ID: 1156201546

View in Genome Browser
Species Human (GRCh38)
Location 18:34838150-34838172
Sequence CAGCTTTTCTGAAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156201538_1156201546 25 Left 1156201538 18:34838102-34838124 CCAAGGACAGTGAAGTAGAGCAG 0: 1
1: 0
2: 2
3: 16
4: 192
Right 1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 319
1156201537_1156201546 26 Left 1156201537 18:34838101-34838123 CCCAAGGACAGTGAAGTAGAGCA 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 319
1156201536_1156201546 29 Left 1156201536 18:34838098-34838120 CCTCCCAAGGACAGTGAAGTAGA 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG 0: 1
1: 0
2: 4
3: 39
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156201546 Original CRISPR CAGCTTTTCTGAAGGGCAAA GGG Intronic
902541198 1:17156203-17156225 CACCTTTTCTGCCTGGCAAATGG + Intergenic
903010128 1:20323947-20323969 CAGCTTTTCTATATGGAAAATGG - Intronic
903933846 1:26880931-26880953 CAGCTTTGCTGAAGGGTAGGTGG - Intronic
906644983 1:47468492-47468514 GTGCTTTGCTGAAGGGCAGATGG + Intergenic
906743609 1:48206311-48206333 CAGCTTTTCTGTAGGTGAAATGG - Intergenic
906955529 1:50370782-50370804 CTGCTTTTCAGAGGGGCAGAAGG - Intergenic
907327461 1:53649263-53649285 CAGTTTCTGTGAACGGCAAATGG - Intronic
908540689 1:65119496-65119518 CAGTTTTCTTGAAGGTCAAATGG - Intergenic
908667532 1:66509835-66509857 CAGCTGTCCTGAAGCCCAAAGGG + Intergenic
909808222 1:79898237-79898259 AAGCTTTTCAGAAAGGAAAATGG - Intergenic
911984600 1:104605537-104605559 CACATTTTCTGAAGAGCACATGG + Intergenic
913227486 1:116712921-116712943 TTGCATTTCTGAAGGGCTAAGGG + Intergenic
913341451 1:117761441-117761463 CAGATTTTCAGAATGGCAAATGG - Intergenic
914517039 1:148382966-148382988 AAGCTTTTCTGCAGGTCACAGGG + Intergenic
914886951 1:151593313-151593335 AAGCTTTTCTGACTGGCAATTGG + Intergenic
914932665 1:151949000-151949022 TAGCTATTCAGAAGGGCAAGCGG - Intergenic
915004593 1:152624133-152624155 CAGCTTTTCAGAAGGCCAGATGG + Intergenic
915744845 1:158147919-158147941 TACCTTTTCTGCAGGGCAGATGG + Intergenic
915994966 1:160552885-160552907 CAGGTTTTCTGAATGGAGAATGG + Intronic
916144709 1:161727933-161727955 AGGCTTATCTGAAGGGCTAAGGG - Exonic
917430688 1:174965237-174965259 AATCTTTTCTGAAAGGCAAGAGG + Intronic
918876806 1:190057311-190057333 CAGCTTTGTTGAAGAGCAGATGG + Intergenic
918974889 1:191471110-191471132 AAGATTTTCTGACTGGCAAATGG - Intergenic
919069798 1:192739565-192739587 CACCTTTTCTGCGGGGCAGATGG + Intergenic
920514196 1:206572411-206572433 CAGCTTTACAGAAGAGCACATGG + Intronic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
921373112 1:214445981-214446003 CAGCTTTTCTGTCCAGCAAAGGG - Intronic
921696684 1:218219145-218219167 CACCATTGCTGAAGTGCAAAAGG - Intergenic
922011744 1:221595814-221595836 AAGCTTCTCTGAAAGGCAGATGG - Intergenic
922051602 1:221995734-221995756 CAGCTTTTCTGGAATGAAAATGG + Intergenic
1062771701 10:106184-106206 AAGATTTTCTGATTGGCAAATGG + Intergenic
1064024757 10:11838585-11838607 CAACCTTTCTGTAGGGCAACTGG - Intronic
1065307397 10:24381962-24381984 CAGCTTTTCTGAAAGGCAGAAGG + Intronic
1065551673 10:26873793-26873815 CAGCACTTCAGAAGGCCAAAGGG - Intergenic
1065703051 10:28444196-28444218 CAGGTTTTCAGAAGAGGAAATGG + Intergenic
