ID: 1156190274

View in Genome Browser
Species Human (GRCh38)
Location 18:34711188-34711210
Sequence TGAGAAGGCGTCTGCGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156190274_1156190281 20 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190281 18:34711231-34711253 CTGGCAGCTTGTTTCAAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1156190274_1156190282 23 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190282 18:34711234-34711256 GCAGCTTGTTTCAAAATGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 137
1156190274_1156190283 29 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190283 18:34711240-34711262 TGTTTCAAAATGGGAGGCTTTGG 0: 1
1: 0
2: 1
3: 21
4: 354
1156190274_1156190280 19 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190280 18:34711230-34711252 CCTGGCAGCTTGTTTCAAAATGG 0: 1
1: 0
2: 2
3: 10
4: 188
1156190274_1156190277 1 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156190274 Original CRISPR TGAGAAGGCGTCTGCGCTCT GGG (reversed) Intronic
900228665 1:1544839-1544861 TGAGGAGGCGGCTGCGTGCTGGG - Intronic
903031539 1:20467430-20467452 TGAGAAGGAGGCGGTGCTCTTGG - Intergenic
903231699 1:21926271-21926293 TGAGAAGGTGTCAGCACTCAGGG + Intronic
905814029 1:40934012-40934034 TGAGAATGCGTCTGGACTCATGG + Intergenic
912708728 1:111934224-111934246 TGGGAGGGAGTCTGCTCTCTTGG - Intronic
915729593 1:158043672-158043694 GGAGAAGGCCTCTGCTTTCTTGG + Intronic
916988433 1:170216202-170216224 TGAGCATGCGTTTGCGCACTGGG - Intergenic
1064057431 10:12109528-12109550 AGAGAAGGTGCCTGAGCTCTGGG + Intronic
1070101939 10:73396553-73396575 TGAGAAGGCATCTGTCCTCCAGG + Exonic
1070980754 10:80644847-80644869 TGATGAGGCCTCTGCTCTCTGGG + Exonic
1071907209 10:90187480-90187502 GGAGAATGCGTCTGCACTCAAGG - Intergenic
1073563980 10:104519743-104519765 TGAGAAGGAATCTCCCCTCTCGG + Intergenic
1076869603 10:133186908-133186930 TGAGGAGGCGGCTGCTTTCTGGG - Intronic
1078731157 11:13975197-13975219 AGACATGGCGTCTGCTCTCTAGG - Intronic
1090260494 11:125315465-125315487 TGAGAAGGCCTCTCTGCACTGGG - Intronic
1095250504 12:39973416-39973438 AGAGAAGGAATCTGGGCTCTGGG - Intronic
1096657042 12:53098251-53098273 GCAGAAGGTGTCTGCGCTCTCGG + Intronic
1097082049 12:56439146-56439168 TGAGAAGGAGTTTTCACTCTTGG - Intronic
1102406552 12:112678889-112678911 TGAGAAGGGGTCTGTGTTCCGGG + Intronic
1102437297 12:112935011-112935033 TGAAAAGGCCTCTGCTCTCATGG - Intergenic
1103378109 12:120472484-120472506 TGAGAAGGCATCTGGACTTTCGG - Intronic
1104444870 12:128824567-128824589 TGAGACGGCGGCTGCTCTCCAGG + Intergenic
1107272784 13:38640214-38640236 TGAGAATTCATCTGCACTCTAGG + Intergenic
1113082805 13:106535476-106535498 TGAGAAGGCTCCTGCGCGCCCGG - Intergenic
1113882984 13:113638266-113638288 TCAGAACGCGTCTGCGGTCTGGG + Intronic
1113882991 13:113638437-113638459 TCAGAACGCGTCTGCGGTCTCGG + Intronic
1114365160 14:22018273-22018295 TGAGGAGGTGTCTGCGCTTTGGG - Intergenic
1115886385 14:37976392-37976414 TGGGAAGGGGTCTGGGCTCCAGG - Intronic
1117360183 14:54965205-54965227 TGAGCAGGTCTCTGCCCTCTGGG + Intronic
1127311050 15:57752661-57752683 GGAGAAGGCTTCTGCGCTGCAGG + Intronic
1127499638 15:59544200-59544222 TGAGGAGACGTCTGGGCCCTAGG + Intergenic
1134071248 16:11261211-11261233 TGAGGAGGCGTCTGGTCTCAGGG + Intronic
1138479577 16:57293353-57293375 TGAGACGGAGTCTGTCCTCTAGG + Intergenic
1143465212 17:7131951-7131973 TGAGACGGAGACTTCGCTCTTGG - Intergenic
1144520960 17:15951912-15951934 AGAGGAGGCCTCTGCCCTCTGGG - Intronic
1146645231 17:34572747-34572769 TGAGATGGCCTCTGCCCTCAAGG - Intergenic
