ID: 1156202651

View in Genome Browser
Species Human (GRCh38)
Location 18:34852272-34852294
Sequence TCTACCACCCAGAAACAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156202646_1156202651 5 Left 1156202646 18:34852244-34852266 CCCTCCTGGGTACTAGGTAGAAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG 0: 1
1: 0
2: 1
3: 20
4: 136
1156202649_1156202651 1 Left 1156202649 18:34852248-34852270 CCTGGGTACTAGGTAGAAGGTGT 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG 0: 1
1: 0
2: 1
3: 20
4: 136
1156202647_1156202651 4 Left 1156202647 18:34852245-34852267 CCTCCTGGGTACTAGGTAGAAGG 0: 1
1: 0
2: 2
3: 5
4: 103
Right 1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG 0: 1
1: 0
2: 1
3: 20
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156202651 Original CRISPR TCTACCACCCAGAAACAGGT AGG Intronic
904664344 1:32108394-32108416 TCTACCTCCCAGGAACACGTGGG - Intronic
911075837 1:93874049-93874071 TATACCACACAGAAACATCTAGG - Intronic
911131389 1:94391944-94391966 TCTGCCACACAGAAAACGGTGGG + Intergenic
912173676 1:107132141-107132163 TCTATCATCCAGAAACATGAAGG + Intergenic
912392661 1:109315294-109315316 TTTCCCACCCAGAAGCAGGTAGG - Intronic
916877278 1:168982895-168982917 TCTGAGACCCAGAAACAGATTGG + Intergenic
919934263 1:202241339-202241361 TCTACCAGCTAGAACCAGATGGG + Intronic
921294483 1:213689166-213689188 TCTAACATCCAGAAAGAGGGAGG - Intergenic
1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG + Intergenic
1063239177 10:4150756-4150778 TCTCCCATTCAGGAACAGGTAGG + Intergenic
1063384897 10:5610015-5610037 TCCCCCACCCAGAAACTGCTGGG + Intergenic
1063963145 10:11323970-11323992 TCCATCACCAAGAAACAGTTTGG - Intronic
1064377754 10:14812295-14812317 TCTGCCACCCAGAAAGGGGTGGG - Intergenic
1064745795 10:18477045-18477067 TCTGCCACACAGAAAAAGGAGGG + Intronic
1066426152 10:35309349-35309371 TCCATCACCCAGAGGCAGGTGGG - Intronic
1072957500 10:99900363-99900385 TCGACCTCCCAGACTCAGGTCGG + Intronic
1074477441 10:113785513-113785535 TCACCCACCTAGAACCAGGTCGG - Intergenic
1077423189 11:2462548-2462570 CCTGCCACTCAGTAACAGGTGGG - Intronic
1078591722 11:12647088-12647110 TATACCAGCAATAAACAGGTGGG + Intergenic
1079646822 11:22874133-22874155 TCTAACACGCAAAACCAGGTAGG - Intergenic
1080105599 11:28508554-28508576 TCTACCACCAAGTATCAGGCAGG + Intergenic
1081740331 11:45435117-45435139 TCTACCTTCCAGTAGCAGGTAGG + Intergenic
1083203334 11:61132875-61132897 TCTTCCACCCAGACACAGAGTGG + Intronic
1086069310 11:82782269-82782291 TCTGCCACCCAGAAAAAGGAGGG - Intergenic
1086700479 11:89896076-89896098 TCTACCGTCCAGAAACATGGTGG - Intergenic
1086705690 11:89948450-89948472 TCTACCGTCCAGAAACATGGTGG + Intergenic
1087781468 11:102305296-102305318 ACTACCAACCAGAAGCAGGGAGG - Intergenic
1088325856 11:108600582-108600604 TCTTCCACCCAGACACTAGTAGG - Intergenic
1088869490 11:113878869-113878891 CGTACCACCCACAAACACGTGGG + Intergenic
1089573579 11:119425452-119425474 TTTCCCACCCAGAAACATATGGG + Intergenic