1065827056 10:29582314-29582336 CAGCTCTTGTGAGGGGCACATGG + Intronic
1065950794 10:30648866-30648888 CAGCTCTTGTGAGGGGCACATGG - Intergenic
1066021624 10:31309555-31309577 GAAGTTTTATGAAGGGCAAATGG - Intergenic
1068242078 10:54315808-54315830 CAGCTTTGTCGAAGGGCAGATGG + Intronic
1068483615 10:57627856-57627878 AAGATTTTCTGACTGGCAAATGG + Intergenic
1069798683 10:71069201-71069223 CAGCCTTTCTGGAGGGCAGCAGG - Intergenic
1070012259 10:72487596-72487618 CTGACTTTCTGAAGGGCCAAAGG + Intronic
1070509897 10:77151473-77151495 CAGCACTTCAGAAGGGCAAGGGG - Intronic
1070907397 10:80085135-80085157 CAATTTTTTTGAAGGGCAGAGGG + Intronic
1071128555 10:82364930-82364952 CAGCCATTGGGAAGGGCAAAGGG + Intronic
1071237316 10:83664099-83664121 CAGCTTCTCTGCAGAGCAGAGGG - Intergenic
1072850673 10:98888343-98888365 CATCTTTACTGAAGGTGAAAAGG + Intronic
1074079432 10:110156150-110156172 CAGTTTTACTGAAGGGCACCAGG + Intergenic
1075418552 10:122283679-122283701 CAGTTTTTCAGATCGGCAAATGG + Intronic
1075751127 10:124772104-124772126 CAGATTTTCGGAATGGGAAATGG + Intronic
1076934093 10:133555896-133555918 CAGCTTCTCTGCAGCACAAAGGG + Exonic
1079460581 11:20674627-20674649 ATGCTTTTCTTAAGGGCACAGGG + Intronic
1080237824 11:30092533-30092555 CAGATTTGCTAAAGGTCAAATGG - Intergenic
1081289663 11:41308677-41308699 TGGGTTTTCTGAAGAGCAAAGGG + Intronic
1081777340 11:45684651-45684673 CAGCTTTTCTGGCTGGCAAGGGG - Intergenic
1082809649 11:57471664-57471686 CAGCTTTTCAGAATGGGGAAGGG + Intronic
1083938429 11:65882415-65882437 CAGTTTTTCTGGAGGGCGAGAGG - Exonic
1084420910 11:69060072-69060094 GAGCTTTTCTGCAGGGCACGTGG - Intronic
1084545837 11:69814692-69814714 CAGGTTGTCTGCAGGGCAATGGG + Intronic
1085227724 11:74937416-74937438 CAGCTCTACTGAGGGGCAAAAGG - Intronic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086979574 11:93178550-93178572 CAGCTTTTGTAAAAGGAAAAGGG + Intronic
1087809681 11:102596831-102596853 GGGCTTTTCTGAAGGCCAGAGGG + Intronic
1088228873 11:107653043-107653065 AAGCTTTGCTGAAGAGAAAATGG - Intronic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1090477106 11:127033135-127033157 CAGCTTATTTGGAGGGCAACTGG + Intergenic
1092001310 12:5034632-5034654 CAGTGTTTCTGAAGTGCTAATGG + Intergenic
1092116236 12:6010136-6010158 CAACTTTTCTAATGGGAAAATGG + Intronic
1092205227 12:6610755-6610777 TAGGTTTTCTGAGGGCCAAAGGG - Intergenic
1092579693 12:9825368-9825390 CAGCTTTGCTGAAGATCAGATGG - Intergenic
1093239671 12:16654579-16654601 CAGCTTTGTTGAAGAGCAAATGG + Intergenic
1094734413 12:33218301-33218323 CAGCTTTGCTGAAGATCAGATGG + Intergenic
1097588352 12:61542228-61542250 CAAGTTTTCTGAAGAGTAAATGG - Intergenic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101163487 12:102004574-102004596 AAGCTTTTCTGATTGGCAATTGG - Intronic
1101168501 12:102063402-102063424 CACCTTTTCTGACAGGCAGATGG - Intergenic
1101483273 12:105123860-105123882 AAGATTTTCAGAATGGCAAATGG - Intronic
1102385289 12:112503942-112503964 CAGGTTATGTGAAGGGCAATGGG - Intronic
1102924584 12:116816934-116816956 AAACTTTTCTTATGGGCAAAGGG - Intronic
1103317784 12:120070976-120070998 CAGCATTTTGGAAGGCCAAAGGG - Intronic
1104319123 12:127733723-127733745 CAGCTTTTAAAAAGGGGAAAGGG + Intergenic
1104331448 12:127850395-127850417 CAGCTTCTTTGAAGAGCAGATGG + Intergenic
