ID: 1156191761

View in Genome Browser
Species Human (GRCh38)
Location 18:34728605-34728627
Sequence AACAAGGACTTGGGTACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156191761 Original CRISPR AACAAGGACTTGGGTACAGT TGG Intronic
900941962 1:5804690-5804712 TACAAGGACTGGGGTGCTGTGGG - Intergenic
902738171 1:18414912-18414934 GACAAGGACTTGGGTGCAGGTGG - Intergenic
902772068 1:18650929-18650951 AAGCAGGAGTTGGGGACAGTAGG - Intronic
904728226 1:32566743-32566765 AGCAAAGACTTGTGTAGAGTTGG + Intronic
904961181 1:34334331-34334353 GACAAGGAGTTGGGGAGAGTAGG - Intergenic
906566425 1:46804312-46804334 CACAAGGAATTGGAAACAGTGGG + Intronic
907280405 1:53343449-53343471 AACAAGGACTTGGGAGCTGAAGG + Intergenic
907283850 1:53367955-53367977 AAAAAGGACTTGGGGACAGAGGG - Intergenic
911075095 1:93865401-93865423 TATAAGCACTTGGGTACAGCAGG - Intergenic
912907875 1:113726055-113726077 AACAAGGATCTTGGTACATTTGG - Intronic
913119818 1:115729457-115729479 AATAATGCCTTGGGTTCAGTAGG - Intronic
915954221 1:160209398-160209420 CACAAAGACTTGGGGGCAGTGGG - Intronic
917872629 1:179255639-179255661 AACAAGAGTTTGGATACAGTAGG + Intergenic
918350963 1:183655377-183655399 TATAATTACTTGGGTACAGTAGG - Intronic
918441335 1:184570085-184570107 AACAAGGAATTAGGTAGAGGTGG + Intronic
919499866 1:198324424-198324446 AGCAATCACTTGGCTACAGTTGG - Intergenic
919732474 1:200922054-200922076 AACAAGGACATGGATAGGGTGGG - Intergenic
920755229 1:208723820-208723842 AAGTAGGACTTGGGTTTAGTAGG - Intergenic
1067709329 10:48635779-48635801 GACAAGGGCTTGGGTGCAGGTGG - Intronic
1067725305 10:48766104-48766126 AACAAGGAAATTGGTAAAGTAGG + Intronic
1070645880 10:78202194-78202216 AACATGGATTTGAGTACAGGAGG - Intergenic
1071436842 10:85655290-85655312 CACAGGGACTTGGATCCAGTGGG - Intronic
1075247959 10:120840830-120840852 AATAAGGATTTGGGTAAAGATGG - Intergenic
1077242536 11:1518121-1518143 AACAAGGGTCTGGGGACAGTAGG + Intergenic
1078438059 11:11341782-11341804 AAGAAGGAGTTGGGGGCAGTGGG - Intronic
1080433103 11:32216468-32216490 AAAAAGGCCTAGGGTACAGGGGG + Intergenic
1081181978 11:39995020-39995042 AAAAAGGACTTTGGAACAGCTGG + Intergenic
1083846740 11:65339292-65339314 AACAAGGACTTTGGTAATGGAGG - Intronic
1086960686 11:92977637-92977659 AACAAGGTGGTGGGAACAGTGGG - Intronic
1090461877 11:126898264-126898286 ACCAAGGACTGGGGAACAGGTGG + Intronic
1091472406 12:740565-740587 AAGAAGGCCTTGGGCACAGCAGG - Intergenic
1095735584 12:45553019-45553041 GACAAGGAGTTGGGTGCAGCTGG - Intergenic
1096362422 12:50999553-50999575 AACTAGGCCTTGGGTAAAGTAGG + Intronic
1099254414 12:80297980-80298002 AACAAGAACTTGGAGACAATTGG - Intronic
1101256996 12:102988440-102988462 AAAAAGGGCTTGGGCACAGGAGG + Intergenic
1101860136 12:108475926-108475948 AACAAGGACTTGAGTGCAAGTGG - Intergenic
1102577279 12:113863671-113863693 AACAATGCCTTGGGTGCAGGTGG - Intronic
1108261322 13:48659381-48659403 AGCTAGGATTTGGGTTCAGTTGG + Intronic
1111235763 13:85405773-85405795 AACAAGAGCTTGGGTACCATGGG - Intergenic
1115175105 14:30553290-30553312 AACAAGATCATGAGTACAGTAGG + Intergenic
1116369049 14:44106864-44106886 AACAACAACTGTGGTACAGTAGG + Intergenic
1117228373 14:53687593-53687615 AACAAGGACTTGGGTACAGATGG - Intergenic
1117548684 14:56812604-56812626 AGGAAGGCCTTGGGGACAGTGGG + Intergenic
