ID: 1156198268

View in Genome Browser
Species Human (GRCh38)
Location 18:34800885-34800907
Sequence ATTTATATGGAAAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 372}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156198268_1156198272 27 Left 1156198268 18:34800885-34800907 CCCTGCAACTTTTCCATATAAAT 0: 1
1: 0
2: 2
3: 23
4: 372
Right 1156198272 18:34800935-34800957 TATGTCTCTTTATAAGATTATGG 0: 1
1: 0
2: 3
3: 19
4: 325
1156198268_1156198273 28 Left 1156198268 18:34800885-34800907 CCCTGCAACTTTTCCATATAAAT 0: 1
1: 0
2: 2
3: 23
4: 372
Right 1156198273 18:34800936-34800958 ATGTCTCTTTATAAGATTATGGG 0: 1
1: 1
2: 3
3: 23
4: 285
1156198268_1156198271 -6 Left 1156198268 18:34800885-34800907 CCCTGCAACTTTTCCATATAAAT 0: 1
1: 0
2: 2
3: 23
4: 372
Right 1156198271 18:34800902-34800924 ATAAATAATATATTCTTAGTTGG 0: 1
1: 0
2: 10
3: 57
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156198268 Original CRISPR ATTTATATGGAAAAGTTGCA GGG (reversed) Intronic
900896509 1:5486682-5486704 ATTTATATTGAAATATTTCATGG + Intergenic
903257116 1:22110100-22110122 ATTTCTATAGAAAAGTGGTAAGG + Intergenic
904943866 1:34184784-34184806 ACTTCTCTGGAAAAGTTGCTTGG + Intronic
905087628 1:35396287-35396309 ATTTAGATGGATAAATTGAAAGG - Intronic
906067189 1:42989925-42989947 ATTAATTTGGTGAAGTTGCAGGG + Intergenic
907779262 1:57550622-57550644 AGATATATGGTAAAGTTGGATGG - Intronic
908781299 1:67692985-67693007 ATTTCTCTGCAAAAATTGCAGGG + Intergenic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
909661843 1:78092102-78092124 TGGTATATGGAAAAGTAGCAGGG + Intronic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
910152461 1:84167410-84167432 ATAAATATGGAAAGGTAGCAAGG - Intronic
914891661 1:151629872-151629894 ATATATATGGAACAGTGGCCGGG - Intronic
915040755 1:152966443-152966465 ATTTAAAAAAAAAAGTTGCAAGG + Intergenic
915197852 1:154203419-154203441 ATATATATGCAAAAGTTACCTGG - Intronic
915294067 1:154907795-154907817 ACTGCTATGGAAAAGTTGCAAGG - Intergenic
918626895 1:186666114-186666136 TTTTTTAAGGAAAAGATGCAAGG - Intergenic
919566677 1:199197948-199197970 ATATTTATGGAAAAGTAGCAAGG - Intergenic
920280296 1:204838505-204838527 TTTTGAATGGAAAACTTGCAGGG - Intronic
922654633 1:227370833-227370855 ATTTATTAGTAAAAGTGGCAAGG + Intergenic
922972871 1:229757948-229757970 ATGTAAATGGAAGAGTTGCGAGG - Intergenic
924207517 1:241728437-241728459 ATTTATATGAAAGAGTTTGAAGG - Intronic
924312433 1:242758032-242758054 GTTTATATGGAAAATGTGCCTGG + Intergenic
1064308607 10:14190791-14190813 TTTTTAATGGAAAAGTTTCAGGG + Intronic
1064455315 10:15482440-15482462 ATTTATCTGGAAACTCTGCAGGG + Intergenic
1064591441 10:16896127-16896149 AATGATATGGAAAAGTTGAAAGG - Intronic
1064815554 10:19257812-19257834 GTTTACTTGGAAAACTTGCAAGG + Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1066215914 10:33287329-33287351 ATTTGTATGGAAAATTGCCATGG - Intronic
1066492121 10:35903900-35903922 ATTCATGTGGTAAAGGTGCAGGG - Intergenic
1067906735 10:50298884-50298906 ATTTAGATAGAAAATTAGCAAGG + Intergenic
1068054088 10:51989301-51989323 ATTAGTAGGGAACAGTTGCAAGG + Intronic
1068265035 10:54636536-54636558 ATTTATATGAAATTGTTTCATGG - Intronic
1068689119 10:59897993-59898015 ATTGATCTGGAACAGATGCATGG + Intronic
1068717124 10:60200676-60200698 ACTTCTTTTGAAAAGTTGCATGG - Intronic
1070205656 10:74257938-74257960 ATTTATGTGTAAAAGTTTCTGGG + Intronic
1073391774 10:103183868-103183890 ATTTAAATGCAACAGTTTCAAGG - Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1078625340 11:12950714-12950736 ATGTTTTTGGAAAGGTTGCAAGG + Intergenic
