ID: 1156202100

View in Genome Browser
Species Human (GRCh38)
Location 18:34845188-34845210
Sequence CAGTATGTTCAAATTATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156202100_1156202105 21 Left 1156202100 18:34845188-34845210 CCTTGTATAATTTGAACATACTG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1156202105 18:34845232-34845254 TAAATTGTTCATGTGCACAAAGG 0: 1
1: 0
2: 2
3: 31
4: 253
1156202100_1156202102 -7 Left 1156202100 18:34845188-34845210 CCTTGTATAATTTGAACATACTG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1156202102 18:34845204-34845226 CATACTGAAATGGCATTATGTGG 0: 1
1: 0
2: 2
3: 25
4: 199
1156202100_1156202107 23 Left 1156202100 18:34845188-34845210 CCTTGTATAATTTGAACATACTG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1156202107 18:34845234-34845256 AATTGTTCATGTGCACAAAGGGG 0: 1
1: 0
2: 3
3: 16
4: 187
1156202100_1156202106 22 Left 1156202100 18:34845188-34845210 CCTTGTATAATTTGAACATACTG 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1156202106 18:34845233-34845255 AAATTGTTCATGTGCACAAAGGG 0: 1
1: 0
2: 3
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156202100 Original CRISPR CAGTATGTTCAAATTATACA AGG (reversed) Intronic
902319399 1:15650080-15650102 CAGAATCTGAAAATTATACAAGG - Intronic
906421783 1:45674850-45674872 CATTATTTTCAAATTACAAATGG + Intronic
906760297 1:48371134-48371156 CAGTTTATTCAAATAATACAAGG + Intronic
907185519 1:52606179-52606201 CAGTAGGTTCACATTCTAGAAGG + Intronic
908050320 1:60222551-60222573 CAATACATTTAAATTATACATGG + Intergenic
908625341 1:66034439-66034461 CAGTAAATTTAAATTATTCATGG + Intronic
910687711 1:89934637-89934659 CAGTCTGTTCAACTTTTGCAGGG - Exonic
911569148 1:99501768-99501790 TAGTATTTGCAATTTATACATGG + Intergenic
913137694 1:115908884-115908906 TAATATGTTTAAATGATACAGGG - Intergenic
914202353 1:145496930-145496952 CTGTACGTTCAAATTTCACATGG + Intergenic
914481478 1:148070080-148070102 CTGTACGTTCAAATTTCACATGG + Intergenic
915041713 1:152973246-152973268 GAGTTTGTACAAAGTATACAGGG + Intergenic
916760376 1:167810935-167810957 CAGTATATTAGAATTAAACAGGG + Intronic
916835953 1:168545082-168545104 CAGTATATTTAAATTCTACTGGG - Intergenic
916838514 1:168575492-168575514 CAGTATGTTTAAATTCTACTGGG + Intergenic
922013490 1:221617836-221617858 CAATATGTTAAAATTATTCCAGG - Intergenic
922413602 1:225398900-225398922 CAGCATGTGGAAATTATACCTGG - Intronic
924891034 1:248280293-248280315 CAGTATATTGACATTATATATGG - Intergenic
1063517157 10:6707841-6707863 CAGTATGTGCAAATGACAGATGG - Intergenic
1063599956 10:7471943-7471965 CAGTCTCTTCAAATCCTACATGG + Intergenic
1065567650 10:27030868-27030890 AAATATTTTCAATTTATACAAGG + Intronic
1065701387 10:28429282-28429304 CAGTTTATTCAAATTATTCATGG - Intergenic
1068890133 10:62140071-62140093 CAGTATGTTCAAAATAATAATGG - Intergenic
1069399569 10:68028590-68028612 CATTGTGTCCAGATTATACATGG + Intronic
1071588706 10:86850362-86850384 CAGGATGCTTAAATTAAACAGGG + Intronic
1075180094 10:120203664-120203686 CACTATATTCAGATTATTCATGG + Intergenic
1075838169 10:125474208-125474230 CACAATTTTCCAATTATACACGG - Intergenic
1076833192 10:133007200-133007222 CAGTACCTTCACATCATACAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079265902 11:18932742-18932764 CAGTAAGTTCAAATTCTACCAGG - Intergenic
1082610655 11:55292993-55293015 CCATATGTTCAAATTATAAGTGG + Intergenic
1082659288 11:55890682-55890704 CCATATGTTCAAATTATAAGTGG - Intronic
1082705235 11:56486789-56486811 CAGTCTGTTCAATTGATTCAGGG - Intergenic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1091268943 11:134292261-134292283 CAGTGTGTTCAAGATTTACACGG - Intronic
1092405136 12:8216356-8216378 CTGTATGTTTAAATTCTAAAGGG - Intergenic
1092556283 12:9565669-9565691 TACTCTGTTCAAATTATATACGG + Intergenic
1093056772 12:14563881-14563903 CAGTATGTTCATTCTTTACACGG - Intronic
1093445010 12:19246853-19246875 GAGTTACTTCAAATTATACAAGG - Intronic
1093503018 12:19833916-19833938 CAGTAAGTTCAAAATCTACAGGG - Intergenic
1093811024 12:23492244-23492266 AAGTATGTTCAGATTATGAAGGG - Intergenic
1094515809 12:31124983-31125005 TACTCTGTTCAAATTATATACGG - Intergenic
1096804199 12:54130381-54130403 GAGTATGTGCAAATGAGACAGGG + Intergenic
1098580841 12:72097182-72097204 CAATTTGTTCAAATTGGACAAGG - Intronic
1099163069 12:79269482-79269504 CTGTGTGTTTAAACTATACAGGG - Intronic
1100262943 12:92949915-92949937 CACTATGTTCAAATATGACATGG + Intergenic
1100509129 12:95251824-95251846 CAGTATGTCCAAATTCTTTAAGG - Intronic
1101586283 12:106088671-106088693 CAGTTTGTTCAATGTTTACAAGG + Intronic
1105044689 12:132992643-132992665 CAATATGTTCAACTTATAATAGG + Intronic
1105475539 13:20725401-20725423 CAGTATGTTGAAATTAGAGGTGG + Intergenic
1107011066 13:35671778-35671800 CTGTGTCTTCAAATTATGCAGGG - Exonic
1108669970 13:52676099-52676121 CAGTTTCCTTAAATTATACAAGG - Intronic
1108692983 13:52876673-52876695 AAATATGTTCAAATTATTAAAGG - Intergenic
1108792153 13:53983173-53983195 CAATATGTTCAAGTTTTCCAAGG + Intergenic
1109702322 13:66042632-66042654 CATTAGTTTCACATTATACAAGG - Intergenic
1111333043 13:86786038-86786060 CAGAATTTGCAAATTATGCAGGG - Intergenic
1112585815 13:100717761-100717783 AAGTATGTTCTTATTAAACAAGG + Intergenic
1113286494 13:108854743-108854765 CATTATTTTCAAATTAGAAATGG - Intronic
1113340716 13:109422701-109422723 CTGTATTTTGAAATTATACCTGG + Intergenic
1114589180 14:23844082-23844104 ATGTGTGCTCAAATTATACATGG + Intergenic
1115370322 14:32606248-32606270 CAGTATGTTCAATTTTTTAATGG + Intronic
1120450460 14:84660159-84660181 TAGTATGTTAAGATTATAAAAGG - Intergenic
