ID: 1156204449

View in Genome Browser
Species Human (GRCh38)
Location 18:34870913-34870935
Sequence CATTGTGTATAGAGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156204449_1156204451 -9 Left 1156204449 18:34870913-34870935 CCCACAACACTCTATACACAATG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1156204451 18:34870927-34870949 TACACAATGAGCACTTTAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156204449 Original CRISPR CATTGTGTATAGAGTGTTGT GGG (reversed) Intronic
902908937 1:19580794-19580816 CATTGAGAATAGAATGTTGGGGG - Intergenic
905821156 1:40992444-40992466 CCTGGTGTCTAGGGTGTTGTAGG + Intronic
910937374 1:92495470-92495492 CAATGTATATTGAGTGTTATGGG - Intergenic
910978240 1:92930899-92930921 AAGTGTGTATAGAGTGTTACAGG - Intronic
911195499 1:94990532-94990554 CATTGTGTATACAGCATTTTGGG + Intronic
911940960 1:104047158-104047180 CATTGTGTATAGTATCTTGCAGG + Intergenic
912005833 1:104899989-104900011 CATTTGTTATAGAGTGTTATGGG - Intergenic
913561387 1:120024118-120024140 CATTGTGTATATAGTTTTTCTGG - Intronic
913636740 1:120769484-120769506 CATTGTGTATATAGTTTTTCTGG + Intergenic
914543001 1:148634234-148634256 CATTGTGTATATAGTTTTTCTGG - Intronic
914623621 1:149436778-149436800 CATTGTGTATATAGTTTTTCTGG + Intergenic
916335792 1:163669919-163669941 CATTGTTTATAGAGAGATTTGGG - Intergenic
916709992 1:167396274-167396296 TATTGTGTGTAGGGTGATGTTGG + Exonic
918444630 1:184605000-184605022 TATTGAGTTCAGAGTGTTGTTGG - Intronic
919394892 1:197033708-197033730 CATAGTGTATATATTGTTGTAGG - Intergenic
924079114 1:240374142-240374164 CATGGTTTATTGAGTGTTTTAGG - Intronic
924488056 1:244506643-244506665 GATTGTGTATAGATTATTTTGGG + Intronic
924700917 1:246451266-246451288 CATTGTTTATAAAATGCTGTTGG - Intronic
1063055476 10:2499845-2499867 CATTGTGTTTAAACTGTGGTAGG - Intergenic
1064323130 10:14324510-14324532 CATTCTGTATACAGTGGTTTAGG + Intronic
1065466567 10:26030406-26030428 CATGGTCAAGAGAGTGTTGTGGG - Intronic
1065479382 10:26177216-26177238 CCTTGAGTATAGAGTGTGGAAGG + Intronic
1068433746 10:56964643-56964665 CATTTTGTATAGAGTAATGCAGG - Intergenic
1075005889 10:118829935-118829957 CAGTGTGTCTAGAGTGTGTTGGG - Intergenic
1076062049 10:127420521-127420543 CACTGTGTAAAGAGAGTTGAGGG + Intronic
1078763965 11:14275742-14275764 CATTGTGTATTTTATGTTGTTGG - Intergenic
1079266235 11:18935650-18935672 CATTTTGTACACAGTGTTTTGGG + Intronic
1082765076 11:57161183-57161205 CATTTAGTATAGAGGGTTTTGGG - Intergenic
1085129723 11:74027985-74028007 AAATGTGTATTGAGTGCTGTGGG - Intronic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1088996820 11:115007733-115007755 CATTGTATATAGACTTTTGTAGG - Intergenic
1089642598 11:119857628-119857650 CATTTTGTATAAAGAATTGTGGG + Intergenic
1091150652 11:133325448-133325470 CAGTGGGAATAGAGTTTTGTTGG - Intronic