1078627660 11:12972279-12972301 CTTTTTATGGAAAAGTTGGCTGG + Intergenic
1079469209 11:20762543-20762565 ATTCATTTGAAAAAGTTGCATGG + Intronic
1080173496 11:29334535-29334557 TTTTATTTGAAACAGTTGCATGG - Intergenic
1080858778 11:36135146-36135168 ATTTATACAGAAAAGTTGAGAGG - Intronic
1081240738 11:40703328-40703350 ATGTAGATGGAAAAATTTCACGG - Intronic
1081335669 11:41863198-41863220 ATCAATAAGGAAAAGTTACAAGG - Intergenic
1081471301 11:43373680-43373702 ATTTATATGGGCAAATTGAAAGG + Intronic
1083168221 11:60905060-60905082 ATTTACATGGCACATTTGCATGG + Intronic
1084246791 11:67863208-67863230 ATATCTATGGAAAAGTTGAAGGG + Intergenic
1085286750 11:75367594-75367616 ATTTATGTGAAAAAGTGGCTGGG + Intergenic
1085650311 11:78261905-78261927 ATTTCTGTGGAAAGGTTACAAGG - Intronic
1085656155 11:78317053-78317075 ACTTATATGACAAAGTTACATGG + Intronic
1085742623 11:79089995-79090017 ATTTAGATGGAAATGTCACAGGG + Intronic
1086108346 11:83171331-83171353 ATATCTGTGGAAAAGTGGCAAGG + Intronic
1087081501 11:94175138-94175160 AGAAATATGGAAAAGCTGCAGGG - Intronic
1087639247 11:100737799-100737821 ATTTATATTGATAAGCTGCTGGG + Intronic
1087843435 11:102943927-102943949 ATTTATAAGGAAATTTTACAAGG - Exonic
1089165597 11:116473789-116473811 ATTTATATGATAAAGATGCTGGG - Intergenic
1090564035 11:127966543-127966565 ATTTATATGGACAAATTAGATGG - Intergenic
1091067019 11:132524152-132524174 AGTAATGTGAAAAAGTTGCAGGG - Intronic
1091483991 12:866066-866088 CTTTATTTGGAAAAGCAGCAAGG - Intronic
1091528946 12:1335771-1335793 ATTTATTTGAAATAGTTTCAGGG + Intronic
1091964587 12:4727374-4727396 CTTTAAATGGATAAATTGCATGG - Intronic
1093803596 12:23404507-23404529 ATATATATGGCAAAGTTTAATGG + Intergenic
1094737823 12:33255039-33255061 ATTTACATTGAAAAGTGGCCTGG + Intergenic
1095256615 12:40044444-40044466 ATTTAAATGGATGAGTTGAATGG + Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096175317 12:49511901-49511923 AGATATATAGAAAAGTTGAAAGG + Intronic
1097439214 12:59588868-59588890 ATTTACATGGAAAATTTAAATGG + Intergenic
1098376945 12:69826080-69826102 ATATATATTTAAAAGTTGAATGG + Intronic
1098509828 12:71298774-71298796 CTTTATATGACAAAGTTTCAGGG + Intronic
1098625342 12:72659353-72659375 ATTAATGTGGAAAAATGGCAAGG - Intronic
1098738701 12:74142444-74142466 ATCTATATGGAAAAGTAGAAAGG + Intergenic
1099647552 12:85378738-85378760 AATTATATGGAAAAGCTGGCAGG + Intergenic
1103262949 12:119604518-119604540 ATTGATATGGGAAGATTGCATGG + Intronic
1108758879 13:53538623-53538645 ATTTATATGGAATATTTAGAAGG + Intergenic
1109444942 13:62423971-62423993 ATTTATATGGCAAAATAGGAAGG - Intergenic
1109747255 13:66641397-66641419 ATTTGTATGGAGAAAGTGCATGG + Intronic
1109965020 13:69680875-69680897 ATTCATAAATAAAAGTTGCATGG + Intergenic
1110450218 13:75632348-75632370 AGTTATATGGAAAGGCTGGAGGG - Intronic
1111518011 13:89360962-89360984 ATTAAAATGGTAAAATTGCATGG - Intergenic
1112609166 13:100938991-100939013 ATTTTTATGCAATAATTGCAGGG - Intergenic
1112930717 13:104732880-104732902 ATTCATATTCAAAAGTTGAAGGG + Intergenic
1113480146 13:110614860-110614882 ATTTTTTTGGAAAATTAGCAGGG - Intergenic
1115184453 14:30669132-30669154 ATTTATTTGAGAAAGTTACAAGG + Intronic
1115965740 14:38885413-38885435 AATTATATGAATAAGTGGCAAGG + Intergenic
1116316203 14:43396174-43396196 TTTCATATCGAAAAGTTCCAGGG + Intergenic
1118093298 14:62507272-62507294 TGTCATATGGATAAGTTGCAGGG - Intergenic
1119499056 14:75107396-75107418 AAGCATGTGGAAAAGTTGCAAGG - Exonic
1120559731 14:85975602-85975624 ATATATTTGAAAAACTTGCATGG - Intergenic
1124606321 15:31172525-31172547 TTTTATATGGAAAACATGCCTGG + Intergenic
1125193546 15:37020772-37020794 ATGTGTATGGAAAAGTTCAAAGG - Intronic
1126861987 15:52893959-52893981 ATTTGGCTGGAAAAGCTGCAGGG + Intergenic
1129639072 15:77355170-77355192 ATTTATAACGGAAAGTAGCATGG + Intronic
1130719717 15:86374731-86374753 ATTTCTTTGGAAATGTAGCAGGG + Intronic
1131330524 15:91495076-91495098 ATTTATATGGGGAAATTGTATGG - Intergenic
1133489648 16:6255160-6255182 ATTGATATGGAAATGTTTCCAGG - Intronic
1133546409 16:6812002-6812024 ATTTATCTGGAGAAATGGCATGG - Intronic
1133925880 16:10192022-10192044 AGATTTATAGAAAAGTTGCAGGG - Intergenic
1134460905 16:14428440-14428462 GTGTCCATGGAAAAGTTGCATGG + Intergenic
1135328033 16:21539998-21540020 CTTTAGATGGGAGAGTTGCATGG - Intergenic
1136338386 16:29626022-29626044 CTTTAGATGGGAGAGTTGCATGG - Intergenic
1137917231 16:52445405-52445427 ATTTGTGTGGAGGAGTTGCAAGG + Intronic
1138214985 16:55196453-55196475 CTTTAAATGGATAAATTGCATGG + Intergenic
1138882458 16:61032147-61032169 ATTTGTAGGGAAAATTTGTAGGG - Intergenic
1140073799 16:71677486-71677508 ATATATATGGAAGAGTTCAAAGG + Intronic
1140253087 16:73311806-73311828 ACCTATATGTAAATGTTGCACGG - Intergenic
1140980889 16:80108335-80108357 AGATTTATGAAAAAGTTGCAAGG - Intergenic
1142041117 16:87894935-87894957 CTTTAGATGGGAGAGTTGCATGG - Intronic
1142294997 16:89215516-89215538 ATATATATGCAAAAGTGGAATGG - Intergenic
1142895467 17:2974636-2974658 ATTTATAAACAAAAGTAGCAAGG + Intronic
1142930849 17:3282956-3282978 TTTTAGATGGAGAAGTTTCAAGG - Intergenic
1143710092 17:8728423-8728445 ATTTAACTGGTAAAGTTGCCAGG + Intergenic
1143864233 17:9912201-9912223 ATCTAAATGGAAAAGTACCACGG + Intronic
1147567430 17:41546320-41546342 ATTTATTTGGAAATGGAGCAAGG + Intergenic
1149742288 17:59058063-59058085 ATTTATATTTTAAAATTGCAAGG - Intronic
1150590871 17:66560985-66561007 ATTTAAATGGAAAGGTTCCAGGG - Intronic
1153712990 18:7819118-7819140 ATTGATATGGAAGAGGGGCAGGG + Intronic
1155724185 18:29058602-29058624 ATTTATATGGAGTGGTTTCAGGG - Intergenic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156777112 18:40805104-40805126 ATTTATATGGATAATATGTATGG - Intergenic
1157984442 18:52421169-52421191 ATTTAAATTAAAAAGTTACAGGG - Intronic
1158006725 18:52680820-52680842 ATTTATATGGTAAATTTAGATGG - Intronic
1158768847 18:60490465-60490487 ATTAAGATTCAAAAGTTGCATGG + Intergenic
1159268054 18:66110643-66110665 TTTTATATAGAAAAGATACAAGG + Intergenic
1159469587 18:68834290-68834312 ATTTATTTTGAAAACTAGCAAGG + Intronic
1159535928 18:69714714-69714736 ATTTAGAAGGAAATTTTGCAAGG + Intronic
1160039122 18:75329564-75329586 ATTTATCTGGAAAAAATGCCTGG - Intergenic
1160282563 18:77506169-77506191 ATTTATAAAGAAAAGTTAAATGG + Intergenic
1160363218 18:78302055-78302077 ACTAATAGGGAAAAATTGCATGG - Intergenic
1165421844 19:35725977-35725999 ATTTATATTCAGAATTTGCATGG + Intronic
1165524606 19:36343397-36343419 ATTTATTTGGAACAGTTGTGGGG - Intronic
1166235843 19:41455715-41455737 ATTTTTATGGATAATTTGGAAGG + Intergenic
1166419053 19:42620421-42620443 ATTTTTGTGGGAAAGTTGCTGGG + Intronic
1167772998 19:51532448-51532470 ATTTACATGAAGATGTTGCATGG - Intergenic
1168664157 19:58190427-58190449 ACTTAAATGGAAAAGTTTCTAGG + Intronic
925794471 2:7527337-7527359 AGTTATAGGAAAAAGGTGCATGG + Intergenic
927116883 2:19913259-19913281 ATTTATTTGGAATATTTCCATGG + Exonic
928462187 2:31485324-31485346 AGTTCTATGGAAAAGTGGCCAGG - Intergenic
929031644 2:37654704-37654726 TTTTCTATGGAAAAGTGACATGG - Intronic
930848067 2:55926803-55926825 ATTTTTCTGGAAAAGTGGCTGGG - Intergenic
931633836 2:64324527-64324549 ATTTATATTGAACAAATGCACGG + Intergenic