1120746855 14:88159924-88159946 AAAAAGGACTTGGTTACTTTGGG - Intergenic
1121653172 14:95574826-95574848 AAAAAGGACTGGGGCAAAGTGGG + Intergenic
1125077576 15:35637341-35637363 AACAAGGACTTGTTTAAATTGGG + Intergenic
1125451147 15:39808928-39808950 AACAGGCACGTTGGTACAGTTGG + Intronic
1126702662 15:51381999-51382021 AAGAAGGACCTGGGTATGGTGGG - Intronic
1129016056 15:72469940-72469962 TACTAGGACTTGGGGACAATGGG + Intergenic
1131441164 15:92460799-92460821 AACAAGGACTTGGGGTCAGAAGG + Intronic
1131814426 15:96207482-96207504 CCCAAGGACTTGGATACAGTGGG - Intergenic
1132424000 15:101698566-101698588 AAAAAGGAGTGGGGTAGAGTAGG - Intronic
1133104072 16:3495448-3495470 AACCAGGACTTGGGTGCAGCAGG + Intronic
1133455994 16:5943041-5943063 AACAAAGGCTTGAGAACAGTGGG - Intergenic
1135044254 16:19141857-19141879 AACAAGGTCTTGCTCACAGTAGG + Intronic
1137482518 16:48864459-48864481 GACAAGGATTTGGGTGCAGGTGG - Intergenic
1137851392 16:51748685-51748707 TACCAGGACATGGTTACAGTAGG + Intergenic
1137971893 16:52993923-52993945 AAAAAGGGCTGGGGGACAGTGGG - Intergenic
1141086252 16:81097365-81097387 AACAAGGAATTGTGCACACTGGG - Intergenic
1142044475 16:87916454-87916476 AGCTGGGACTTGGGTCCAGTGGG + Intronic
1145799327 17:27673021-27673043 CCCAAGGACTTGAGAACAGTGGG + Intergenic
1146159692 17:30553251-30553273 CCCAAGGACTTGAGGACAGTGGG - Intergenic
1146844690 17:36175255-36175277 CCCAAGGACTTGAGTACAGTGGG + Intronic
1146856996 17:36263190-36263212 CCCAAGGACTTGAGTACAGTGGG + Intronic
1146863621 17:36325185-36325207 CCCAAGGACTTGAGTACAGTGGG - Intronic
1146872906 17:36387100-36387122 CCCAAGGACTTGAGTACAGTGGG + Intronic
1146880264 17:36438186-36438208 CCCAAGGACTTGAGTACAGTGGG + Intronic
1147066481 17:37925773-37925795 CCCAAGGACTTGAGTACAGTGGG - Intronic
1147075790 17:37987725-37987747 CCCAAGGACTTGAGTACAGTGGG + Intronic
1147078013 17:38005334-38005356 CCCAAGGACTTGAGTACAGTGGG - Intronic
1147087315 17:38067271-38067293 CCCAAGGACTTGAGTACAGTGGG + Intronic
1147093949 17:38129269-38129291 CCCAAGGACTTGAGTACAGTGGG - Intergenic
1147103260 17:38191234-38191256 CCCAAGGACTTGAGTACAGTGGG + Intergenic
1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG + Exonic
1149847834 17:60017703-60017725 CCCAAGGACTTGAGTACAGTGGG + Intergenic
1150086190 17:62274320-62274342 CCCAAGGACTTGAGTACAGTGGG + Intronic
1151101093 17:71556114-71556136 AACTAGGACATGGGGAAAGTGGG - Intergenic
1152548674 17:81018078-81018100 AACAAGCACTTGGGAACTGCGGG - Intergenic
1155788524 18:29933397-29933419 AACAAGGACAGGGCTACAGTGGG + Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1156465901 18:37347724-37347746 CCCAAGGACTTGGGTACACAGGG + Intronic
1157012206 18:43663774-43663796 AACTGGGTGTTGGGTACAGTAGG + Intergenic
1159675436 18:71278427-71278449 CAAAAGGACTTAAGTACAGTTGG - Intergenic
1160313858 18:77822069-77822091 AACAGGGACTTGGGTGCAACAGG - Intergenic
1166011338 19:39944906-39944928 AAAAAGGAAGAGGGTACAGTGGG + Intergenic
925249294 2:2417576-2417598 GACAATGTCTTGGGTAAAGTTGG + Intergenic
928095855 2:28404624-28404646 AGCCAGGACTTGGCTACAGATGG + Intronic
928171573 2:29007782-29007804 AACAAGCACTGGGGGACAGCGGG - Intronic
928337514 2:30410496-30410518 CACAAGGCTTGGGGTACAGTAGG + Intergenic
928678321 2:33672400-33672422 AATAAGGAATGGGTTACAGTAGG - Intergenic
928698208 2:33871953-33871975 AACAAGGACTTGGGTCCCAAGGG + Intergenic