1104512512 12:129393358-129393380 CATCTTTTCTGGGGGGCAACTGG + Intronic
1105574787 13:21640268-21640290 CAGCACTTCGGAAGGGAAAATGG + Intergenic
1106708642 13:32308502-32308524 CATCTTTTTTGAAGGGAAAGAGG - Intronic
1107813196 13:44219561-44219583 CAGCTTCTAGAAAGGGCAAACGG + Intergenic
1108078575 13:46708745-46708767 CACCTTTGCTGATGGGAAAATGG - Intronic
1108141134 13:47422831-47422853 CTGGCTTTCTCAAGGGCAAAGGG + Intergenic
1108394012 13:49975454-49975476 CAGCTTCTCTGAAGAGCAACAGG - Intergenic
1108572990 13:51768789-51768811 CTGCTTCTCTGCAGTGCAAAGGG - Intronic
1108872430 13:55003994-55004016 AAGATTTTCTGATGGGCAATTGG - Intergenic
1109167514 13:59054384-59054406 CAGCTTTGTTGAAGGTCAAATGG - Intergenic
1110149682 13:72235909-72235931 CAACTTTGTTGAAGGCCAAATGG + Intergenic
1110550135 13:76802717-76802739 AAGCTTTTGTGAATGACAAAGGG + Intergenic
1110594375 13:77302819-77302841 GAGCATTTCTAAATGGCAAAAGG + Intronic
1111141943 13:84130217-84130239 AAGCTTTCCTGAAGGGCAGATGG - Intergenic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1113988107 13:114335431-114335453 CAGCTTTTCTGACAAGCAATGGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1115531544 14:34332721-34332743 GACCTTTTCTGAACGACAAATGG + Intronic
1116129877 14:40841661-40841683 CAGGTTTACTGAAAGGAAAATGG - Intergenic
1116710014 14:48356510-48356532 CAGCTTGGATGAAGTGCAAAGGG - Intergenic
1118642630 14:67806835-67806857 CAGCTTTTCTGAAGCTCCCAAGG - Intronic
1119759957 14:77143264-77143286 AAGCTGCTCTGAAGGGAAAAGGG - Intronic
1120113034 14:80580822-80580844 GAGCTTGTTTTAAGGGCAAATGG - Intronic
1121262665 14:92577908-92577930 GAGCTTTTGTGAGGGTCAAAGGG + Intronic
1121745239 14:96284103-96284125 CAAGTTTCCTTAAGGGCAAATGG + Exonic
1124840320 15:33235459-33235481 CAGCTTTTCTCAACAGCAAAAGG + Intergenic
1125718848 15:41835573-41835595 CATCTTTCCTGCAGGGCAGAAGG - Exonic
1126079074 15:44940863-44940885 CAGCTTTTCAGAAAGAAAAAGGG + Intergenic
1126605849 15:50475465-50475487 TAGCCTTTCTGAAGGGCAACTGG + Intronic
1127096968 15:55521825-55521847 CAGCTTTGCTGAAGATCATATGG + Intergenic
1127625093 15:60772667-60772689 CATCTTTTCTGTAGAGCAACAGG - Intronic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1128968132 15:72081824-72081846 CAGCTTTGTTGAAGGTCAGATGG + Intronic
1129447141 15:75626208-75626230 CTGCTTTTGTTAAGGGCAAGTGG - Intronic
1130053151 15:80500642-80500664 CATCTTTTTTGATGGGCAGAGGG - Intronic
1130213418 15:81946667-81946689 CACCTTTTCTGCAGGGCAGATGG + Intergenic
1130745179 15:86645583-86645605 CACCTTTTATGAAGGCCACAAGG + Intronic
1130859124 15:87870668-87870690 CATCTTTTTTGAAAGGCCAAAGG - Intronic
1131218052 15:90556683-90556705 CAGCTTTTGTGAAAATCAAAAGG + Intronic
1131873539 15:96782860-96782882 CAGTTTCTCTGAAAGGAAAATGG - Intergenic
1133075195 16:3274804-3274826 CACCTTTTCTGAGGGGCAGATGG - Intronic
1133743833 16:8672802-8672824 CAGCCTTTCTGGAGGGAAATTGG - Intergenic
1134151262 16:11806924-11806946 CAGCTTTGCAGAAGGGAAAGTGG - Intergenic
1134558828 16:15189751-15189773 CTGCATTTCTGCTGGGCAAAGGG - Intergenic
1134684164 16:16147095-16147117 CACCTTTTCTTAAGGACACAGGG - Intergenic
1134919361 16:18101352-18101374 CTGCATTTCTGCTGGGCAAAGGG - Intergenic
1138163504 16:54778033-54778055 CAGCTTTTCTGAAGCTGAACTGG + Intergenic
