394646-12394668 TATCCACTGGGACTTCAGATGGG + Intronic
1134355030 16:13474286-13474308 AAACCACTGGGTGTTGAGATCGG - Intergenic
1137442248 16:48507439-48507461 AAGACACAGGGAGAACAGACAGG - Intergenic
1137605012 16:49781430-49781452 AACCCACTGCGAGTTCAGCGTGG + Intronic
1138027878 16:53537041-53537063 TGGCCTCTGGGAGTTCAGTCAGG - Intergenic
1138559357 16:57791394-57791416 AAGCCACAGGAAGGACAGACGGG + Intronic
1140434343 16:74933256-74933278 ATGCCACTTGGAGTGCAGCCTGG + Intronic
1143848568 17:9791942-9791964 GAGCCACTGGGAGGTGTGACAGG + Intronic
1143875087 17:9985366-9985388 AAGCCAGTGGGATGTCAGTCTGG - Intronic
1147663086 17:42128080-42128102 AAGGCACTGGGATTACAGACAGG + Intronic
1149018554 17:51936701-51936723 AAGCCACTGAGAGTTTAGCAGGG + Intronic
1149513868 17:57265128-57265150 TGGCCACCGGGATTTCAGACTGG + Intronic
1152071425 17:78135650-78135672 AAGCCAGTGGGAGCTCAGGTGGG - Intronic
1153012928 18:556154-556176 AAGGCCCTGAGAGTTAAGACGGG - Intergenic
1154385693 18:13889915-13889937 AAGCCTGTGGGACTTTAGACCGG - Intronic
1155480963 18:26286944-26286966 AAAGCACTGGGATTACAGACAGG + Intronic
1156188367 18:34689910-34689932 AAGCCACTGGGAGTTCAGACTGG - Intronic
1156805623 18:41176073-41176095 TAGCCACTGGGAGTTCCTTCAGG + Intergenic
1157271745 18:46281668-46281690 AACCCACTGGGAGTCTAGACTGG + Intergenic
1158128609 18:54128358-54128380 AAGCAACTGGGTCTTCAGACAGG - Intergenic
1161045477 19:2132157-2132179 AGCCCACTGGCAGCTCAGACAGG + Intronic
1162196850 19:8991605-8991627 AAGACACTGGAGGTTCAGAGAGG + Intergenic
1163876079 19:19869473-19869495 CAGCTACTGGGAGCTGAGACAGG - Intronic
1165997906 19:39858027-39858049 AAAGCACTGGGAATACAGACAGG + Intergenic
1166171447 19:41030147-41030169 AGGGCACTGAGTGTTCAGACAGG + Intergenic
1166841502 19:45699971-45699993 AAGTCACTGGGACTGCAGGCAGG - Intronic
929064730 2:37962457-37962479 AAGCCACCAGAAGTTCGGACTGG - Intronic
929356430 2:41030094-41030116 AAGCCACATAGAGTTCAGCCTGG + Intergenic
929939347 2:46320577-46320599 AAGCCACTGGGTGAACACACTGG + Intronic
930523913 2:52502164-52502186 AACCCACTGTGAGCTGAGACAGG + Intergenic
931073859 2:58686737-58686759 AAGGCACTGGGTCTTCAGACTGG + Intergenic
931111950 2:59120541-59120563 AAACCACAGGCAGTGCAGACTGG - Intergenic
931274446 2:60732382-60732404 AGGCCACTGGTACTTCTGACTGG + Intergenic
931897991 2:66755014-66755036 AAGCCACTGTGTGTTCAGAATGG - Intergenic
933182901 2:79247160-79247182 AAGTCAGTGGGAGATCACACTGG - Intronic
933275136 2:80276333-80276355 AAGCCACTTGGATTTCTGCCCGG + Intronic
934599734 2:95648519-95648541 AGGTCACTGGGGGTTCAGAAGGG - Intergenic
934716290 2:96546579-96546601 GAGCCACAGGCAGTTCAGCCAGG + Intronic
935451349 2:103213341-103213363 AAGCCACTGGGAATGCATACAGG - Intergenic
937385774 2:121431065-121431087 AAGCCAGTGGGAGTTCAAGTTGG - Intronic
937954903 2:127416647-127416669 AAGCTTCTGGGAACTCAGACAGG - Intergenic
938961995 2:136352365-136352387 AAGCCACTGGGCTTCCAGACTGG - Intergenic