1124408376 15:29413252-29413274 CAGTATATGTAAATTATACCTGG + Intronic
1126428442 15:48555074-48555096 CAGTATGTTCTATTTAAACATGG + Intronic
1131615542 15:94013736-94013758 CAGTCTGTTGAAATTGTAAAGGG - Intergenic
1131827560 15:96332981-96333003 CAGGAGGTTCAAATTACAAATGG + Intronic
1134363023 16:13550372-13550394 TAGAAAGTTCAAATTATAGAAGG - Intergenic
1135934343 16:26766987-26767009 CAGTATGTTCTTATCATCCAGGG - Intergenic
1140715988 16:77726094-77726116 TAGTATTTTCACATTATACTGGG - Intronic
1144186150 17:12797127-12797149 CAAAATGTTAAATTTATACACGG - Intronic
1146029797 17:29356075-29356097 CAGAATGTACAAATCATACATGG - Intergenic
1148182297 17:45614962-45614984 TAGCATGTGCAAATTATAGAAGG - Intergenic
1148266561 17:46230746-46230768 TAGCATGTGCAAATTATAGAAGG + Intergenic
1150291304 17:63983870-63983892 CAGTAGGTGCAAAATAAACATGG - Intergenic
1152858718 17:82682213-82682235 TAGTAAGATCAAAATATACAAGG + Intronic
1153405169 18:4730324-4730346 CACTATATTCAACATATACAGGG + Intergenic
1155236581 18:23825933-23825955 CAGTAGGTTTAAATTTTAAAAGG - Intronic
1155585896 18:27364507-27364529 CTGTATTTTAAAATAATACATGG + Intergenic
1156202100 18:34845188-34845210 CAGTATGTTCAAATTATACAAGG - Intronic
1156636580 18:39037964-39037986 CAGTATCTTCAAACTATTCTAGG - Intergenic
1156672551 18:39488278-39488300 CAGCATTTTCAAATAAAACATGG - Intergenic
1156931389 18:42648625-42648647 CAGCATGTTCAACTAATATATGG + Intergenic
1156976734 18:43231093-43231115 TAGTATGTGCAAATATTACACGG - Intergenic
1157970286 18:52259422-52259444 CAGTATTTACAAATTGGACAAGG + Intergenic
1158232968 18:55279186-55279208 CAGGATGTTCAAAACATACATGG + Intronic
1163391344 19:17032479-17032501 CAGTAGGTTGAAATTACCCATGG + Intergenic
930742188 2:54843063-54843085 CATTGTGTTAAAATTATACGTGG - Intronic
931802053 2:65767983-65768005 CAGCATGTTCAGATCACACAGGG + Intergenic
932525460 2:72461684-72461706 CATTAAGTTCAAATTCTAAAAGG + Intronic
933486273 2:82928113-82928135 AAGAATGTTCAAAATAGACATGG - Intergenic
933854576 2:86400784-86400806 TAATATGTTCAAATTATGCCAGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
938241656 2:129747055-129747077 CAGTGTGTGCAGATTATATATGG + Intergenic
938586348 2:132694523-132694545 CAGCATTTTCAAATTTTACTAGG - Intronic
940327950 2:152444692-152444714 AACTATGTTAAAATCATACAGGG - Intronic
941104075 2:161332686-161332708 CAGTATGTTCTAAAAAAACATGG - Intronic
942156658 2:173135867-173135889 CAGTTAATTAAAATTATACATGG - Intronic
942735535 2:179107304-179107326 CATTATGTTAAAATCATACTTGG + Exonic
943492305 2:188570216-188570238 CAGTAATTTCAAAGTAAACATGG + Intronic
944059140 2:195553821-195553843 AAGTATATTGAAAGTATACAAGG - Intergenic
945571168 2:211469620-211469642 AAGTCTTTTTAAATTATACAAGG + Intronic
945658315 2:212653118-212653140 CAGTATGTGCAAATTTAAAACGG - Intergenic