1139707276 16:68749909-68749931 CAGCTTCTCCGAAGGGAAGAAGG - Intronic
1140847392 16:78903518-78903540 TACCTTTTCTGCAGGGCAGATGG - Intronic
1142539934 17:650666-650688 AAGCTTTGCTGGAGGGCAAATGG + Intronic
1148081992 17:44971964-44971986 CAGGTTTTCAGAAGCGAAAAGGG + Intergenic
1149253875 17:54801947-54801969 CAGATTTTTTCAAGGGCCAAGGG + Intergenic
1150995849 17:70316427-70316449 AAGCTTTTCTGGAGGGAAATGGG - Intergenic
1151065335 17:71142781-71142803 CAGATTTTATGCAGGACAAAAGG + Intergenic
1153800662 18:8665560-8665582 CACCTTTTCTGCAAGGCAGATGG - Intergenic
1156113251 18:33754099-33754121 CAGTCTTTCTGATGGACAAAAGG - Intergenic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1157142665 18:45126345-45126367 CAGTTTTGCTGAAGGGACAATGG + Intergenic
1157663420 18:49465695-49465717 CATCTTTTCTGATGGCCAGAAGG - Intergenic
1157859204 18:51125607-51125629 CTGCTTTTCACAAGGGCAGAGGG + Intergenic
1159120534 18:64164023-64164045 CTGCATTTCTGAAGTGTAAAAGG - Intergenic
1159309643 18:66690299-66690321 CAGTCTATCTGCAGGGCAAATGG - Intergenic
1164460668 19:28444892-28444914 GACCTTTTCTCCAGGGCAAATGG + Intergenic
1166279374 19:41780803-41780825 ATGCATTTCTGAAGGGCTAAGGG + Intergenic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
925740140 2:6998469-6998491 CAGCCTTTCTTAAGGGCAGAAGG + Intronic
926251989 2:11159932-11159954 CAGCTCTTCTGGAAGGCAACTGG + Intronic
926382515 2:12304491-12304513 AAGCTTTTCTGATTGGCAATTGG - Intergenic
926487841 2:13485058-13485080 TAGCTTTTCTGAAGAGTAAAAGG + Intergenic
927368781 2:22330435-22330457 CAGTTTTTCTGTAGCACAAAAGG + Intergenic
927425700 2:22979016-22979038 CAGCTTTTGGGAAGGGGAGAGGG + Intergenic
928624200 2:33122682-33122704 CAGCATTTCTGAAGGGGAGTAGG + Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932959759 2:76398834-76398856 AAGATTTTCTGACGGGCAATTGG - Intergenic
937019610 2:118638502-118638524 CACCTTTTCTGCATGGCAGATGG + Intergenic
937240862 2:120461515-120461537 CAGATTTTCTGAGGGGCTTATGG + Intergenic
937540094 2:122939123-122939145 CAAATTATCTGAAGGGAAAATGG + Intergenic
938310228 2:130284661-130284683 CAGCTTTTCTGCTGGGCCAGAGG + Intergenic
938444703 2:131367710-131367732 CAGCTTTTCTGCTGGGCCACAGG - Intergenic
939641160 2:144641544-144641566 CAATTTTTCTGATGGGGAAATGG + Intergenic
940678888 2:156759360-156759382 CAGCTTTGTTGAAGGTCAGATGG - Intergenic
942216578 2:173726515-173726537 CAGCTTTGCTGAAGATCAGATGG - Intergenic
942228633 2:173838713-173838735 AAACCTTTCTGAAGGCCAAAAGG + Intergenic
942660696 2:178261580-178261602 TAGTTTTTCTGAAAGGGAAAAGG - Intronic
943014039 2:182489726-182489748 CAGTTTTCCAGAAGGACAAAAGG + Intronic
944126715 2:196302171-196302193 CAGGTTTGCTGAAGGTCAAATGG + Intronic
944447629 2:199807252-199807274 CAGATTTTCTAAAAGGCAGAAGG + Intronic
944988829 2:205210653-205210675 CTGCTTTTCTGCAGGGCAACTGG - Intronic
945098962 2:206246406-206246428 CAGCTCTTCTAAAGGGTAAGTGG - Intergenic
945448525 2:209966622-209966644 CAGATTTTCTGAAGGAGAATTGG - Intronic
945510831 2:210700794-210700816 CAGAATCTCTGAAGGACAAAGGG + Intergenic
946378278 2:219327455-219327477 CTGCTCCTCTGAAGGGCAATGGG + Exonic
946457849 2:219843256-219843278 CAGATTTTTGGAAGGGCAATTGG - Intergenic
947472785 2:230413844-230413866 CACCTTTTCTGTGGGGCAATGGG - Intergenic