1090502913 11:127279292-127279314 TCTGCCACCCAGAACCAGAAGGG - Intergenic
1091986413 12:4912619-4912641 TCTACCACCGAGAAACTGAGGGG + Exonic
1093890775 12:24517735-24517757 TTTACAACTCAGCAACAGGTAGG + Intergenic
1098736935 12:74117024-74117046 TCTATTACCCAGAAAAAGATGGG - Intergenic
1105285389 13:18999167-18999189 TCTAACACCCAGAACCATGCTGG - Intergenic
1107404734 13:40101903-40101925 TCCACCACCCAGGCACAGGTGGG - Intergenic
1115342585 14:32308123-32308145 TCTTCCAGGCTGAAACAGGTTGG - Intergenic
1117844663 14:59897964-59897986 AATTCCACCTAGAAACAGGTGGG - Intergenic
1120046215 14:79809487-79809509 TCTAGTTCCCAGAAAAAGGTAGG - Intronic
1122540462 14:102495238-102495260 TCTGACAGCCAGAATCAGGTGGG + Intronic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1130712886 15:86301186-86301208 TGTACCTCCCAGAGACATGTGGG + Intronic
1131046230 15:89317965-89317987 TCTGCCACTCAGAACCAGTTTGG - Intronic
1132220705 15:100103021-100103043 TCTGTCATCCAGAAAGAGGTGGG + Intronic
1135085993 16:19474928-19474950 TCCACCACCCAAACAAAGGTGGG + Intronic
1142811205 17:2396445-2396467 TCTCTCACCCAGAACCAGGCAGG - Intronic
1144258450 17:13493676-13493698 TCTACCTCTAAGAAACAGGAAGG + Intergenic
1144555848 17:16282205-16282227 TCTCACACCCAGAAAAAGGGAGG - Intronic
1148836153 17:50466943-50466965 CCTTCCACCCAGACAAAGGTTGG + Intronic
1150380402 17:64715647-64715669 TCCACCACCCAGAAGCAGCTGGG + Intergenic
1153721736 18:7910767-7910789 TCTGCCACCCAGAAAAAGTTGGG + Intronic
1153792945 18:8596301-8596323 TCGACCACCCAGGCTCAGGTGGG + Intergenic
1155682565 18:28506879-28506901 GGTACAACCCAGAAACAAGTAGG - Intergenic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1161308745 19:3582024-3582046 TCAACCACAAAGAAACAGCTGGG - Intergenic
925841201 2:7994147-7994169 GATACCACCCAGAAACAGCCAGG + Intergenic
925987914 2:9230999-9231021 TCTCCCCGCCAGAAACAGGCAGG - Intronic
929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG + Intergenic
938224478 2:129604161-129604183 TCTACCCCCCAAAATCAGGCTGG + Intergenic
939156063 2:138525390-138525412 TGTACCACCCTGATACAGTTTGG - Intronic
944919805 2:204400939-204400961 TCTATCACCAAGAAAGAGATAGG - Intergenic
945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG + Intergenic
948384752 2:237574599-237574621 CCAACCCCCCAGAAGCAGGTGGG + Exonic
948421517 2:237863269-237863291 TTTGCCACCAAGAAACTGGTGGG - Intronic
948943261 2:241206662-241206684 GCTCCCAGCCAGACACAGGTGGG + Intronic
1168872859 20:1145836-1145858 TCTGCCAACCAAAACCAGGTTGG - Intronic
1170761807 20:19257624-19257646 TCCAGCACCCAGAAAAAGGTAGG - Intronic
1171120273 20:22562566-22562588 GCCACCACCCAGAGACAGCTTGG - Intergenic
1171494188 20:25543599-25543621 TCTACCACGCAGAAAAGGTTGGG - Intronic
1179336424 21:40460624-40460646 TCAACCACCCAAAAACATGATGG + Intronic
1181847363 22:25722446-25722468 TCTAGCACCCAGAAACAGGGAGG + Exonic
1183346739 22:37312280-37312302 TTTGCCAGCCAGAAACAGGAGGG - Intronic
1183734448 22:39636121-39636143 TTTACCACCCAGAGGCAGGCTGG + Intronic