946581823 2:221137060-221137082 CAGTATGTGTACATAATACAAGG - Intergenic
947280601 2:228449067-228449089 CAGTAAGTTAAAAATATAAAAGG - Intergenic
948665069 2:239529508-239529530 CAGAACATTCAAATTGTACAGGG - Intergenic
1169577593 20:6982478-6982500 CTGTATTTTCAAATTATAAAGGG - Intergenic
1179298566 21:40086132-40086154 CAGTTTGAACAAATCATACAGGG + Intronic
949571346 3:5296319-5296341 CGGTATGATAAAATGATACAAGG + Intergenic
950913846 3:16623006-16623028 CAGTCTGTTCAATGTAAACAGGG - Intronic
951292165 3:20884663-20884685 CAGAATTTTCACACTATACATGG - Intergenic
951322924 3:21269279-21269301 CAGTATGTTTGAATTTTCCAAGG - Intergenic
951986252 3:28624703-28624725 TAGTATGTTTAAATCCTACATGG + Intergenic
955017335 3:55085084-55085106 CATAATGTTAAAAATATACAAGG + Intergenic
957418690 3:79939622-79939644 CAGTATGTTAATATCATACTTGG - Intergenic
959826196 3:110798999-110799021 CAGTGTTTTCAGTTTATACATGG - Intergenic
960169713 3:114444915-114444937 ATGTATTTTCAAATTCTACATGG + Intronic
960444458 3:117730687-117730709 CAGTAAGTTCAATTCGTACATGG + Intergenic
963337512 3:143993445-143993467 CAGGATGATCAAATTATGAAGGG + Intronic
963457684 3:145565725-145565747 CATTATATTCAAGTTATACATGG - Intergenic
964165083 3:153694596-153694618 CAGTATTCACAAATAATACATGG + Intergenic
964320845 3:155495442-155495464 CAGCATGTTCAAATGACATATGG - Intronic
964608332 3:158582980-158583002 CAGTTTGTTCAAATAATAATAGG + Intronic
967555585 3:190853753-190853775 CAGGATGTGCAAATTATTCTGGG + Exonic
967626379 3:191690209-191690231 CAGTATGTTGAAATTCCACCTGG + Intergenic
967717913 3:192784309-192784331 CATTATTTTCAAATTGTAAATGG + Intergenic
968407274 4:351799-351821 CAGCCTGCTCAAATTAGACAGGG + Intronic
969760981 4:9181638-9181660 CTGTATGTTTAAATTCTAAAGGG + Intergenic
971019480 4:22518952-22518974 CTGTTTCTTCAGATTATACATGG - Intergenic
974105514 4:57465656-57465678 CAGGAGATTCAAATTCTACATGG + Intergenic
974902359 4:68016826-68016848 CTGTCTGTTAAAATTACACATGG + Intergenic
975127148 4:70795581-70795603 CTGTGTGTACATATTATACAAGG + Intronic
975271900 4:72445403-72445425 CAATATGTTCAAATAATCTATGG + Intronic
977769955 4:100846448-100846470 CATTATGTTCAAATAAAAAATGG - Intronic
979155209 4:117378288-117378310 CAGTATGTCAAAAGAATACAGGG + Intergenic
979749443 4:124259606-124259628 TAGTATAGTCAAATGATACAAGG + Intergenic
980173007 4:129312139-129312161 CAGTATTTTTAAATTAGAGATGG - Intergenic
980277416 4:130672198-130672220 CAGTCTGTTTATATTAAACAGGG - Intergenic
980490629 4:133522644-133522666 CACTATATTAAAAATATACATGG + Intergenic
981570911 4:146149450-146149472 CAGTATTTTCAACTGAGACAGGG + Intergenic
982580143 4:157167065-157167087 CAGTATATTCTAAATATACTTGG + Intronic
983158031 4:164376466-164376488 AATTATGTGCAAATAATACAAGG + Intronic
983332012 4:166342145-166342167 CAGTATGATTAGATTATACAAGG - Intergenic