931977789 2:67662355-67662377 AGATATAAAGAAAAGTTGCAAGG + Intergenic
932267274 2:70378535-70378557 CTTTAAATGGACAAATTGCATGG - Intergenic
932267853 2:70383623-70383645 ATTTATAAAGAAAAGTTTAATGG - Intergenic
932842175 2:75093782-75093804 TTTTAAACGGAAAAGTTTCATGG + Intronic
934075473 2:88424782-88424804 ACGTATATAAAAAAGTTGCATGG - Intergenic
935125784 2:100221643-100221665 ATAAATATGGGGAAGTTGCAAGG + Intergenic
937722078 2:125111932-125111954 ATTTATATTTAAAAGATTCATGG - Intergenic
939362790 2:141195518-141195540 ATTCATCTTTAAAAGTTGCAGGG - Intronic
939385817 2:141495984-141496006 ATTTATATGTAAAACTATCATGG + Intronic
940110994 2:150153960-150153982 ATTTATATGGCAGAGTTCTAAGG - Intergenic
940667338 2:156624973-156624995 ATTCATATGTAAAAGTGTCAAGG + Intergenic
941195569 2:162447148-162447170 ATTGACCTGGAAATGTTGCAAGG + Intronic
941389321 2:164891714-164891736 ATTTTTATGGAAACGATGAAAGG + Intergenic
941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG + Intergenic
941655278 2:168136984-168137006 ATTGATATGGAAAAGATTCAAGG + Intronic
942511303 2:176705055-176705077 ATTCATATATAAAAGATGCATGG - Intergenic
942540699 2:177012544-177012566 GTTTAAATGAAAAAGTGGCAAGG - Intergenic
942618989 2:177827226-177827248 CTTTACATGGAAGAATTGCATGG + Intronic
942628947 2:177935434-177935456 ATTTATATATAAAATTTTCAAGG + Intronic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
943473574 2:188326945-188326967 ACTTATCTGGAAAACTAGCAGGG + Intronic
943745026 2:191453311-191453333 ATTAATATGTAAATTTTGCAAGG - Intergenic
943745069 2:191453770-191453792 ATTAATATGTAAAATTTGCAGGG + Intergenic
943785289 2:191871026-191871048 ATTTATAAGGAAAAGTGGAAGGG - Intergenic
945112778 2:206378738-206378760 ATTGATATGGAAAAGCTTTATGG + Intergenic
945665545 2:212736841-212736863 GTTTATTTTGACAAGTTGCAAGG - Intergenic
945765949 2:213977889-213977911 GCTTATATAGAAAAGATGCAGGG - Intronic
946624737 2:221599081-221599103 ATTAATATGGACAAGTTCAAAGG + Intergenic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
947052834 2:226066075-226066097 ATTTATATTTAAAAGTAGAAGGG - Intergenic
1168987278 20:2060603-2060625 ATCTATATGGAAAAAATGAATGG + Intergenic
1169052287 20:2590624-2590646 ATTAATATTGAAAAGTAGTAGGG - Intronic
1169589842 20:7128323-7128345 TTTTATATGGAATAGTTGAATGG + Intergenic
1170355829 20:15490559-15490581 ATTTATATTGAAAACTCCCAAGG - Intronic
1170517076 20:17141485-17141507 ATGTATATGGAAAATTAACATGG - Intergenic
1172694680 20:36814378-36814400 ATTTAGAAGGACAAGCTGCAAGG + Intronic
1173029900 20:39346881-39346903 ATTAATAGGGGAAATTTGCATGG + Intergenic
1173401604 20:42730952-42730974 ATTTATTTGGGAAAGCTGTATGG - Intronic
1174283904 20:49458771-49458793 AATTTTATGGAAGATTTGCATGG + Intronic
1174490587 20:50891600-50891622 GTTCCTATGGAAAAGTTGAAGGG - Exonic
1175453162 20:59088273-59088295 ATTCATATGAAAAAGATCCAGGG - Intergenic
1177315862 21:19459825-19459847 ATCTATATGGGGAAATTGCATGG - Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG + Intronic
1178293605 21:31389801-31389823 ATTTATATAGAAAAATACCAGGG - Intronic
1178996004 21:37400417-37400439 AATTATTTGGAAAAGTAGGAAGG + Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1182107469 22:27699580-27699602 ATTAATGTGGAGAAGGTGCATGG - Intergenic
1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG + Intergenic
1184975215 22:48057031-48057053 ATTCATATCTAACAGTTGCAGGG + Intergenic
949332525 3:2937960-2937982 ATTTAGATGGAAGAGGTGGAAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950266327 3:11575812-11575834 TTGGATATGGGAAAGTTGCAGGG - Intronic
