ID: 1156212497

View in Genome Browser
Species Human (GRCh38)
Location 18:34960406-34960428
Sequence TGTTAGTTAGATGGCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156212497_1156212500 8 Left 1156212497 18:34960406-34960428 CCCACAAAGCCATCTAACTAACA No data
Right 1156212500 18:34960437-34960459 GTACCTACTATGTAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156212497 Original CRISPR TGTTAGTTAGATGGCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr