ID: 1156190277

View in Genome Browser
Species Human (GRCh38)
Location 18:34711212-34711234
Sequence GCGTTGTTTACATATCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156190275_1156190277 0 Left 1156190275 18:34711189-34711211 CCAGAGCGCAGACGCCTTCTCAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 48
1156190274_1156190277 1 Left 1156190274 18:34711188-34711210 CCCAGAGCGCAGACGCCTTCTCA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156190277 Original CRISPR GCGTTGTTTACATATCACCC TGG Intronic
910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG + Intergenic
920510982 1:206551841-206551863 TAGTTGTTCACATCTCACCCTGG + Intronic
923870796 1:237992057-237992079 GAGTTGTTTACTTTTCACCCAGG - Intergenic
1064042352 10:11978539-11978561 GAGTTTTTTAAAGATCACCCTGG - Intronic
1065196495 10:23270909-23270931 GAGTTCTGTACATATAACCCTGG - Intronic
1065442196 10:25764123-25764145 GCGATGTTTACATAACGCGCAGG - Intergenic
1071289632 10:84179492-84179514 GCGTTGCTTACACAACACCCTGG - Intronic
1079637982 11:22769208-22769230 GTGTTTTGTAAATATCACCCTGG - Intronic
1086176360 11:83895749-83895771 GCTTTGTTTCCACAGCACCCAGG + Intronic
1097416226 12:59319676-59319698 TTATTGTTGACATATCACCCAGG + Intergenic
1100510983 12:95273141-95273163 GCATTGTCTACATATAAACCAGG - Intronic
1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG + Intronic
1111203947 13:84978781-84978803 GCGTTGTTCACATTTTACCAGGG - Intergenic
1116787277 14:49301449-49301471 GAGTTGTTTACATGGCACCTGGG - Intergenic
1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG + Exonic
1126095571 15:45087326-45087348 GTGTTGTTTCCATATCACACTGG + Intergenic
1153585294 18:6614658-6614680 GTGTTGTTTATAAATCACCCAGG - Intergenic
1154956070 18:21256503-21256525 TAGTTGTTTTCACATCACCCTGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156276533 18:35589041-35589063 GCTTTGTTTTGATACCACCCTGG + Intronic
925382122 2:3435813-3435835 GCATTCATTACATATCACACAGG - Intronic
927372160 2:22368793-22368815 TCTTTGTTTACATATCAATCTGG - Intergenic
935676867 2:105601914-105601936 GCGGTGTTTAAAAATCACCTTGG - Intergenic
940400488 2:153243111-153243133 GGGATGTGTGCATATCACCCAGG - Intergenic
941110946 2:161418164-161418186 ACATTGTTTACATATGCCCCTGG - Intronic
944830586 2:203530399-203530421 GCTTTGTTTTGATTTCACCCAGG + Intronic
945135411 2:206622482-206622504 GCTTTGTTTACTCATCACCTTGG - Intergenic
1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG + Exonic
1175516049 20:59570902-59570924 GGGTTGATTACAGAACACCCAGG - Intergenic
1178353997 21:31895384-31895406 GTGTTGATTACTTATCAGCCCGG + Intronic
1180319858 22:11310004-11310026 TTGTTGTTTACCTGTCACCCAGG + Intergenic
952509142 3:34036486-34036508 GCCTTGGCTCCATATCACCCTGG - Intergenic
952525891 3:34210308-34210330 GTGTTGTTTTCATCTCTCCCCGG - Intergenic
956016071 3:64884386-64884408 TCCTTATTTACATATCACCGTGG + Intergenic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG + Intronic
980693530 4:136327844-136327866 GTGAGGTTTACATAGCACCCAGG + Intergenic
981121858 4:141060574-141060596 CCTTTGTTTACATTTTACCCTGG - Intronic
982794731 4:159630982-159631004 GCTTTGTTTATATATCAGTCTGG - Intergenic
995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG + Intergenic
999475059 5:151890836-151890858 GCATTGTTAACATAACCCCCAGG - Intronic
1008387125 6:50904506-50904528 GCCTTCTTTAAATATCACCAAGG - Intergenic
1013315685 6:108940467-108940489 GTGATGTTTACATAGCACGCAGG + Intronic
1024786876 7:52918136-52918158 GTGTTGTTTATATCTGACCCAGG + Intergenic
1035421594 7:158733877-158733899 GCCTTGTTTATATATCACTGAGG - Exonic
1042758387 8:72243482-72243504 CTGTTGTTTCCATATCATCCAGG - Intergenic
1044934459 8:97279318-97279340 GGGGTGTATACAAATCACCCAGG - Intergenic
1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG + Intronic
1057092998 9:92277087-92277109 ATGTAGTCTACATATCACCCAGG - Intronic
1188688400 X:33098594-33098616 ACATTGTTTACATATAACACAGG - Intronic
1191609745 X:63100178-63100200 GTGATGTTTACATAACACACAGG + Intergenic
1191701623 X:64048154-64048176 GAGTTCTTTCCATATAACCCTGG - Intergenic
1194554000 X:95335537-95335559 TCATTGTTTCCATTTCACCCTGG - Intergenic
1200784649 Y:7249436-7249458 GCAGTATTTGCATATCACCCAGG + Intergenic