940057563 2:149528956-149528978 AACCCACTAGGGGCTCAGACAGG - Intergenic
942642050 2:178071324-178071346 AAGCCATTGGGTGTTAAGAAAGG + Intronic
943804360 2:192103971-192103993 AAGCCACCGGGAGTTTTGAGAGG + Intronic
947349926 2:229232921-229232943 AAGTCACTCCGAGTTGAGACTGG + Intronic
947373887 2:229475725-229475747 AGGCCTCTGGAAGTTCAGATGGG - Intronic
1171046389 20:21812134-21812156 GAGCCACTGGGAGATCGGTCAGG - Intergenic
1173184930 20:40833355-40833377 AAGCCATTGGGATTTCAGCCAGG - Intergenic
1173908462 20:46646054-46646076 GAGCCTCAGGGAGCTCAGACAGG - Intronic
1174366288 20:50058578-50058600 GAGTAACTGGGACTTCAGACAGG - Intergenic
1175048883 20:56134379-56134401 CAGCCTCTTAGAGTTCAGACAGG + Intergenic
1179052950 21:37904651-37904673 AAGTCACTGGGAATTTAGCCTGG - Intronic
1179886313 21:44315716-44315738 AAGCCACTGTGGGTCCACACTGG - Intronic
1181162216 22:20965666-20965688 AAGCCACTGGGAGTCCGATCTGG + Intronic
1181272943 22:21671022-21671044 ATGCCATCGGGAGTGCAGACTGG - Exonic
1181327463 22:22060916-22060938 CAGCCACTGGGACTGCACACGGG + Intergenic
1183364304 22:37399131-37399153 AAGCCTCTCCGAGTTCAGAGAGG - Intronic
1183675661 22:39297565-39297587 CTGCCACTGGGAGTTCAGTGGGG + Intergenic
1183868264 22:40721389-40721411 AAGTCACTGTGAGGTCAGAAAGG - Intergenic
1184244300 22:43228135-43228157 AGGCCACTTGAAGATCAGACAGG - Intronic
1184645579 22:45892984-45893006 AAGCCAGTGGCATTTCAGGCTGG + Intergenic
949580590 3:5384041-5384063 AAGCCACTGGGAATTTCGAATGG - Intergenic
953609169 3:44433296-44433318 TAGAGACAGGGAGTTCAGACTGG + Intergenic
954464852 3:50648364-50648386 AGGCCACTGGGAGTTGTGGCTGG + Exonic
955263286 3:57416352-57416374 AAAGCACTGGGATTACAGACAGG + Intronic
961100937 3:124198550-124198572 AAGCCCCTGGTAGCTCAGCCAGG - Intronic
961637119 3:128340718-128340740 CTGCCACTGGGAGTTGGGACAGG + Intronic
963964409 3:151349544-151349566 AAAGCACTGGGATTACAGACAGG + Intronic
965017422 3:163175088-163175110 AAGCTGCAGGAAGTTCAGACTGG + Intergenic
966182435 3:177198923-177198945 AGGCCACCAGGAGTCCAGACTGG - Intergenic
966549085 3:181184074-181184096 AAGAGAGTGGGAGGTCAGACAGG + Intergenic
968009719 3:195266165-195266187 AAGCCACTGGAGGTTCTGAATGG + Intronic
969060455 4:4429833-4429855 CAGCCACTGGGAGTTTCTACAGG + Intronic
969409041 4:7015780-7015802 AAGGAACTGGGAGCTCAGCCGGG - Intronic
971478743 4:27095664-27095686 AAGCCACTGGCCATTCAGAAGGG - Intergenic
972349515 4:38223726-38223748 AAGCCACTGGGAGCCCAGTTTGG + Intergenic
981266331 4:142787991-142788013 AAAGCCCTGGGAGTTCAGATGGG + Intronic
984526040 4:180860500-180860522 AAGCCCCTGGAAGTTCAGACTGG - Intergenic
986711528 5:10491501-10491523 AAGCCAGTGGGAGTCCTGCCAGG + Intergenic
991576606 5:68110786-68110808 AATCCACTGGGAGTAGAGCCGGG + Intergenic
992085384 5:73273758-73273780 AAGCAACGAGGAGATCAGACTGG - Intergenic
993014169 5:82516969-82516991 ATGTCCCTGGGAGTACAGACTGG + Intergenic
994202114 5:96988724-96988746 AAGTCATTGGGACTACAGACAGG + Intronic
