ID: 1156190275

View in Genome Browser
Species Human (GRCh38)
Location 18:34711189-34711211
Sequence ATGAGAAGGCGTCTGCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156190275_1156190281 19 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190281 18:34711231-34711253 CTGGCAGCTTGTTTCAAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 177
1156190275_1156190277 0 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 48
1156190275_1156190280 18 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190280 18:34711230-34711252 CCTGGCAGCTTGTTTCAAAATGG 0: 1
1: 0
2: 2
3: 10
4: 188
1156190275_1156190283 28 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190283 18:34711240-34711262 TGTTTCAAAATGGGAGGCTTTGG 0: 1
1: 0
2: 1
3: 21
4: 354
1156190275_1156190282 22 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190282 18:34711234-34711256 GCAGCTTGTTTCAAAATGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156190275 Original CRISPR ATGAGAAGGCGTCTGCGCTC TGG (reversed) Intronic
903231698 1:21926270-21926292 ATGAGAAGGTGTCAGCACTCAGG + Intronic
915366838 1:155321450-155321472 CAGAGAACGCGGCTGCGCTCTGG - Intronic
915950947 1:160189708-160189730 ATGAGAAGGGGTCTGTCCTTTGG - Intergenic
916988434 1:170216203-170216225 ATGAGCATGCGTTTGCGCACTGG - Intergenic
923732549 1:236566761-236566783 ATGGGCAGGCGCCTGTGCTCCGG + Exonic
1069786129 10:70989037-70989059 CTGAGAAGGGGTCTGACCTCTGG - Intergenic
1070964189 10:80519409-80519431 ATGAGAAGTGGTCTGAGCTATGG - Exonic
1075980549 10:126735168-126735190 ACGAGCAGGCGGCTGTGCTCTGG - Intergenic
1077056410 11:595996-596018 ATGAGAAGGTGTCTGCTGTGTGG - Intronic
1077540798 11:3145619-3145641 AAGAGCAGGGGTCTGCGCTGGGG + Intronic
1083443415 11:62691461-62691483 ATGAGAAGGCTGGTGCTCTCTGG - Intronic
1084775372 11:71371269-71371291 CTGAGAATGTGGCTGCGCTCGGG - Intergenic
1090665990 11:128915197-128915219 ATGAGGAGGCCTCTGTGCTTAGG - Intronic
1093181583 12:15972761-15972783 AGGAGAAGGGATCTGCGTTCAGG + Intronic
1095250505 12:39973417-39973439 AAGAGAAGGAATCTGGGCTCTGG - Intronic
1099938968 12:89162310-89162332 ATGACAAGGCCTTTGCTCTCAGG + Intergenic
1102406551 12:112678888-112678910 GTGAGAAGGGGTCTGTGTTCCGG + Intronic
1111054296 13:82927520-82927542 ATGAGAAGTCTTCAGAGCTCAGG + Intergenic
1113882983 13:113638265-113638287 TTCAGAACGCGTCTGCGGTCTGG + Intronic
1114365161 14:22018274-22018296 GTGAGGAGGTGTCTGCGCTTTGG - Intergenic
1121876532 14:97458152-97458174 ACGGGAAGGCGTCTTCGGTCCGG + Intergenic
1123508492 15:20970950-20970972 ATGAGAAGGCATCTGAGCTAAGG - Intergenic
1123565714 15:21544699-21544721 ATGAGAAGGCATCTGAGCTAAGG - Intergenic
1123601977 15:21981986-21982008 ATGAGAAGGCATCTGAGCTAAGG - Intergenic
1202974085 15_KI270727v1_random:271792-271814 ATGAGAAGGCATCTGAGCTAAGG - Intergenic
1133612599 16:7447544-7447566 ATGAGAAGGTGACTGGGCTTAGG - Intronic
1134071247 16:11261210-11261232 CTGAGGAGGCGTCTGGTCTCAGG + Intronic
1136394396 16:29985235-29985257 ATGAGCAGGACTCTGCGCTGCGG + Exonic
1137919897 16:52476581-52476603 AAGAGAAGGCCTCTGATCTCTGG + Intronic
1142858411 17:2746457-2746479 TGGAGAAGGCTTCTGTGCTCAGG + Intergenic
1153507342 18:5814654-5814676 TTGAGCAGGCGTCTGGGCTGAGG + Intergenic
1156190275 18:34711189-34711211 ATGAGAAGGCGTCTGCGCTCTGG - Intronic
1160172308 18:76565363-76565385 ATGAGGAGGCGGCTTTGCTCGGG + Intergenic
1163577147 19:18117671-18117693 CTGAGAAGGGGTCAGTGCTCTGG + Intronic
1166044784 19:40223507-40223529 GTGAGAAGGAGTCCGCGCTCAGG + Exonic
925293452 2:2763187-2763209 AGGAGGAGGGCTCTGCGCTCAGG - Intergenic
937408143 2:121649405-121649427 AGGAGAAGGCGGCGGCTCTCTGG - Exonic
1170828527 20:19819112-19819134 ATTAGAAGGTGTCTTAGCTCAGG + Intergenic
1184554288 22:45224931-45224953 CTGAGAAGGCGTCTGCCGTGGGG + Intronic
949147698 3:722561-722583 TTGAGAAGGAGTCTGAGTTCTGG + Intergenic
967945262 3:194799003-194799025 ATGTGATGGGGTCTGGGCTCAGG + Intergenic
971144208 4:23959419-23959441 TTGAGAAGGTTTCTGCACTCAGG - Intergenic
985180539 4:187256619-187256641 TTGAGATGGAGTCTGCACTCTGG - Intergenic
991079938 5:62587934-62587956 ATCAGAAGGCCTCTGCCATCTGG + Intronic
999770096 5:154769211-154769233 ATGAGAAGGCCTAGCCGCTCTGG + Intronic
1008760287 6:54846209-54846231 CTGAGAAGGAGTCTGCACTGCGG + Intergenic
1012233889 6:96790483-96790505 ATGAGAAGGCTTTTGCCCTCAGG + Intergenic
1013386026 6:109632053-109632075 ATGAGAGGGCGTCTGGGTGCTGG + Intronic
1016954000 6:149608813-149608835 ATGAGAAGGCCTCTGCCCCTAGG + Intronic
1017900421 6:158714626-158714648 ATGAAAAGGAGTCTGTCCTCTGG - Intronic
1018908663 6:168089436-168089458 TTGAGAAGGCGCCTGGGGTCTGG + Intergenic
1024747941 7:52429141-52429163 TTGAGATGGAGTCTGCACTCAGG - Intergenic
1026298809 7:69079336-69079358 ATAAGAAGCCTTCTGCCCTCCGG + Intergenic
1033618186 7:143037602-143037624 ATGAGAAGGAATCAGCACTCAGG - Intergenic
1034889481 7:154827513-154827535 AAGAGAGGGCGTCTGCGCAGAGG + Intronic
1037580889 8:20245536-20245558 ATGACAAGGCCTCTGCGGTGGGG - Intergenic
1044945408 8:97384525-97384547 ATGAGAAGGCCTAGGTGCTCAGG - Intergenic
1193238539 X:79138506-79138528 ATGAGCAGGTGTCTTCTCTCTGG + Intergenic
1193271503 X:79534687-79534709 ATGAGAAAGCCTCAGTGCTCAGG - Intergenic
1198596441 X:138241058-138241080 TTGAGAAGGGATCTGCTCTCAGG - Intergenic