983435123 4:167704483-167704505 CAGAATGTTCAAATAATAAAAGG - Intergenic
984107086 4:175561548-175561570 CAGTATCTTCAAATAATAACTGG + Intergenic
984563905 4:181304642-181304664 CAGTATTTAAAAATTATACTTGG - Intergenic
984982731 4:185298698-185298720 CAGAATGTGCAAAGAATACAAGG - Intronic
985016416 4:185639535-185639557 TAATATTTTCAAATAATACATGG + Intronic
986305323 5:6509886-6509908 CAGCATGTTCAAAGAATACAGGG + Intergenic
986851849 5:11822428-11822450 CAATATATTCAAACAATACATGG + Intronic
987940776 5:24533093-24533115 CATTATTTTCAAATTATAGATGG - Intronic
987983076 5:25113692-25113714 CAATCTATTCAAATTATAGATGG - Intergenic
988025237 5:25677632-25677654 CATTCTGTTTAAATTATAAATGG - Intergenic
988235875 5:28543564-28543586 TATAATGTTAAAATTATACAGGG - Intergenic
989285602 5:39695897-39695919 CAGGATGTTACAATTACACACGG - Intergenic
989393661 5:40929389-40929411 CAGTAAGTTCAGATTGTTCAAGG + Intronic
990295397 5:54396743-54396765 TAGTATCTTCAATTTATTCAAGG + Intergenic
990926766 5:61034715-61034737 CAGCATGTTCAAACTATGAAAGG + Intronic
991698624 5:69297003-69297025 CAGTATGTACCAATTTCACAGGG + Intronic
992712824 5:79477554-79477576 CAATCTGTTCAAATTGAACAGGG + Intronic
993818067 5:92577874-92577896 CAATATTTTCAAATTAGGCATGG - Intergenic
994637948 5:102365611-102365633 CAGTATTTTCAAATTATGATGGG - Intergenic
994716790 5:103331303-103331325 GCATATATTCAAATTATACAAGG - Intergenic
995904052 5:117101973-117101995 AAGTATGTTCAAATATTACATGG - Intergenic
999505423 5:152189958-152189980 AAGTATGTTCAAATTATTAGAGG - Intergenic
1001164391 5:169350416-169350438 AAGTAAGTTCAAATTATAGATGG + Intergenic
1010356613 6:74941515-74941537 CAGAATGTTCAGTTTAAACATGG + Intergenic
1010380879 6:75223472-75223494 CAGAATATTAAAATTAGACAAGG + Intergenic
1010688887 6:78885152-78885174 AACTATTTTCAAATTATAAAAGG + Intronic
1012083295 6:94787891-94787913 CATTATATTCAAAGTATACTAGG + Intergenic
1013699742 6:112750872-112750894 AAGTATGTTGAAATTAGCCAAGG + Intergenic
1014339011 6:120179298-120179320 CAGCATGTTCACATTGCACATGG + Intergenic
1017393940 6:153974549-153974571 CTGTATGGTAAAATTATAGATGG - Intergenic
1019226735 6:170517480-170517502 CACTATATTCAAATTTTTCATGG - Intergenic
1020679417 7:11218754-11218776 AAATATGTTGAAATTATACATGG + Intergenic
1022801985 7:33785587-33785609 CAGTAAGTTAAAAGTATATATGG - Intergenic
1024973107 7:55088469-55088491 CTGGTTGTTCAGATTATACAGGG + Intronic
1030187052 7:106774292-106774314 AAGAATGTTCAAGTTTTACAGGG + Intergenic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1032211862 7:129922631-129922653 CAGTATTTGCAAATTATAAATGG + Intronic
1033781290 7:144672484-144672506 CATGATGTTGAAATTATCCATGG - Intronic
1033871295 7:145756926-145756948 CAGTATATTCAAATTTATCATGG + Intergenic
1034568058 7:151931141-151931163 CAGTATTTTCAAATTTTGGAAGG - Intergenic