930853286 2:55985084-55985106 CCCAAGGACTGGGATACAGTTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932795254 2:74689364-74689386 AACAAGGATTTGTGGAGAGTGGG + Intergenic
934507571 2:94906215-94906237 GACAAGGACTTGGGTACCAAGGG + Intergenic
935115468 2:100131828-100131850 AACAAGGTCTAGGATATAGTGGG - Intronic
937639171 2:124192224-124192246 GACAAGGGCTTGGGAAGAGTGGG + Intronic
940176802 2:150886677-150886699 AACAAATACATGGGTTCAGTGGG + Intergenic
942594153 2:177576358-177576380 AAGAAGGATTGGGGTACAGTTGG - Intergenic
943866949 2:192937774-192937796 AGCAAGGTCATGGTTACAGTGGG - Intergenic
944049482 2:195451306-195451328 ATTAAGGACTTGGAAACAGTGGG - Intergenic
946785165 2:223235789-223235811 AAAAATTATTTGGGTACAGTGGG + Intergenic
947700361 2:232229312-232229334 AATAAGGGCTGGGGTACAGGTGG - Intronic
947727730 2:232410272-232410294 CACAAGGACTTGGGTGCATCAGG + Exonic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1170717982 20:18848415-18848437 CACAAGGACTTAGGTGCAGGTGG - Intergenic
1170910639 20:20563928-20563950 AACAAGGACTGAGGCACAGATGG - Intronic
1171168804 20:22997350-22997372 AACAAGTCCTTTGGTGCAGTGGG + Intergenic
1174235664 20:49089109-49089131 AACAAGCACTAGGGTATAATTGG + Intronic
1174892419 20:54410484-54410506 AAGGATGACTTGGGAACAGTTGG + Intergenic
1175167263 20:57053731-57053753 AACAAGAAATTGGGATCAGTAGG - Intergenic
1178507093 21:33171242-33171264 GACAAGGTCTTGGGCACAGGAGG - Intergenic
1181933757 22:26425160-26425182 AACAAGGAATTGGGAGCAGTAGG - Intergenic
1183510313 22:38230786-38230808 AGCCAGGACTTGGGAACAGTGGG + Intronic
949233414 3:1778096-1778118 ATCAAGGACTTGGGCACACAAGG - Intergenic
950825035 3:15809631-15809653 ATCCAGGACTTGGTGACAGTGGG - Intronic
951636721 3:24786844-24786866 AACAAGGACTGGGGTTCTATTGG - Intergenic
952155014 3:30633693-30633715 AAAAAAGACTTGGAAACAGTGGG - Intronic
953731624 3:45454627-45454649 AACATGGAATTGGCTTCAGTAGG + Intronic
956482631 3:69688350-69688372 GATAAGGACTTGGGTGCAGATGG - Intergenic
956863886 3:73350729-73350751 AACAAGAACTTGGGGACATGGGG - Intergenic
957036376 3:75297033-75297055 AAGAAGGACTTTGGAACAGGAGG - Intergenic
957037615 3:75309491-75309513 CACATGGTCTTGGCTACAGTGGG + Intergenic
957265781 3:77963507-77963529 AACAAAAATTTGTGTACAGTGGG + Intergenic
961085645 3:124065028-124065050 CACATGGTCTTGGCTACAGTGGG + Intergenic
961468418 3:127096077-127096099 AGCAAGGGCTTGGGTGTAGTTGG - Intergenic
966880829 3:184349810-184349832 AGTAAGGATTTGGGTTCAGTTGG + Intronic
967502009 3:190208532-190208554 CACAATGCCTGGGGTACAGTTGG + Intergenic
971091104 4:23346670-23346692 AACAAGGGCTTGGGACCACTGGG - Intergenic
971128596 4:23781006-23781028 AACAATGTCTGGGATACAGTAGG + Intronic
974940783 4:68465284-68465306 GACAAGGGCTTGGGTGCGGTTGG - Intronic
975943889 4:79681609-79681631 AATAATGACTTTGGTACAGAAGG - Intergenic
975971962 4:80050378-80050400 AACAAGGTCTTAGGTACAAAAGG - Intronic
976277499 4:83292260-83292282 GACAAGGACTTGGGTCAGGTGGG - Intergenic
976945256 4:90757903-90757925 AACAAGGACTATTGTACAGCTGG - Intronic
981412702 4:144451474-144451496 AAAAAGAAATTGGGTACTGTGGG + Intergenic
987867021 5:23555410-23555432 AACAATTACTTGGATACATTAGG + Intergenic
988514941 5:31896052-31896074 GACACAGACTTGGGAACAGTAGG + Intronic
990790315 5:59470366-59470388 AACAAGAACCAGGGGACAGTAGG - Intronic