1097746328 12:63307652-63307674 GATTGTTTATAAAGTGTTTTTGG + Intergenic
1100181323 12:92089142-92089164 AATTATGTATAGAGTGATTTAGG + Intronic
1100795039 12:98173081-98173103 AATTGTTTATACAGTATTGTGGG - Intergenic
1102651710 12:114447230-114447252 GATTCTGTATACAGTGTTGCAGG + Intergenic
1106148558 13:27074884-27074906 GTGTGTGTATAGAGGGTTGTTGG - Intronic
1107537086 13:41346151-41346173 CATTTTGTATATGGTGTGGTAGG + Intronic
1107915259 13:45143559-45143581 CATTGTGTCTAATGTGGTGTGGG + Intronic
1108557135 13:51604766-51604788 CATTGTGGATAGAGTGTCAGGGG + Intronic
1110825966 13:79972610-79972632 CATTTTGTATAGTGTCTTGCAGG + Intergenic
1110884005 13:80609750-80609772 CAGTGTCTATAGAGTATTGAGGG + Intergenic
1116216247 14:42021168-42021190 CATTGTGTATTCTATGTTGTGGG - Intergenic
1118925602 14:70188149-70188171 CATTGTGTATGCAGTGTTGGGGG - Intronic
1120551103 14:85874069-85874091 CATAGTGCAAAGAGTGTTGTTGG + Intergenic
1123799937 15:23809070-23809092 CTTTATGTACAGAGTGATGTTGG + Intergenic
1125087213 15:35744515-35744537 AATAGTATATAGAGTGTTCTAGG - Intergenic
1129138000 15:73571468-73571490 GCGTGTGTATAGAGTGCTGTAGG + Intronic
1129968092 15:79754641-79754663 CATGGGGTATAGGGTTTTGTGGG - Intergenic
1131585322 15:93686647-93686669 CATTGTTTGTAGATTGTTTTGGG - Intergenic
1132976667 16:2714428-2714450 CATTGTGCAGAGAGAGGTGTGGG - Intronic
1133142282 16:3755330-3755352 CACTGTCTCTAAAGTGTTGTGGG - Intronic
1142106699 16:88308005-88308027 CATTGTGTATGGTGTGAGGTAGG + Intergenic
1148534584 17:48429344-48429366 CAGTGTGTGTTGAGTGTTGACGG + Intronic
1151873764 17:76854413-76854435 TGTTGGGTATAGAGTTTTGTGGG - Intergenic
1153085154 18:1277761-1277783 CACTATGTATAGACTTTTGTGGG - Intergenic
1156204449 18:34870913-34870935 CATTGTGTATAGAGTGTTGTGGG - Intronic
1157373935 18:47145593-47145615 TGTTGTGTATAGTGTGATGTGGG - Intronic
1157935907 18:51872894-51872916 CATTTTGTATAGTGTTTTGCAGG + Intergenic
1159683593 18:71387371-71387393 AAATGTTTATAGAGTTTTGTGGG - Intergenic
1160282225 18:77501990-77502012 CATGGTGTAGACAGTGTTGTTGG + Intergenic
1160467515 18:79093995-79094017 CATTTTGAATATTGTGTTGTGGG + Intronic
1164949561 19:32325776-32325798 CATTGTGTATAGTGTGCTTAGGG + Intergenic
1165478049 19:36043421-36043443 CAATGGGGATAGAGTGTTTTAGG + Intronic
925624808 2:5832152-5832174 CATTGTGTATGGAGTATGTTGGG - Intergenic
926997224 2:18749130-18749152 CATTGTATATAACATGTTGTTGG + Intergenic
928902714 2:36337845-36337867 CATAGTGTATAAAGTGCTGCTGG + Intergenic
931152423 2:59589212-59589234 CTATGTTTATAGGGTGTTGTAGG - Intergenic
933261645 2:80137850-80137872 TATTGTGAATAGAGTGTCTTGGG + Intronic
936003698 2:108862323-108862345 CATTGTGTTTACAGTGCTCTAGG + Intronic
937604513 2:123781559-123781581 AATTTTGTATAAATTGTTGTGGG - Intergenic
944239815 2:197475496-197475518 CACTGGGTATAGAGTGATGAAGG + Intergenic
946047617 2:216834237-216834259 CATTGTGTTTGGTGTGTGGTAGG - Intergenic
948147681 2:235720292-235720314 CTTTAGGTATAGAGTGTTGTGGG + Intronic
1176662035 21:9646073-9646095 CAATGGGTATAGAGTTTTATAGG - Intergenic
1179398761 21:41064857-41064879 CGTTGTGTCTAGAGGGCTGTGGG + Intergenic
1179724125 21:43332322-43332344 CATTGTGTCTACAGTGCTGTCGG - Intergenic
1184312810 22:43659044-43659066 CATTGTGTTTTGACTGCTGTCGG - Intronic
949301343 3:2587354-2587376 TATTCTGTATAGAATTTTGTTGG + Intronic
957357813 3:79114750-79114772 CATTGTGTATGTAGTATTTTTGG + Intronic
957599183 3:82310445-82310467 TATTGTTTATAAAGTTTTGTAGG - Intergenic
959387279 3:105726227-105726249 CCATATGTAGAGAGTGTTGTTGG - Intronic
959425800 3:106186537-106186559 CATTGTGTGTAGGGGGTTGGAGG - Intergenic
959991044 3:112632659-112632681 CACTGTGTATAGAGCTATGTGGG - Intronic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
964254085 3:154755049-154755071 CATTGTGTGAAGAATGTGGTAGG - Intergenic
965448230 3:168802769-168802791 TTATGTGTATAGAGTGTTGATGG + Intergenic
967618760 3:191605892-191605914 AATTGGATATAAAGTGTTGTTGG - Intergenic
969648217 4:8446351-8446373 CATTGTGAATAGAGTGCTGGGGG + Intronic
970832366 4:20356458-20356480 CATTATGAATAGAGTGTGTTAGG - Intronic
973842645 4:54877858-54877880 AATTGTGTATACAGTGATGGAGG - Intergenic
974749681 4:66120823-66120845 CATTGTGTAAAGTGTTTTGATGG + Intergenic
974922087 4:68254349-68254371 CACTGTGAATAAAGTGTTGCAGG + Intergenic
975908537 4:79243971-79243993 CAGTGTGTTTAGAGAGTTATAGG + Intronic
976544907 4:86323569-86323591 GATTTTGTATAGACTGCTGTAGG - Intronic
976773996 4:88686933-88686955 CATAGTGTCTTGAGTGTTATAGG + Intronic
978975292 4:114862224-114862246 GATTATGTATGGTGTGTTGTAGG - Intronic
979134639 4:117094739-117094761 CATTGTGTATGGGGTTTTGAAGG - Intergenic
982710553 4:158754534-158754556 AATTGTGTACAAAGTATTGTAGG - Intergenic
983691708 4:170477890-170477912 CATTATGTTTAAAGTGATGTGGG + Intergenic
983777345 4:171624619-171624641 CATGGTGTATAGACTGTTGATGG - Intergenic
986091840 5:4516225-4516247 CACTGTGTTTAAAGTGTTCTTGG - Intergenic
986230531 5:5860657-5860679 GAATGTGTATAAAGTGTTGTAGG - Intergenic
986280625 5:6319206-6319228 CAGTGTGCATTGAGTGTTGAGGG - Intergenic
992085922 5:73278336-73278358 CCTTGTGTGTAGAATGTTGTTGG + Intergenic
994357718 5:98812729-98812751 CATAGTGAACATAGTGTTGTTGG - Intergenic
996169031 5:120265453-120265475 TATTCTCTCTAGAGTGTTGTGGG + Intergenic
1000878583 5:166670308-166670330 TATTGCATATAGAGTGTTGATGG + Intergenic
1002797199 6:483258-483280 CATTGTGGATAAAGTGGTCTTGG + Intergenic
1004980834 6:21021905-21021927 CATTGTCTTTGAAGTGTTGTTGG + Intronic
1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG + Intergenic
1007493254 6:42240803-42240825 CAATGTGTATGTAGTGCTGTGGG - Intronic
1008455738 6:51708690-51708712 CATTGTATAGAAAGAGTTGTTGG - Intronic
1010749755 6:79604680-79604702 CATTGTGTGTTGAGTGTGTTGGG + Intergenic
1010824142 6:80452203-80452225 CATTGGCTATAGTGTGTCGTAGG + Intergenic
1012444444 6:99293646-99293668 CACTGTGTATAGAGCATTATGGG - Intronic
1013513768 6:110867112-110867134 AATTGTTTAGAAAGTGTTGTTGG - Intronic
1015898058 6:138035879-138035901 CATTATGAATAGATTGTTTTTGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017552931 6:155529434-155529456 CTCTGTGTACAGAGTGTTCTAGG - Intergenic
1018150653 6:160934355-160934377 CATGGTGTATGGTGTGTTGTGGG - Intergenic
1020657531 7:10945146-10945168 CATTGTATTTTGGGTGTTGTGGG + Intergenic
1020921189 7:14266656-14266678 CATTTTATTTTGAGTGTTGTTGG - Intronic
1022369140 7:29753977-29753999 CCTTTTGAATATAGTGTTGTTGG - Intergenic
1023031788 7:36096037-36096059 CATTGTGTATACAGCATTCTAGG - Intergenic
1023130058 7:36993847-36993869 CATTGTGTGGAGAGAATTGTAGG - Intronic
1026439289 7:70429877-70429899 CATTGTGTTGAGAGAGTGGTTGG + Intronic
1028935966 7:96464493-96464515 CCTTGTGTTTAGATTGTTGTTGG - Intergenic
1031040883 7:116837460-116837482 CCTTATGTATAAAGTGTGGTAGG + Intronic
1031734485 7:125340615-125340637 CACAGTGTATAGATTTTTGTAGG + Intergenic
1033647742 7:143318175-143318197 CATGGTGTGTAGAGTGGTGAGGG - Intronic
1036401654 8:8414021-8414043 CATTGTGTCTATAGCATTGTGGG - Intergenic
1040506614 8:48054484-48054506 ATGTGTGTATAGAGGGTTGTGGG + Intronic
1041875912 8:62686689-62686711 AATTGAGTTGAGAGTGTTGTGGG - Intronic
1045601138 8:103718391-103718413 CATTGTGTATTGGGTGTATTGGG + Intronic
1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG + Intergenic
1050823005 9:9906342-9906364 AATTGAGTATAGAGTGAAGTTGG - Intronic
1052074637 9:24125943-24125965 CATTGTATCTAGTGTGTTATAGG + Intergenic
1054842371 9:69757107-69757129 CACTGTTTATGAAGTGTTGTGGG - Intronic
1057876513 9:98759302-98759324 CATTCTGTGTTGATTGTTGTGGG - Intronic
1058462358 9:105195008-105195030 CGTTGGGAATGGAGTGTTGTTGG - Intergenic
1059702183 9:116785966-116785988 CATTTTGTATAGGGTCCTGTGGG - Intronic
1203639596 Un_KI270750v1:147916-147938 CAATGGGTATAGAGTTTTATAGG - Intergenic
1188841630 X:35024539-35024561 CATTTTTTATAGAGTGGGGTGGG - Intergenic
1192099587 X:68249969-68249991 AATTTTGTATATAGTGTTGAAGG - Intronic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1195735288 X:108006710-108006732 GAATGTGTATACACTGTTGTTGG + Intergenic
1195941380 X:110170576-110170598 CATGGTTTATAGGATGTTGTGGG - Intronic
1197043441 X:121968484-121968506 AATTGTCTAGAGAGTATTGTGGG - Intergenic
1197385066 X:125792068-125792090 CTTTGTATATACAATGTTGTGGG - Intergenic
1198511574 X:137357108-137357130 CATTGTGTAAAAAGTTTTGATGG + Intergenic