947878866 2:233487041-233487063 CTGCTCTTCAAAAGGGCAAAAGG + Intronic
947904731 2:233752398-233752420 CAGGTTTTCAGAATGGAAAAAGG - Intronic
1169254457 20:4086306-4086328 AAGCTTTGCTGAGGGGCACAGGG - Intergenic
1169759894 20:9079626-9079648 CCTCTGTTCTGGAGGGCAAATGG - Intronic
1170178304 20:13497843-13497865 CAGCTTTGTTGAAGGTCAGATGG - Intronic
1170226697 20:13998427-13998449 CAGTTTTTGTGAATGTCAAAAGG - Intronic
1172478165 20:35254216-35254238 CAGCTTTGCTGGAGATCAAATGG + Intronic
1173485607 20:43438746-43438768 CACCTTTTCTGCGGGGCAGATGG + Intergenic
1173504843 20:43578634-43578656 CAGCTGTTTTGAAGATCAAATGG + Intronic
1175280091 20:57798155-57798177 CAGCTTTTCCGGAGGGCAATTGG - Intergenic
1175696531 20:61106904-61106926 CAGGGTTGCTGATGGGCAAAGGG - Intergenic
1177493296 21:21856168-21856190 CAGCTTTGTTGAAGAGCAGATGG + Intergenic
1178494295 21:33073712-33073734 ATGCTTTTCAGAAGGGCCAAAGG + Intergenic
1178811299 21:35884512-35884534 CAGGTTTGTTGAAGGGCAGATGG - Intronic
1178814441 21:35915071-35915093 AAGATTTTCTGATGGGCAATTGG + Intronic
1180567654 22:16688630-16688652 CAGCTCTTCTAATGGGAAAATGG + Intergenic
1180903562 22:19392559-19392581 CAGCTTTTCTGCAGGTCCTAGGG - Intronic
1183136478 22:35893840-35893862 CATCTGGGCTGAAGGGCAAAGGG + Intronic
1183150865 22:36036435-36036457 CACATTATGTGAAGGGCAAAAGG - Intergenic
1183550328 22:38479052-38479074 GAGCTTTTCTGAAGGAGCAATGG + Intronic
1183783173 22:40011942-40011964 CAGCTATTCTGTAGAGCAACAGG - Intronic
1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG + Intronic
949334994 3:2964995-2965017 CAGGTTTTCTGATGTGTAAATGG + Intronic
949845503 3:8366356-8366378 CAGCATTCCTGGAGGGCAAGAGG - Intergenic
951655118 3:24998522-24998544 CAGCTGTTCTGAACGCAAAAAGG - Intergenic
952228233 3:31401364-31401386 CAGCTTTGTTGAAGATCAAATGG + Intergenic
952796681 3:37244782-37244804 CTTCTTTTCTCAAGTGCAAATGG + Intronic
953498955 3:43414238-43414260 CTGTTTTTCTGAAAGGGAAAAGG - Intronic
953572366 3:44081324-44081346 CAGGTTTGCTGATGGGCAAGTGG - Intergenic
955090320 3:55744026-55744048 CACCTTTTCTGCATGGCAGATGG + Intronic
955251594 3:57288402-57288424 CACCTTTTATGAAAGACAAATGG + Intronic
955811914 3:62799923-62799945 GAGCTTCTCTGCAGGGCAGAGGG + Intronic
958434843 3:94083664-94083686 CACATTTTCTGCATGGCAAATGG - Intronic
958768140 3:98395489-98395511 CAGCTTCTCTGAGGGTCAGAGGG - Intergenic
960170060 3:114450111-114450133 CAGTTTTCCAGAAGGGAAAAAGG - Intronic
960898584 3:122531708-122531730 TAGCTTTTCTGAGAGGAAAAGGG + Intronic
961677100 3:128574296-128574318 CAGATTTTCTGCAGGAAAAATGG + Exonic
961904584 3:130249653-130249675 CAACTTTTCTGAAGAGCAACTGG + Intergenic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
964584638 3:158283772-158283794 CAGGTTTTCTGGAGGGCAATTGG - Intronic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
965741793 3:171883169-171883191 CAAGTGTTCTGAAGGGGAAAAGG - Intronic
966118938 3:176500534-176500556 CAGAATTTTTGCAGGGCAAAAGG + Intergenic
967024421 3:185551717-185551739 TAATTTTTTTGAAGGGCAAAGGG - Intronic
967050551 3:185779762-185779784 CAGCTTTTCAGAATGGCAATAGG - Intronic
967641518 3:191870400-191870422 CAGCATTTATAAAGGGCAAGAGG - Intergenic
967978652 3:195050881-195050903 CAGCTTTGCTGAAGATCAGATGG + Intergenic
968281662 3:197481675-197481697 CAGCTTTTCTGAAGAACATGAGG - Intergenic
970091662 4:12415419-12415441 CCGCTTTTTAGAATGGCAAAGGG - Intergenic
971203569 4:24537426-24537448 CAGCTATTCTGAAGGCCATCAGG + Intronic
972190307 4:36583540-36583562 CAGCTTTTGGGAAGGGATAAAGG + Intergenic
973062082 4:45739686-45739708 CAGCTTTGCTGAAGATCAGATGG + Intergenic
976008690 4:80461050-80461072 AAGATTTTCTGATGGGCAATTGG + Intronic
976121879 4:81792040-81792062 CATCTATTCTGGAAGGCAAAGGG + Intronic
978668205 4:111212037-111212059 CAGCATTTATGAATGGCACATGG + Intergenic
978978170 4:114906820-114906842 CAGCTCTTCTGAAGGGACCATGG + Intronic
979270701 4:118757277-118757299 CAGCTTATCATAAGGGCAAAAGG + Intronic
980456503 4:133050767-133050789 CAACTTTTTTGAAGAACAAATGG - Intergenic
981092381 4:140745025-140745047 AAGATTTTCTGATGGGCAATTGG - Intronic
981473723 4:145166334-145166356 AAGCCTTTCTGAAAGGCAAATGG + Intronic
981648105 4:147022808-147022830 CAGTTTTGCTGAAGATCAAATGG + Intergenic
982272432 4:153604949-153604971 CAGCACTTCTGGAGGCCAAAGGG - Intronic
982603910 4:157488931-157488953 GAGCTCTTCTCAAGTGCAAATGG - Intergenic
983576762 4:169269981-169270003 CAGCTTTTCTGAATGGGATTAGG - Intronic
985144567 4:186881602-186881624 CAGTTTTTCTGAGGAGCAATGGG - Intergenic
986399105 5:7362116-7362138 CAGCCTTTCTGAAGTGCTGATGG - Intergenic
986875200 5:12098857-12098879 CAGGTTTGCTGAAGGTCAGATGG + Intergenic
987458675 5:18178976-18178998 AAGCTATTCTGGAGAGCAAAGGG - Intergenic
987504809 5:18754219-18754241 TACCTTTTCACAAGGGCAAAGGG + Intergenic
987677024 5:21087705-21087727 AAGATTTTCTGATTGGCAAATGG - Intergenic
987730910 5:21771506-21771528 AAGATTTTCTGATGGGCAATTGG + Intronic
989298988 5:39865975-39865997 CAGCTTTTTTGAAGATCAGATGG + Intergenic
989455344 5:41637469-41637491 CAGCACTTCAGAAGGCCAAAGGG - Intergenic
992099032 5:73388716-73388738 TTGCTTTTATGTAGGGCAAATGG - Intergenic
994710450 5:103258931-103258953 CACCTTTTCTGCAGCACAAAAGG - Intronic
995961137 5:117841228-117841250 CAGCTTTACTGAAGATCATAAGG - Intergenic
997338101 5:133121916-133121938 CAGTTTTCCTGAGGGGCGAATGG + Intergenic
999113001 5:149138178-149138200 CAACTTCTCTGAGGGGAAAAAGG - Intergenic
999350378 5:150864612-150864634 CTGCTTTACAGAATGGCAAATGG + Intronic
999362624 5:150998650-150998672 CACCTTTTCTGCATGGCAGATGG - Intergenic
999573144 5:152943387-152943409 CAGCATTTCCTAAGGGCAACTGG - Intergenic
1000061427 5:157659826-157659848 AAGATTTTCTGAATGGCAATTGG + Intronic
1002308506 5:178298425-178298447 CAGCCTTCCTGAAATGCAAATGG + Intronic
1002691503 5:181053454-181053476 CAGCTTTTCTGAAGGGAAACGGG - Exonic
1003787027 6:9498012-9498034 GAGATTTTCTGATGGGCAATTGG + Intergenic
1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG + Intergenic
1004456742 6:15798448-15798470 CAGTTTGTCAGAAGGGCAGATGG + Intergenic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1005694701 6:28341086-28341108 CAGCGTTTCTGCAGGGGAACAGG - Intronic
1006224422 6:32524612-32524634 CATCATTTCTAAAGGGCAAACGG - Intronic
1007195584 6:40057016-40057038 CAGCTTTGCTGAACTGCAGAGGG + Intergenic
1008064584 6:47033781-47033803 GAGCTTTTCTCAAAGGCAAGTGG - Intronic
1008649920 6:53551644-53551666 AAGGTTTTCTGAATGGCAATTGG - Intronic
