ID: 1156188367

View in Genome Browser
Species Human (GRCh38)
Location 18:34689910-34689932
Sequence AAGCCACTGGGAGTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156188367_1156188372 24 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT No data
Right 1156188372 18:34689957-34689979 ACCTACTCAAGCCTCAGTAATGG No data
1156188367_1156188370 -5 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT No data
Right 1156188370 18:34689928-34689950 GGCTTTGTTTACACTGTGAGAGG No data
1156188367_1156188374 27 Left 1156188367 18:34689910-34689932 CCAGTCTGAACTCCCAGTGGCTT No data
Right 1156188374 18:34689960-34689982 TACTCAAGCCTCAGTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156188367 Original CRISPR AAGCCACTGGGAGTTCAGAC TGG (reversed) Intronic