950375474 3:12568425-12568447 TTTTATAGGGAAAGGTAGCAAGG + Intronic
951441104 3:22725232-22725254 AATTATATTGAAATGTTACATGG + Intergenic
951578027 3:24133485-24133507 ATTTAAATGAAGAAGTTGAAGGG + Intronic
952257972 3:31711828-31711850 ATTTAAATGGATAAATTGTATGG + Intronic
952276447 3:31881994-31882016 AGTGATATGGAGAAGTTACAAGG - Intronic
953488258 3:43323869-43323891 ATTTCTAGGCAAAACTTGCAAGG + Intronic
953740906 3:45538192-45538214 ATCTATATGGAAATGTTGGCAGG + Intronic
954753220 3:52825175-52825197 AAATAGAAGGAAAAGTTGCAGGG - Intronic
955819325 3:62879438-62879460 ATTTACATGGACAAGATGGAGGG + Intergenic
957061098 3:75481957-75481979 ATACCTATGGAAAAGTTGAAAGG + Intergenic
957208736 3:77233067-77233089 ACTTATATGGAAAAGCTAAAGGG + Intronic
957831761 3:85530623-85530645 ATTTATATAGAAAAGTGGGCCGG - Intronic
957954445 3:87166347-87166369 ATTTACATGGAAAAGGCACAGGG - Intergenic
959004150 3:101000259-101000281 ATTTATTTAGAAAATCTGCATGG - Intergenic
959065264 3:101649262-101649284 ATTGATATGGACAAGAGGCAAGG - Exonic
959793241 3:110390129-110390151 ATTTATATGGAAACTTTATATGG + Intergenic
959846472 3:111039649-111039671 ATTTATAAGGAAAAGAGGCTGGG - Intergenic
961292284 3:125857459-125857481 ATACCTATGGAAAAGTTGAAGGG - Intergenic
962233779 3:133691042-133691064 ATTTATAAGAAAAAGTGGGATGG + Intergenic
964061068 3:152523326-152523348 ATGTTTATGGATAAGCTGCAAGG - Intergenic
964240022 3:154581576-154581598 ATAAATTTGGCAAAGTTGCAAGG - Intergenic
964424991 3:156543135-156543157 TGGTATATGGAAAAGTAGCAGGG - Exonic
965539291 3:169856251-169856273 ATATATATTGAAAAGTTACTAGG - Intronic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
967517421 3:190386775-190386797 ATTTAAATGTAAAAGCTGCATGG - Intronic
967652645 3:192005729-192005751 ATTTATCTTTAAAAGTTCCAGGG - Intergenic
968389104 4:174215-174237 ATTTGTAAGAAAAAGTTACAGGG - Intergenic
968838987 4:2986974-2986996 CTTTAAATGGATAAGTTGTATGG - Intronic
969005013 4:4011990-4012012 ATACCTATGGAAAAGTTGAAGGG + Intergenic
969747856 4:9088153-9088175 ATACCTATGGAAAAGTTGAAGGG - Intergenic
969808897 4:9632686-9632708 ATACCTATGGAAAAGTTGAAGGG - Intergenic
970697639 4:18696601-18696623 ATTGATATGGAAAGGATTCAGGG - Intergenic
970764708 4:19533493-19533515 AATTATATTCAAAAGATGCAAGG - Intergenic
971647183 4:29222234-29222256 ATCTATATGAAAAATTTACAGGG + Intergenic
971964774 4:33539160-33539182 AGTTAAATGGGAATGTTGCAGGG - Intergenic
972111762 4:35570434-35570456 ATTGATATTGAAAAGATGAAAGG - Intergenic
972181825 4:36476034-36476056 ATTGATATGAAAAAGTTGCCAGG + Intergenic
972226547 4:37019590-37019612 ATTTATATAGAAAAAGTTCAAGG + Intergenic
972907161 4:43764717-43764739 ATATATAAGGAAAAATGGCATGG - Intergenic
973075084 4:45914923-45914945 AATTATATGGGAGAGTGGCAAGG + Intergenic
973149267 4:46866888-46866910 AATTATATGAACAAGTTACATGG + Intronic
973306796 4:48661153-48661175 AGATTTATAGAAAAGTTGCAGGG - Intronic
973816459 4:54623930-54623952 ATTTATAAGGAGAAGCTACATGG - Intergenic
973932585 4:55808056-55808078 ACTTATTTAAAAAAGTTGCAGGG - Intergenic
974092319 4:57324141-57324163 ATAAATATAGAAAAGTTGAAAGG - Intergenic
974626964 4:64438250-64438272 ATGTATATGAAAATTTTGCATGG + Intergenic
974640334 4:64622560-64622582 ATGAATTTAGAAAAGTTGCAAGG - Intergenic
975413127 4:74078483-74078505 AGTTATCTGGAAATTTTGCAAGG + Intergenic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
978125015 4:105125130-105125152 AGCTGCATGGAAAAGTTGCAAGG + Intergenic
978343714 4:107743474-107743496 AACTAGATGGAAAAGTTGAAGGG + Intergenic