1009036009 6:58117800-58117822 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009211827 6:60871401-60871423 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1010272455 6:73929558-73929580 CATCTTTTCTGGAGGGAACATGG + Intergenic
1011211992 6:84965089-84965111 CAGCTTCTCTGAAGGGGCAGAGG + Intergenic
1012572843 6:100752059-100752081 CAGCTGTTCTTAAGGGTAAGAGG - Intronic
1013425941 6:110012655-110012677 TACCTTTTCTGAATGGTAAAAGG + Intergenic
1014099573 6:117496260-117496282 CAGTTTTTCTGAAAGGAATATGG - Intronic
1014852330 6:126357212-126357234 CAGCTTTGTTGAAGAGCAGATGG + Intergenic
1015121547 6:129706564-129706586 CAGCTTTTCAAAAGACCAAATGG + Intronic
1015189956 6:130461592-130461614 CTCCTTTTCTGAAGGTCATATGG + Intergenic
1015313916 6:131795491-131795513 AATCATTGCTGAAGGGCAAAAGG + Intergenic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1016792527 6:148080314-148080336 CATCATTTTTGAAGGGAAAAAGG - Intergenic
1018171167 6:161144183-161144205 GATCTTCTCGGAAGGGCAAAGGG + Intronic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021536129 7:21706846-21706868 CAGCTTTTCAAAGGAGCAAAAGG + Intronic
1023480388 7:40627668-40627690 CACCTTTTCTGCAAGGCAGATGG - Intronic
1026086488 7:67267298-67267320 GAGATTTTCTGATGGGCAATTGG - Intergenic
1026184753 7:68074000-68074022 CACCTTTTCTGCATGGCAGATGG - Intergenic
1026537988 7:71256142-71256164 CAGATTTTCTGATTGGTAAATGG - Intronic
1026690656 7:72547559-72547581 GAGATTTTCTGATGGGCAATTGG + Intergenic
1027494162 7:78866821-78866843 CAAATTTTCTGAAGTGAAAAAGG - Intronic
1029002227 7:97166401-97166423 AAGATTTTCTGATGGGCAATTGG + Intronic
1029993422 7:104983781-104983803 CTGCTTTTTTGGAGGGCAAGAGG + Intergenic
1029997550 7:105022866-105022888 CAGTTTTTCTGTAAGGCATATGG + Intronic
1030279158 7:107752260-107752282 CAGCTTTTCTAAGGTGTAAATGG + Intronic
1030374624 7:108740897-108740919 CTGCTTTTCTGAAGATCAGATGG + Intergenic
1030856927 7:114570050-114570072 GATTTTGTCTGAAGGGCAAAAGG - Intronic
1032700999 7:134379042-134379064 CACCTTTTCTGCATGGCAGATGG - Intergenic
1033021305 7:137727420-137727442 AAGCTTTGCAGAAGGGCAAAAGG - Intronic
1033554977 7:142481362-142481384 CAGCTTTGGTTAATGGCAAATGG + Intergenic
1034779244 7:153862116-153862138 CTGCTTTTCTGAAGTCCAAATGG - Intergenic
1035556846 8:573416-573438 AAGATTTTCTGATTGGCAAATGG + Intergenic
1035862845 8:3048558-3048580 TAATTTTTCTGAAGGGCAAAAGG - Intronic
1036818724 8:11922205-11922227 CTGCTTATCTGTATGGCAAAGGG - Intergenic
1037385554 8:18336537-18336559 AAGATTTACTTAAGGGCAAAGGG + Intergenic
1037682730 8:21110896-21110918 CACCTTTTCTGCATGGCAGATGG + Intergenic
1039479240 8:37859491-37859513 CAGCTGTTCAGTATGGCAAAGGG + Exonic
1039656161 8:39410423-39410445 AAGTTTTTCTGCAGGGAAAAAGG - Intergenic
1039796053 8:40916336-40916358 CTGCTTTTCTGAAAGGCACCTGG + Intergenic
1039817047 8:41103521-41103543 CAGCTACTCAGGAGGGCAAAAGG - Intergenic
1040414400 8:47183492-47183514 CAGCTCTTGAGAAGGACAAACGG + Intergenic
1042089477 8:65143418-65143440 CAGTGCTTCTGAAAGGCAAATGG - Intergenic
1042145563 8:65725492-65725514 CAACTTTTCTGAAAGGAAAAAGG + Intronic
1043002850 8:74780592-74780614 AAGATTTTCTGATGGGCAATTGG - Intronic
1043506916 8:80911327-80911349 CAGCGTCTCACAAGGGCAAAAGG + Intergenic
1044922849 8:97184365-97184387 CTGATTTTCCAAAGGGCAAATGG - Intergenic