992057670 5:73008086-73008108 CACAAGGACTAGGTTACATTAGG + Intronic
992166156 5:74054049-74054071 AGCAAGGAGCTGGGAACAGTGGG - Intergenic
992751009 5:79860726-79860748 AAAAATTACTTGGGTAAAGTTGG + Intergenic
993002774 5:82398623-82398645 AACAACGCCTTGTGTAGAGTAGG + Intergenic
993898648 5:93570272-93570294 AGCAAGGCCTGGGGCACAGTTGG - Intergenic
995360851 5:111295236-111295258 AAGAAGGAGATGGTTACAGTAGG + Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
999970418 5:156855580-156855602 AAAAAATACTTGGGTACAGGAGG + Intergenic
1006789715 6:36691907-36691929 GACAAGGACTTGTGTGCAGGTGG + Intergenic
1006849666 6:37089118-37089140 AACAGGCACTTTGGAACAGTTGG - Intergenic
1009394907 6:63188219-63188241 AATGAGGACTTGGGTGCAGGTGG - Intergenic
1011111087 6:83837287-83837309 AACAAGGACTTGTGTACAGGAGG + Intergenic
1013976794 6:116088216-116088238 GACAAGGACTTGGCTGCAGGTGG - Intergenic
1019007495 6:168812532-168812554 AACAAGGACTGGAGAACAGGAGG - Intergenic
1019587519 7:1813422-1813444 CACAAGGGCTTGGGGACAGTGGG + Intergenic
1021327583 7:19293459-19293481 AAAAAGGAGTTGGGTAAAGATGG + Intergenic
1021811628 7:24407436-24407458 AAGAAATACTTGGGGACAGTGGG - Intergenic
1022089853 7:27100961-27100983 GACAAGCAGTTGGGAACAGTGGG + Exonic
1022290389 7:28996973-28996995 AACAAGGGCTTGGGTTACGTAGG - Intronic
1024337565 7:48224907-48224929 AACAAGGACTTGTATATAGGTGG - Intronic
1025888975 7:65628089-65628111 AACAAAGGATTGGATACAGTAGG + Intergenic
1031711896 7:125058172-125058194 AACAAGGACTTGAGAGCAGCTGG - Intergenic
1031748411 7:125536618-125536640 ATGAAGGACTTTGGTAGAGTGGG - Intergenic
1031853475 7:126893880-126893902 AACAAAGGATTGGATACAGTAGG - Intronic
1033091037 7:138386204-138386226 AATAAGTAATTGGGAACAGTAGG - Intergenic
1035722460 8:1802375-1802397 AACAAGGCCTAGGGTGCAGGAGG + Intergenic
1036935258 8:12995753-12995775 AACAATGACTTGGGTCTAATTGG - Intronic
1036949117 8:13124153-13124175 ATGAAGAACTTGTGTACAGTAGG + Intronic
1037784352 8:21893610-21893632 CGCCAGGACTAGGGTACAGTAGG - Intergenic
1038933489 8:32221010-32221032 AACGAGGGCTAGGCTACAGTTGG + Intronic
1041158966 8:55018041-55018063 AACAGGGACATGGGGACACTGGG + Intergenic
1042749910 8:72147315-72147337 ATCAAGGTCATGGGTAGAGTTGG + Intergenic
1043000453 8:74753608-74753630 AAAAATAGCTTGGGTACAGTGGG - Intronic
1043531614 8:81157320-81157342 AATAAGGGCTTGGGTACAGGTGG - Intergenic
1045296996 8:100880372-100880394 GAAAAGGACTTGGGACCAGTTGG + Intergenic
1047015561 8:120719677-120719699 GACAAGGACTTGAGTGCAGGTGG + Intronic
1052316566 9:27122032-27122054 GACAAGACCTTGGGCACAGTGGG + Intronic
1056430953 9:86527065-86527087 GACAAGGACTTGGGTGCAGGTGG - Intergenic
1058406962 9:104687654-104687676 TACATGGACTGGGGCACAGTAGG + Intergenic
1059671465 9:116496389-116496411 AACAATGGCTTGGGTGCAGAAGG + Intronic
1061447384 9:130648025-130648047 CACAATGCCTTGGGTACAGCTGG - Intergenic
1189481302 X:41394247-41394269 CACAAGGACTTGGGTGCAGGTGG - Intergenic
1191939497 X:66462995-66463017 AAGAAGGACTTGGAAATAGTTGG + Intergenic
1194878970 X:99226074-99226096 AACAAGAGCTTGGGTACCATGGG + Intergenic
1195063977 X:101222496-101222518 AAGCAGCAGTTGGGTACAGTGGG - Intronic
1196182044 X:112703343-112703365 AACCAGGTATTGGTTACAGTGGG - Intergenic
1201714144 Y:17025267-17025289 AACAACTACTTTGGTAAAGTTGG + Intergenic