ID: 1156190277

View in Genome Browser
Species Human (GRCh38)
Location 18:34711212-34711234
Sequence GCGTTGTTTACATATCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156190274_1156190277 1 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA No data
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG No data
1156190275_1156190277 0 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT No data
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156190277 Original CRISPR GCGTTGTTTACATATCACCC TGG Intronic