1184586438 22:45451232-45451254 TCTTCCACCCAGAAACACATTGG + Intergenic
1185277213 22:49954976-49954998 TCTCCCACCCAGAGCCAGGCCGG - Intergenic
1185381467 22:50509859-50509881 TCTTCCACCAAGAAAAAGCTTGG - Intronic
1185388137 22:50545889-50545911 TCTACCAGGCAGAAGCAGGTTGG + Intergenic
1185402174 22:50624898-50624920 TCACCCAGCCAGAAAGAGGTTGG - Intronic
950706760 3:14787626-14787648 TCTGTCACCTAGAAACATGTTGG + Intergenic
951778468 3:26336778-26336800 TCTATCAACCAGAAAAAGGTTGG - Intergenic
953669021 3:44947104-44947126 TCCACCACCCAATAACAAGTTGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955952249 3:64254062-64254084 TCTACCACCAAGCAAGAGGAAGG - Intronic
956038200 3:65118362-65118384 TCTATAGCCCAGACACAGGTAGG + Intergenic
957495581 3:80987310-80987332 TCTACCAACCAGAAAAAGCCTGG + Intergenic
961871038 3:129988438-129988460 TCCACCGCCCAGACACAGGCAGG - Intergenic
962810436 3:138955036-138955058 TGTAGCATCCAGAAACAGGCTGG - Intergenic
964057178 3:152475657-152475679 TCTTCAACCCAGTAACAGTTGGG + Intergenic
964588194 3:158330484-158330506 CCTACCATCCAGAAAATGGTAGG - Intronic
967269373 3:187720210-187720232 ACTGCCACCCAGGAACAGGAAGG + Intronic
967566970 3:190984870-190984892 TCCACCACCCACCATCAGGTAGG + Intergenic
968637929 4:1691948-1691970 CCTACCACCCTGAAAGAGCTGGG + Intergenic
969870919 4:10104154-10104176 TCTATCACCCAGAGATAGGTAGG - Intronic
974087776 4:57279487-57279509 TCTACGAACCAGGAACAGTTTGG + Intergenic
974238169 4:59208265-59208287 TCTACAAGCCAGAAGCAAGTGGG + Intergenic
978751987 4:112260094-112260116 TCTAGCAGCCTGAAACAGGAAGG + Intronic
978997406 4:115173526-115173548 TCTACAACCCAGAAGAAAGTGGG + Intergenic
980927377 4:139151423-139151445 TCTCCCACCCCCAAAAAGGTGGG + Intronic
983138578 4:164118967-164118989 TCTCCCACCAAGAAACAAGTGGG + Intronic
983387160 4:167079901-167079923 CCTCCCACCCTGAAACTGGTAGG - Intronic
983643308 4:169964186-169964208 TCAACTACCCAGATACATGTGGG - Intergenic
984896928 4:184549196-184549218 GATTCCACCCAGAAAGAGGTGGG + Intergenic
985544295 5:501409-501431 TCTGCCTCCCAGAAACAGCCTGG + Intronic
986166812 5:5280069-5280091 TCTACCACTCAGACACTGGAAGG - Intronic
987691021 5:21267057-21267079 TCTACCAACCAAAAAAAGGCCGG + Intergenic
989392487 5:40915785-40915807 TCTAACAGCCAGAAGCAGGCAGG + Intronic
989646593 5:43640184-43640206 TCTACACCCCAGAGACAGCTTGG - Intronic
991130438 5:63116628-63116650 TCTACCACCATAAAACAAGTAGG - Intergenic
992621964 5:78602853-78602875 ACTACCACCCACAATGAGGTAGG + Intronic
992677069 5:79115882-79115904 TGGAGCACCCAGAAGCAGGTTGG + Exonic
993516481 5:88842245-88842267 TGTAGCACCCAAATACAGGTAGG - Intronic
996109586 5:119549571-119549593 TCTGCCACGCAGAAAAAGGCGGG - Intronic
996307745 5:122069342-122069364 TCTAGCACCCAGCAACACTTGGG + Intronic
1001778395 5:174346486-174346508 TCTCCCACCCTTAAACTGGTTGG - Intergenic
1001808796 5:174611073-174611095 ATTACCACCGTGAAACAGGTGGG + Intergenic
1002667361 5:180834981-180835003 TCTGCAAACCAGAAGCAGGTGGG + Intergenic
1003482301 6:6545486-6545508 TTAACCACCCACACACAGGTGGG - Intergenic
1003517973 6:6833645-6833667 TCTACCATCCTGGAACATGTAGG + Intergenic
1007772288 6:44201466-44201488 TCAACCTCCCACAAACAGGAAGG + Intergenic
1009539598 6:64936267-64936289 TCAACAAACCAGAAACAGGAGGG + Intronic
1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG + Intronic
1020725222 7:11804604-11804626 TTTATCAGCCATAAACAGGTTGG - Intronic
1020803287 7:12758347-12758369 TCTCCCACCCAGAAACCTGAAGG + Intergenic
1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG + Intergenic
1023152722 7:37216945-37216967 TCTTCCTTCCAGAAAAAGGTGGG + Intronic
1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG + Intergenic
1025283995 7:57648163-57648185 CCTATCATCCAGAAATAGGTTGG + Intergenic
1031413489 7:121467948-121467970 TCTACCACCCAAATATAGGACGG - Intergenic
1033362383 7:140646890-140646912 TCTCCCACCTAGACACAGCTGGG + Intronic
1035993834 8:4523082-4523104 ACTACCACCCACCAAAAGGTTGG - Intronic
1036091078 8:5666032-5666054 TCTACTTCCCAGAAACAGTAAGG - Intergenic
1037832984 8:22199907-22199929 TCTCCAACCCAGGATCAGGTAGG - Intronic
1038259192 8:25978541-25978563 TTTAGCTCCCAGAAACAGCTTGG - Intronic
1041179796 8:55235766-55235788 TCTATCACCCAGGATCAGGCTGG - Intronic
1042610900 8:70600014-70600036 TCACCCTCCCAGCAACAGGTAGG - Exonic
1043740675 8:83807812-83807834 GTTACCACACAGAAACAGGAGGG + Intergenic
1044174864 8:89107464-89107486 TCCCCAACCCAGAAAAAGGTAGG + Intergenic
1047704564 8:127484613-127484635 GCTACCACCCAGGAATAGGAAGG + Intergenic
1047846800 8:128814980-128815002 TCTGCCACTCAGAGACAGGCTGG + Intergenic
1047891461 8:129316110-129316132 TCTTCCACTCAGGAACAGCTGGG - Intergenic
1049206115 8:141364408-141364430 TCTTCCACCAAGAGGCAGGTGGG + Intronic
1052396360 9:27943491-27943513 TCTCCCTTCCAGAAGCAGGTGGG - Intergenic
1052592792 9:30520210-30520232 TCTCACACCCAGAAACAGTTCGG - Intergenic
1053729124 9:41034597-41034619 TCCACCACCCATAAACAGGGTGG - Intergenic
1054161609 9:61675261-61675283 CCTATCAAGCAGAAACAGGTTGG + Intergenic
1054699392 9:68397486-68397508 TCCATCACCCATAAACAGGGTGG + Intronic
1056410689 9:86323506-86323528 TATACCATCCAGAAACAGGAAGG - Exonic
1060998912 9:127891252-127891274 TCTGCCTTCAAGAAACAGGTGGG + Intronic
1061542752 9:131287130-131287152 TATAGCACCCAGATACAGGGAGG - Intergenic
1061675245 9:132211872-132211894 ACCAGCACCCAGAACCAGGTAGG + Intronic
1062084263 9:134640905-134640927 CCTACCACCCAGAGACTGGCGGG + Intergenic
1187262737 X:17702256-17702278 ACAACCACCCTGAAAGAGGTGGG + Intronic
1188535377 X:31190902-31190924 TCTACAACACAGAAACTGGGAGG + Intronic
1189761716 X:44328585-44328607 TCTGCCATGCAGAAAAAGGTGGG - Intronic
1195022144 X:100839825-100839847 TCTACTATCCAGAAACAGTAAGG - Intronic
1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG + Intronic
1198703085 X:139418041-139418063 TCTTACTTCCAGAAACAGGTAGG + Intergenic
1201526313 Y:14938397-14938419 TGTACCACCCAGAAAGAGGAGGG - Intergenic