978550483 4:109920234-109920256 ATTTACATTGGAAAGTTGCTAGG - Intronic
979064334 4:116109096-116109118 AGTTATATGAAAAAGTTATAGGG - Intergenic
979127107 4:116987520-116987542 ATTGAAAAGGAAAAGATGCAGGG + Intergenic
979492750 4:121347508-121347530 ATTTATTTGGAAAGGTTTTAGGG + Intronic
980319513 4:131251407-131251429 ATTTTCAGGGAAAAGTTACAGGG + Intergenic
981022679 4:140045607-140045629 TTTTATAGTGAAAAGCTGCAAGG - Intronic
981849123 4:149207399-149207421 ATTTAAATGGGTAAATTGCATGG + Intergenic
982120517 4:152138795-152138817 ATTTCTATGGACAACTTGCAGGG - Intergenic
982832178 4:160076207-160076229 AGTTATAAGAAAAAGTTACAGGG - Intergenic
982992656 4:162298239-162298261 AGTGATATGGAAAAGATGAATGG - Intergenic
983792836 4:171819641-171819663 ATTTGTATAAAAATGTTGCAAGG - Intronic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
984544029 4:181077460-181077482 ATTTATATAGCAAAATTCCATGG - Intergenic
985519556 5:367120-367142 ACTAAAATGGAGAAGTTGCAGGG + Intronic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
987209169 5:15661078-15661100 AGATATATGGAAAAATTACATGG - Intronic
987309072 5:16665421-16665443 TTTTATATGGAAAAGTTTTAAGG - Exonic
987468317 5:18298999-18299021 ATTTGTAGGGAAAATTTACAAGG - Intergenic
987678439 5:21105579-21105601 ATTTATAGTTAAAAGGTGCAAGG - Intergenic
988084877 5:26462202-26462224 AATTACAAGGAAAAGTTGCTGGG - Intergenic
989279869 5:39628315-39628337 TTTTATATGGAAAAATTGATGGG + Intergenic
989647148 5:43647349-43647371 ATTCATAAGGAAATGTAGCAAGG + Intronic
989702547 5:44287327-44287349 ATGTGTCTGGAAAATTTGCAGGG + Intergenic
993180489 5:84546332-84546354 ATTTGTATTGAAAATTGGCAGGG - Intergenic
993195232 5:84733658-84733680 ATATATATTTAATAGTTGCAGGG - Intergenic
995233752 5:109801127-109801149 ATTCTTATGGACAAGTTTCAAGG + Intronic
996198945 5:120646116-120646138 ATTGAAATGTAAAAGTGGCATGG + Intronic
996860526 5:128060769-128060791 ATTGATTTGGAAAAGTTAGATGG + Intergenic
997965160 5:138351176-138351198 ATTTTGATAGAAAAATTGCAAGG + Intergenic
998293800 5:140944740-140944762 ATTTACATGGAAAAAATGCTGGG + Intronic
998468967 5:142368384-142368406 TTTTATATTGATAAGCTGCAGGG - Intergenic
998693164 5:144610616-144610638 ATTTATATGCAACAATGGCATGG - Intergenic
998873682 5:146577514-146577536 ATGTAAATGGAAAAATTGGATGG + Intergenic
999036167 5:148352838-148352860 ATTAAAATTGACAAGTTGCAAGG + Intergenic
999422964 5:151460677-151460699 ATTTATATAGAAAACATGCCAGG + Intronic
1000462032 5:161535015-161535037 ATTTATCAGGAAATGTTGCCTGG - Intronic
1000890495 5:166795988-166796010 AGTTATATGGAAAAGTCGAAGGG + Intergenic
1001890613 5:175335149-175335171 ATTTGTCTGGAAGAGTTGCAAGG + Intergenic
1003048485 6:2758648-2758670 ATGTAAATGGTAAAATTGCAAGG - Intergenic
1003522634 6:6871417-6871439 ATTTATATTATAAAGTTACATGG + Intergenic
1004571307 6:16848261-16848283 ATTTCAAGGGAGAAGTTGCATGG + Intergenic
1004647646 6:17578107-17578129 TGTTATATGGAAAAGTTGAAGGG - Intergenic
1005197283 6:23302503-23302525 ATTGAAATGGAAAATTTTCAAGG + Intergenic
1006197229 6:32252430-32252452 ATTTGTATGGAAAATCTGTATGG + Intergenic
1008349452 6:50472841-50472863 ATTAATAGGCAAAAGTTGCTAGG - Intergenic
1008380908 6:50839027-50839049 ATTTTTAAGGCAAAGTTGCTTGG + Intronic
1008384821 6:50876732-50876754 ATTTACATGGAAAATGTCCAGGG + Intergenic
1009312950 6:62179655-62179677 ATTTTTATGAAAAAGTAACAAGG - Intronic
1009825366 6:68859491-68859513 ATTTATAAAGAAAAGTTTAATGG + Intronic
1010159362 6:72833738-72833760 ATTTAAAGATAAAAGTTGCATGG + Intronic
1010481318 6:76357777-76357799 ATTTATATTGAAAAATAGAATGG - Intergenic
1010923597 6:81715711-81715733 AGTCATAAGGAAAAGTTACATGG - Intronic