998672268 5:144367210-144367232 TAGCCACTTGAACTTCAGACAGG + Intronic
1003405205 6:5822147-5822169 GAACCACTGGGAGCCCAGACTGG + Intergenic
1004160391 6:13207642-13207664 AAGGCACTGGGATTTCCCACTGG + Intronic
1006775568 6:36589941-36589963 AAGTAACTGGGAATTCAGGCTGG + Intergenic
1006986308 6:38178009-38178031 GAGCCACAGGGAGCTCAGTCAGG - Intronic
1007789281 6:44299887-44299909 CAGACAGTGTGAGTTCAGACTGG + Exonic
1008407579 6:51136208-51136230 AAGCCCCTGGAAGTTCAGACTGG - Intergenic
1008722286 6:54370663-54370685 AAGCCACTGAGAGGTCCCACAGG + Intronic
1009285976 6:61818018-61818040 AAGCCTCTGGGTTTTAAGACGGG - Intronic
1023100237 7:36710406-36710428 AAGCAAATGGGAGTTCAGTCCGG + Intronic
1027473277 7:78598706-78598728 AAGCTACTGGGAGGTGACACTGG + Intronic
1027783546 7:82550501-82550523 AAGCCATTGGAAGTGCAGGCAGG + Intergenic
1028420950 7:90632262-90632284 GAGCCACTGGGAGTCCAGGAAGG + Intronic
1031424127 7:121585145-121585167 GAACCTCTGGGAGTTCAGAAGGG - Intergenic
1031615972 7:123879932-123879954 CAGCAACTGGGATTACAGACTGG - Intergenic
1031672207 7:124563650-124563672 AAGCCATTGGGAGTTAGGAAGGG - Intergenic
1034907273 7:154961011-154961033 AAGCCACTGGGCGTTGACACAGG + Exonic
1034976021 7:155449684-155449706 ACGCCTCTGGGCGTTCCGACGGG + Intergenic
1035794078 8:2337286-2337308 AAGACACCAGAAGTTCAGACTGG + Intergenic
1035798726 8:2384422-2384444 AAGACACCAGAAGTTCAGACTGG - Intergenic
1038979466 8:32741946-32741968 AAGACACTGAGCTTTCAGACTGG - Intronic
1044044159 8:87409693-87409715 AAGCCCCTGGGTTTTCAGAGTGG - Intronic
1044203975 8:89470064-89470086 AAGACACTGGAAGTTGAAACTGG + Intergenic
1044319360 8:90785242-90785264 AAGCATCTCAGAGTTCAGACAGG + Intronic
1044962074 8:97541116-97541138 AAGCCACTGGGAGACCAGATGGG + Intergenic
1049242358 8:141544402-141544424 ATGCCACTTGGAGATCAGAGAGG + Intergenic
1057383132 9:94586467-94586489 AAGACAATGGTAGATCAGACTGG + Intronic
1058611438 9:106780453-106780475 AAGGGACTGGGACTTCAGATAGG + Intergenic
1061430323 9:130526736-130526758 AATCCAAAGGGAGTCCAGACAGG - Intergenic
1061875950 9:133544163-133544185 AGCACACTGGGAGTTCAGTCCGG - Intronic
1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG + Intronic
1187677023 X:21726415-21726437 AGGACACTGGGATTTTAGACTGG + Intronic
1188608787 X:32070023-32070045 TAGCCACAGGGAGTACAGGCAGG + Intronic
1194565261 X:95479174-95479196 ACGCCACTGGCACTCCAGACTGG - Intergenic
1195503672 X:105632089-105632111 AAGCCATAGTGAGTTCAGACAGG - Intronic
1195559539 X:106267942-106267964 AAGCCACTGGGACATCCCACAGG + Intergenic
1195562422 X:106298397-106298419 AAGCCACTGGGACATCCCACAGG - Intergenic
1196898047 X:120357403-120357425 GAGCCACTGTGATTTCTGACTGG + Intergenic
1197828567 X:130616348-130616370 GAGGCACAGGGAGTTCAGTCTGG + Intergenic
1198655628 X:138910510-138910532 AAGCCACTGCAAGTTCTGAAAGG + Intronic
1201546733 Y:15173213-15173235 AAGTAACTGGGATTGCAGACCGG + Intergenic