1036113999 8:5938199-5938221 AAGTATGTGCAAATTTCACATGG - Intergenic
1036271085 8:7303464-7303486 CACTATGTTTAAATTCTAAAGGG + Intergenic
1036350264 8:8006880-8006902 CACTATGTTTAAATTCTAAAGGG - Intergenic
1038131347 8:24735087-24735109 CAGTATTTTCATATTACATAGGG + Intergenic
1039769792 8:40673823-40673845 CAGGAACTTCAAATGATACATGG + Intronic
1040958233 8:53002724-53002746 CAGTATTTTCAAAATATTGAGGG - Intergenic
1041568517 8:59308952-59308974 CATTATGTTCATATTATGGAAGG - Intergenic
1042094065 8:65192457-65192479 CAGTATTCTGAAATTCTACAAGG + Intergenic
1043177053 8:77034869-77034891 CAGTATGTAGGAATAATACAGGG + Intergenic
1043994981 8:86802665-86802687 CATAATGTTCAATTAATACATGG - Intergenic
1044567863 8:93684521-93684543 CAGCATTTTCAAAATATAAAAGG + Intergenic
1045891043 8:107157725-107157747 GAGTGTATTTAAATTATACATGG - Intergenic
1046010520 8:108540968-108540990 GAGAATATTCAAAATATACAGGG - Intergenic
1046234525 8:111405251-111405273 AAATATGTTTAAATTATAAAAGG - Intergenic
1046760343 8:118013781-118013803 AAGTATGTTCAAATATTTCATGG + Intronic
1047640383 8:126813602-126813624 CAGTTTCTTCATAATATACATGG + Intergenic
1048241828 8:132750253-132750275 CAGTATGTCCAAAATAGAAAAGG - Intronic
1050574785 9:6982841-6982863 CAGTAGGTTCAAATAATCAATGG + Intronic
1052206230 9:25844467-25844489 CACTATTTTCAAAATATGCATGG - Intergenic
1052874972 9:33552064-33552086 AAATATTTTCAATTTATACAAGG - Intronic
1053333731 9:37243254-37243276 CATAATGTTTAAATTTTACACGG - Intronic
1055291013 9:74781739-74781761 CAGTAAGTTCGAATTATGAAAGG - Intronic
1055982717 9:82021057-82021079 CAGTATTTTCAGCTTATACTGGG + Intergenic
1056430049 9:86518500-86518522 CAGTATGTTCCAAAAATATATGG + Intergenic
1057680453 9:97176759-97176781 AAATATTTTCAATTTATACAAGG + Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058904648 9:109472269-109472291 CAATTTGTCCAAATTATAAAAGG + Intronic
1058909945 9:109511806-109511828 CACTATCTTAAAATAATACAGGG - Intergenic
1058934836 9:109760186-109760208 CAGTACTTTAAAATTAAACACGG + Intronic
1186389778 X:9147527-9147549 CAATATTTTCAAATCATGCAAGG + Intronic
1186848915 X:13560239-13560261 AAGTATGTTAAAATGATTCAGGG + Intergenic
1188095188 X:26012585-26012607 CAGTAAGTTCACATTTCACATGG - Intergenic
1188309865 X:28603109-28603131 CAGTATGATCCAAATAAACAAGG - Intronic
1188350446 X:29123978-29124000 GAGCATCTTAAAATTATACATGG + Intronic
1188825557 X:34828796-34828818 CAGTGTGTTCATATTTTATATGG - Intergenic
1193593323 X:83417375-83417397 CAGTCTTTTCAACTTACACAAGG - Intergenic
1195409258 X:104551164-104551186 CTGTGTGTTCCAATTCTACAAGG - Intergenic
1195549219 X:106147531-106147553 GAATTTATTCAAATTATACAGGG + Intergenic
1197381144 X:125741743-125741765 CACTATGTTCAAAGAAGACAAGG + Intergenic
1200779581 Y:7202204-7202226 CAGTATCTTCATACTAGACATGG - Intergenic