1010960408 6:82139381-82139403 TTTCATATTGGAAAGTTGCAGGG - Intergenic
1011843584 6:91532578-91532600 ATTTAAATGGAAAAAATGCGTGG - Intergenic
1012103018 6:95115567-95115589 ATTTAGATGGTAAAGGTGAAGGG - Intergenic
1012339251 6:98099046-98099068 ATTTATAAGTAAATGTTACATGG + Intergenic
1012593668 6:101015237-101015259 ATGTATATTGCTAAGTTGCATGG + Intergenic
1013205009 6:107936640-107936662 CTTTATATAGTAAAGCTGCAGGG + Intronic
1014054347 6:116996570-116996592 ATTTATATATAAAAATTGCATGG - Intergenic
1015011411 6:128353534-128353556 ATTAATATGCACAACTTGCATGG + Intronic
1015231738 6:130922732-130922754 TTTTATTTGGAATATTTGCAAGG + Intronic
1015800380 6:137055038-137055060 ATGTATATGGAAAATCTGGAGGG + Intergenic
1016124110 6:140378607-140378629 AATTTTATGAGAAAGTTGCATGG + Intergenic
1016821157 6:148347790-148347812 CTCTATGTGGAGAAGTTGCAGGG + Intronic
1017316739 6:153039616-153039638 TTTTATGTGAAAAAGTAGCATGG + Intronic
1018147819 6:160909491-160909513 CTTTAAATGGAAAAGCTGGATGG + Intergenic
1018254697 6:161906232-161906254 ATATTTTTTGAAAAGTTGCATGG + Intronic
1018672275 6:166189596-166189618 ATTTATAAGGCAAAGTGCCAGGG + Intergenic
1020185845 7:5958889-5958911 AGTAAGATGCAAAAGTTGCACGG - Intronic
1020297071 7:6765873-6765895 AGTAAGATGCAAAAGTTGCATGG + Intronic
1020325143 7:6968481-6968503 ATACCTATGGAAAAGTTGAAGGG + Intergenic
1020562199 7:9742765-9742787 ATTTATATCTCAAAGGTGCAGGG - Intergenic
1020909221 7:14107730-14107752 GTTTATATGGAGAAGAAGCAAGG + Intergenic
1021077398 7:16321847-16321869 ATATTTATGGAAAATTTGCCAGG + Intronic
1021297310 7:18923882-18923904 AGTTATATGGAAATCTTTCATGG + Intronic
1022018140 7:26371171-26371193 ATATATATGGTAAAGTTGGCTGG + Intronic
1022283829 7:28936128-28936150 GTTTCTATGGAAAAGCAGCACGG - Intergenic
1022457967 7:30575629-30575651 ATTTACATGGGAAAGTAGAAAGG - Intergenic
1023056871 7:36297946-36297968 ATTTAAAAATAAAAGTTGCAGGG + Intronic
1023250044 7:38249092-38249114 AATTCTATAGAAAAGTAGCAGGG + Intergenic
1023251351 7:38265194-38265216 AATTCTATAGAAAAGTAGCAGGG + Intergenic
1023536727 7:41221091-41221113 ATTGATATGTAATAGTTGCAAGG + Intergenic
1023884312 7:44341537-44341559 ATTAATATGCAAAATTGGCAAGG - Intergenic
1024810930 7:53211489-53211511 ATTTATAAGGAATGCTTGCAAGG - Intergenic
1024832116 7:53473105-53473127 TTTTATATTGAAAATTTACATGG + Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1027470910 7:78573177-78573199 ATATATATATAAAAGTTCCAGGG - Intronic
1028766827 7:94569395-94569417 ATTTATAGGGAAAAATCCCAAGG + Intergenic
1029974704 7:104822078-104822100 ATTTACATCCAAAAGATGCAAGG + Intronic
1030675662 7:112383322-112383344 AATCAAATGGAAAAGATGCAGGG + Intergenic
1031039061 7:116819606-116819628 TTTTAGATGGGAAAGTTACATGG - Intronic
1031736528 7:125369368-125369390 AATTTTAAGGAAAATTTGCAAGG + Intergenic
1031757143 7:125659326-125659348 TTTTATATGATAAAGTTGAAGGG - Intergenic
1031772203 7:125858140-125858162 ATTTAGATGGTAAACTTGCCAGG - Intergenic
1031797421 7:126193919-126193941 ATTCATGGGGAAAAGTTTCATGG - Intergenic
1032580036 7:133095954-133095976 ATTTAAATGTAAAAGTTGTTTGG + Intergenic
1033768879 7:144526012-144526034 ATTTATATGGAAGAGTTACATGG + Intronic
1033798451 7:144874438-144874460 ATTAATATGAAAAATTGGCAAGG + Intergenic
1036370919 8:8162348-8162370 ATACCTATGGAAAAGTTGAAGGG - Intergenic
1036513931 8:9426192-9426214 ATTAATATTTAAAAGTTGGATGG + Intergenic
1036550577 8:9811935-9811957 AGTTGTAAGAAAAAGTTGCAGGG + Intergenic
1036879975 8:12503288-12503310 ATACCTATGGAAAAGTTGAAGGG + Intergenic