1152394980 17:80026910-80026932 TGAGAAGGCATCTGGCCCCTAGG - Intronic
1152918423 17:83053138-83053160 GGAGAAGGCGGCCGGGCTCTGGG + Intergenic
1154530055 18:15333608-15333630 TGAGACGGAGTCTGCTCTGTCGG - Intergenic
1156190274 18:34711188-34711210 TGAGAAGGCGTCTGCGCTCTGGG - Intronic
1159946201 18:74446517-74446539 TGAGAAGGTTTCTGAGCTCCTGG - Intronic
1163577148 19:18117672-18117694 TGAGAAGGGGTCAGTGCTCTGGG + Intronic
1163694377 19:18756313-18756335 TGAGATGGAGTTTTCGCTCTTGG - Intronic
1164823705 19:31268728-31268750 GGAGAAGGCCTCTGCTTTCTTGG + Intergenic
1165416551 19:35697549-35697571 TGAGATGGAGTCTGCCCTCCAGG - Intergenic
1166549560 19:43656287-43656309 TGAGAAGGCATCTGGGTTCCTGG + Intronic
926006738 2:9378613-9378635 TGAGAAGGACGCTGGGCTCTAGG + Intronic
932973366 2:76572890-76572912 TGAGAAGGATTCTTCTCTCTTGG - Intergenic
934955028 2:98609863-98609885 TGAGAAGGCTTTTCCGCTTTCGG + Exonic
942796589 2:179827835-179827857 TGAGAAGGCATCTGGGGTTTTGG - Intronic
948088087 2:235267278-235267300 GGAGGAGGCATCTGTGCTCTGGG + Intergenic
948256148 2:236569433-236569455 TGTGAATGCCTCTTCGCTCTAGG - Intronic
948795548 2:240400477-240400499 AGATAAGGGGTCTGAGCTCTGGG + Intergenic
1169561004 20:6800645-6800667 TGAGGATGCCTCTGCTCTCTTGG + Intergenic
1169927620 20:10799314-10799336 TGAGGAGGCTTCTGCGGGCTGGG + Intergenic
1176066012 20:63195601-63195623 TCAGAAAGCGTCTGCTCTCTAGG + Exonic
1176667923 21:9705003-9705025 TGAGAAGGCGACGTCACTCTTGG - Intergenic
1176767358 21:13034866-13034888 TGAGATGGAGTCTGCTCTGTCGG + Intergenic
1178348218 21:31850484-31850506 AGACAAGGCGTCTGCACTCTTGG - Intergenic
1180165449 21:46023361-46023383 TGCGGACGCGTCCGCGCTCTAGG + Intergenic
1182760768 22:32720829-32720851 GGAGAGGGCTTCTGAGCTCTGGG - Intronic
1185084731 22:48734515-48734537 AGAGGAGCCGTCTGGGCTCTGGG + Intronic
960658979 3:120038135-120038157 TGAGTAAGCGCCTGGGCTCTGGG - Intronic
963001605 3:140686936-140686958 TGAGAGGGCATCTGTGCTCAAGG - Intronic
974101984 4:57427327-57427349 TGGGAAGGCTCCTGCTCTCTAGG - Intergenic
983820541 4:172188483-172188505 TGACACGGTGTCTGCTCTCTTGG + Intronic
985406874 4:189646595-189646617 TGAGAAGGCGACGTCACTCTTGG + Intergenic
992671889 5:79069634-79069656 GGAGCAGGCGCCTGCGCCCTCGG - Exonic
999969479 5:156844906-156844928 TGAGAAGGGGCCTCTGCTCTTGG + Intergenic
1006744259 6:36330413-36330435 TGCGAAGGCCTCTGCTCGCTGGG + Exonic
1007725709 6:43914538-43914560 TGAGAAGGACTCTGCCCACTGGG - Intergenic
1008760288 6:54846210-54846232 TGAGAAGGAGTCTGCACTGCGGG + Intergenic
1017175988 6:151505266-151505288 TGAGATGCCGCCTGCCCTCTTGG - Intronic
1017900420 6:158714625-158714647 TGAAAAGGAGTCTGTCCTCTGGG - Intronic
1018968622 6:168508964-168508986 TGAGGAAGCGTCTGTGCTCCAGG - Intronic
1022770656 7:33469031-33469053 TGAGAAGTCATCTGCTCTTTTGG + Intronic
1027675353 7:81150961-81150983 TGAGATGGTGGCTGGGCTCTTGG - Intergenic
1035689006 8:1547613-1547635 TGGGAAGGCGGCTGGGCGCTGGG - Intronic
1049108231 8:140626723-140626745 TGTGGAGGTGTCTGAGCTCTTGG - Intronic
1057298425 9:93862501-93862523 TGGGAAGGTCTCTGCTCTCTGGG - Intergenic
1061367210 9:130178308-130178330 TGAGGAGGAGGCTGGGCTCTGGG - Intronic
1062354037 9:136153492-136153514 TGAGAAGAAGTCTGGGCTCCTGG + Intergenic
1203657890 Un_KI270753v1:15700-15722 TGAGAAGGCGACGTCACTCTTGG + Intergenic
1185464514 X:346563-346585 GGAGGAGGCGGCCGCGCTCTGGG - Intronic
1193238540 X:79138507-79138529 TGAGCAGGTGTCTTCTCTCTGGG + Intergenic
1197349684 X:125369039-125369061 TGAAAAGGAGTCTCTGCTCTTGG + Intergenic
1198403740 X:136291933-136291955 TGAGCAGGCCTCTGCCCTCCTGG + Intergenic