ID: 1156210692

View in Genome Browser
Species Human (GRCh38)
Location 18:34938339-34938361
Sequence CTCATGGACATGTGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156210692_1156210697 9 Left 1156210692 18:34938339-34938361 CCCACTCTGCACATGTCCATGAG No data
Right 1156210697 18:34938371-34938393 AACACTGCAAGTATTAATCTGGG No data
1156210692_1156210696 8 Left 1156210692 18:34938339-34938361 CCCACTCTGCACATGTCCATGAG No data
Right 1156210696 18:34938370-34938392 AAACACTGCAAGTATTAATCTGG No data
1156210692_1156210698 10 Left 1156210692 18:34938339-34938361 CCCACTCTGCACATGTCCATGAG No data
Right 1156210698 18:34938372-34938394 ACACTGCAAGTATTAATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156210692 Original CRISPR CTCATGGACATGTGCAGAGT GGG (reversed) Intergenic
No off target data available for this crispr