1037112674 8:15183577-15183599 ATTTAGATGTGAAAGTTTCAGGG + Intronic
1037185660 8:16059411-16059433 TTTTATATGCAAAAGTTTTAAGG + Intergenic
1038085492 8:24192245-24192267 ATTTAAAGGCAAAAGTTTCAAGG - Intergenic
1038134476 8:24770464-24770486 ATTTTTTTGGAAAAGGGGCAGGG - Intergenic
1039352052 8:36773683-36773705 CTTTATAAGGAAAAGTTGTGTGG - Intergenic
1039513552 8:38111412-38111434 AATTATTTTGAAAAGTTTCAAGG + Intronic
1039651677 8:39347382-39347404 ATTTATATGGCCATTTTGCATGG + Intergenic
1041809721 8:61894911-61894933 ATTAATTTTCAAAAGTTGCAAGG - Intergenic
1041921024 8:63181084-63181106 ATTTATATGCACAAATTACATGG - Intronic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043401390 8:79888572-79888594 ATTTATATGGAAAATATTAATGG + Intergenic
1046461964 8:114551093-114551115 ATTTACATGAAAAAGATTCAGGG - Intergenic
1046610845 8:116423858-116423880 CTTTAAATGGAAGAGTTGCTGGG + Intergenic
1046954164 8:120046210-120046232 GTTTACATGGATAAATTGCATGG - Intronic
1047500309 8:125435399-125435421 ATTAGGATGGGAAAGTTGCAAGG - Intronic
1048298669 8:133235378-133235400 ATGAATATGGAAAAGTGGAAAGG + Intergenic
1052291043 9:26841139-26841161 CCTTATATATAAAAGTTGCAGGG - Exonic
1052362441 9:27575385-27575407 ATTTATAAAGAAAAGTTTAATGG + Intergenic
1052485775 9:29098104-29098126 ATTTATCTAGCATAGTTGCAGGG + Intergenic
1055062320 9:72082616-72082638 ATTTTGATGGAAAACTTGGACGG + Intergenic
1056874046 9:90310864-90310886 ATTTACATTGAAAAGCTGCCTGG + Intergenic
1057001796 9:91516728-91516750 ATTTCTATGGAAATATGGCATGG + Intergenic
1058720938 9:107763004-107763026 AAATATAGGCAAAAGTTGCATGG - Intergenic
1059462326 9:114440966-114440988 CATTATAAGAAAAAGTTGCATGG + Intronic
1060428295 9:123525202-123525224 ATTTCTATGGAAAGGCTGCATGG + Intronic
1060713938 9:125902669-125902691 ATTTATTTTGAAAAGTGCCAGGG + Intronic
1061431041 9:130531408-130531430 AGCTTTATAGAAAAGTTGCAAGG - Intergenic
1061742041 9:132714291-132714313 ATATATATATAAAAGTGGCAAGG + Intergenic
1185695105 X:2188202-2188224 ATTTATAAGGGAAAGCTGGATGG - Intergenic
1186349078 X:8724990-8725012 AGTTAAATGGAAAAGTTGAAAGG + Intronic
1186915033 X:14209637-14209659 ATTTGAATGGAAAGGTTTCAAGG - Intergenic
1188301514 X:28509580-28509602 ATTTATTTTGAAGGGTTGCATGG - Intergenic
1188542768 X:31267704-31267726 ATTTTATTGGAAAAGTTACAGGG + Intronic
1189484310 X:41417494-41417516 ATTTATCTGGAAATGTTACCCGG + Intergenic
1189651193 X:43191472-43191494 ATTTAAAAAGAAAAGTTGGATGG - Intergenic
1192327810 X:70148231-70148253 ACGTATATAGAAAAGTTTCAAGG - Intronic
1192454221 X:71264142-71264164 CTTTAAATGGGCAAGTTGCATGG - Intergenic
1194056981 X:89147310-89147332 ATTTTTATGGAAATGTTTCCTGG - Intergenic
1194106318 X:89771504-89771526 TTTTCTAGGGAAAAGATGCAGGG + Intergenic
1194664832 X:96666125-96666147 TTTTTTCTGGAAAAGTTACAAGG - Intergenic
1194737221 X:97526855-97526877 AGATAGATGGAAAAGTTGAATGG - Intronic
1195743780 X:108093002-108093024 AGATTTATAGAAAAGTTGCAAGG + Intronic
1196163542 X:112513019-112513041 ATTTATAAGGAAAGTTTCCAAGG - Intergenic
1197562355 X:128039023-128039045 ATTTCTATGGAAAAGTTAGACGG - Intergenic
1197713179 X:129686866-129686888 ATTTAAATGGAAAAGAAGCTTGG - Intergenic
1199024775 X:142923485-142923507 AGTTCTATGGAAAATATGCAAGG - Intergenic
1199464589 X:148121981-148122003 ATTTATGTTAAGAAGTTGCATGG - Intergenic
1199709316 X:150457340-150457362 AGGTATATGGAAGAGTAGCAGGG - Intronic
1200458279 Y:3419363-3419385 TTTTCTAGGGAAAAGATGCAGGG + Intergenic
1201248403 Y:12030079-12030101 ATAAATATGGAATTGTTGCAGGG + Intergenic
1201255494 Y:12104108-12104130 GTTTTTATGAAAAAGTTGGAAGG + Intergenic