1045044085 8:98257821-98257843 AAGCTTTTCTGATTGGCAATTGG - Intronic
1046541272 8:115586951-115586973 CATTTGTTTTGAAGGGCAAAAGG - Intronic
1046736328 8:117780003-117780025 CAGCTTTGCTGAAGATCAGATGG - Intergenic
1046803843 8:118458378-118458400 CACCTGTTCAGAAGGTCAAATGG - Intronic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1048252274 8:132876608-132876630 TAGCCTTCTTGAAGGGCAAAAGG - Intronic
1052723125 9:32196740-32196762 CAGCTTTGCTGAAGATCAACTGG + Intergenic
1055217636 9:73885843-73885865 CAGCTTTGTTGAAGAACAAATGG + Intergenic
1056739582 9:89242734-89242756 AAGATTTTCTGATTGGCAAATGG + Intergenic
1056920090 9:90779814-90779836 AAGATTTTCTGATTGGCAAATGG + Intergenic
1057066518 9:92057406-92057428 CTGCCTTTCTGGAAGGCAAATGG - Intronic
1058054254 9:100433753-100433775 CAGCCTTTCTTTAGAGCAAACGG + Intronic
1058073330 9:100624173-100624195 CAGCTTTTCTGAAGCAAAATTGG + Intergenic
1058132108 9:101264882-101264904 CATCTTGTCTGAAGTGTAAAGGG - Intronic
1058145333 9:101404470-101404492 CAATTTTTCTGAAAGACAAAAGG - Intronic
1059988159 9:119839852-119839874 CAGCTCTTCTGATGGGAGAAGGG - Intergenic
1061824681 9:133250824-133250846 CAGCTTTGCTGAATTCCAAAAGG + Intronic
1062376087 9:136262506-136262528 CAGCTTTTCTGAGGAGGAAATGG - Intergenic
1186018295 X:5224814-5224836 CAGCTTTGCTGAAGATCAGATGG - Intergenic
1187587205 X:20676535-20676557 CAGCTTTTGGGAAGCCCAAATGG + Intergenic
1187756765 X:22536428-22536450 CAGCTCTTCTGCAGGGGAAAAGG - Intergenic
1188353889 X:29165746-29165768 TAGCTTCTCTGATGGCCAAAGGG - Intronic
1188780701 X:34280365-34280387 CAGCTTATCTGGAGAGCAGATGG - Intergenic
1189069537 X:37848990-37849012 CACCTTTTCTGCAGGGCAGATGG - Intronic
1189496433 X:41513089-41513111 CAGATTCTCTGCAGGGCAAGTGG + Intergenic
1189851736 X:45184365-45184387 CATCCTTTCTGTAAGGCAAAGGG - Intronic
1191764701 X:64684863-64684885 CAGCTTTTCAGAAGTCTAAAGGG + Intergenic
1191959251 X:66681729-66681751 CAGCTTTGTTGAAGGCCAGATGG + Intergenic
1192119215 X:68439048-68439070 CACCTTTTCTGAGGGGCAGATGG + Intergenic
1192302643 X:69921700-69921722 CAACTTCTCTGAAGGACAAGGGG - Intronic
1193162715 X:78245963-78245985 CAGCTTTGCTGAAGATCAGATGG - Intergenic
1193532398 X:82671520-82671542 AAGATTTTCTGAATGGCAATTGG + Intergenic
1194031290 X:88819075-88819097 CAGCTTTGCTGAAGATCAGATGG + Intergenic
1194059457 X:89179284-89179306 CAGTTTATCTGCAAGGCAAATGG + Intergenic
1194189691 X:90819647-90819669 CAGCTTTTTTGAAGCTCATATGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1194410049 X:93546301-93546323 CAACTTTGCTGAAGAGCAGATGG - Intergenic
1195535573 X:106005495-106005517 CAGCATTTTTGAAGAGTAAAAGG + Intergenic
1196013714 X:110915405-110915427 ATACTTTTCTGAAGAGCAAAAGG - Intergenic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196586806 X:117439547-117439569 CATCTTTTCTGAAGTGCAAATGG - Intergenic
1196781687 X:119389251-119389273 CACCTTTTCTGGATGGCAGATGG + Intergenic
1196858514 X:120006020-120006042 CACTTTTTCTGCAGGGCCAATGG - Intergenic
1197073256 X:122325851-122325873 CAGATTGTCTGAAGGGTGAAAGG - Intergenic
1197525926 X:127562709-127562731 CAGGTTTGCTGAAGAGCAGATGG + Intergenic
1198998416 X:142603761-142603783 CAGCTTTTCCGAAGATCAGATGG + Intergenic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic