ID: 1156205569

View in Genome Browser
Species Human (GRCh38)
Location 18:34882450-34882472
Sequence CACTTAAATCAGGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26194
Summary {0: 1, 1: 1, 2: 113, 3: 2755, 4: 23324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156205569_1156205574 8 Left 1156205569 18:34882450-34882472 CCTCCGTCTCCCTGATTTAAGTG 0: 1
1: 1
2: 113
3: 2755
4: 23324
Right 1156205574 18:34882481-34882503 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1156205569_1156205576 9 Left 1156205569 18:34882450-34882472 CCTCCGTCTCCCTGATTTAAGTG 0: 1
1: 1
2: 113
3: 2755
4: 23324
Right 1156205576 18:34882482-34882504 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1156205569_1156205578 16 Left 1156205569 18:34882450-34882472 CCTCCGTCTCCCTGATTTAAGTG 0: 1
1: 1
2: 113
3: 2755
4: 23324
Right 1156205578 18:34882489-34882511 CTCCCGAGTAGCTGGGACTACGG 0: 749
1: 3121
2: 5340
3: 4432
4: 3456
1156205569_1156205579 17 Left 1156205569 18:34882450-34882472 CCTCCGTCTCCCTGATTTAAGTG 0: 1
1: 1
2: 113
3: 2755
4: 23324
Right 1156205579 18:34882490-34882512 TCCCGAGTAGCTGGGACTACGGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156205569 Original CRISPR CACTTAAATCAGGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr