ID: 1156215098

View in Genome Browser
Species Human (GRCh38)
Location 18:34989929-34989951
Sequence CTAACTCACCCCATTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156215098_1156215105 17 Left 1156215098 18:34989929-34989951 CCCATCTCAATGGGGTGAGTTAG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1156215105 18:34989969-34989991 TGCTTTTCATCCCCCTTGCATGG 0: 1
1: 0
2: 0
3: 15
4: 159
1156215098_1156215102 -8 Left 1156215098 18:34989929-34989951 CCCATCTCAATGGGGTGAGTTAG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1156215102 18:34989944-34989966 TGAGTTAGGTGGCCCATATTTGG 0: 1
1: 0
2: 0
3: 1
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156215098 Original CRISPR CTAACTCACCCCATTGAGAT GGG (reversed) Intronic
903496524 1:23771693-23771715 TTCACCCACCCAATTGAGATAGG + Intergenic
907591853 1:55681510-55681532 CTATCTCACGCCAGTGAGAATGG - Intergenic
910393090 1:86764244-86764266 CTAACTCACACCATGTAGGTAGG + Intergenic
910625391 1:89301866-89301888 CTACCTCACCCCAGTTAGAATGG - Intergenic
911121070 1:94297099-94297121 CTCACTCACCCCTTTGACACTGG - Intergenic
911220597 1:95241350-95241372 CTACATCACCCCATTGAACTTGG - Intronic
911467415 1:98273117-98273139 CTATCTCACGCCAGTGAGAATGG + Intergenic
912314398 1:108653619-108653641 ATATCTCACCCCATTTAGAATGG - Intronic
912497512 1:110101049-110101071 CTAACTCACAGAATCGAGATGGG - Intergenic
916633537 1:166642463-166642485 CTATCTCACCCCAGTCAGAATGG + Intergenic
918634631 1:186760405-186760427 CTAACTCATGCCACTGAGGTGGG + Intergenic
918813614 1:189152856-189152878 CTATCTCACACCAGTCAGATTGG - Intergenic
1063756720 10:9019162-9019184 ATAATTCTCCCCATTGAAATTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1067209430 10:44246839-44246861 CTATCTCACACCAGTTAGATTGG - Intergenic
1070903936 10:80055161-80055183 CCATCTCACCCCATTAGGATAGG + Intergenic
1077284779 11:1760796-1760818 CGAACTGACCCCATAGAGCTGGG + Intronic
1082677857 11:56130738-56130760 CCATCTCACCCCAGTGAGAATGG + Intergenic
1086767695 11:90718562-90718584 TTAACTCATTCCACTGAGATTGG + Intergenic
1087025780 11:93648238-93648260 CTAACTCATCCCATTTATACTGG + Intergenic
1092580945 12:9840754-9840776 CTAACTCACACCAGTCAGAATGG + Intronic
1098185532 12:67892365-67892387 CTAGGTCACCCCACTGAGACAGG - Intergenic
1101288326 12:103339645-103339667 CTATCTCACACCAGTGAGAATGG + Intronic
1109621560 13:64914112-64914134 CTATCTCACACCATTCAGAACGG + Intergenic
1109626718 13:64983364-64983386 CTGGCTCACCTCATTGAGACTGG - Intergenic
1111185803 13:84734429-84734451 CTATCTCACACCATTCAGAGTGG - Intergenic
1111276776 13:85959058-85959080 CTACCTCACACCAGTGAGAATGG - Intergenic
1116089620 14:40288285-40288307 CTATCTCACACCATTCAGAATGG - Intergenic
1116269063 14:42737370-42737392 CTAACTCTCCACTTTGTGATAGG + Intergenic
1120576081 14:86182634-86182656 CCATCTCACCCCAGTGAGAATGG - Intergenic
1122200297 14:100118598-100118620 CTCACTCTCCCCAGTGAGAAGGG + Intronic
1123737223 15:23197078-23197100 CTATCTCACACCATTCAGAATGG + Intergenic
1124288440 15:28425740-28425762 CTATCTCACACCATTCAGAATGG + Intergenic
1124294785 15:28491574-28491596 CTATCTCACACCATTCAGAATGG - Intergenic
1126880193 15:53086034-53086056 CTATCTCACACCAGTGAGAATGG - Intergenic
1137033860 16:35552098-35552120 GTACCTCACCCCATTTAGAATGG + Intergenic
1144640906 17:16935969-16935991 CTCACTGCCCCCTTTGAGATGGG - Intronic
1149440565 17:56670334-56670356 CTTCCTCACACCATGGAGATTGG + Intergenic
1156215098 18:34989929-34989951 CTAACTCACCCCATTGAGATGGG - Intronic
1159733536 18:72063293-72063315 CTAATTCAGCACATTGACATTGG - Intergenic
1163803714 19:19383909-19383931 CTAACTCACCGCATTGTCCTAGG + Intergenic
1165385054 19:35505429-35505451 CTCACTTTCCCCTTTGAGATGGG - Intronic
926705686 2:15835859-15835881 CCAACTCATCCCATTCAGATTGG - Intergenic
932203546 2:69856160-69856182 CTAATTCACATTATTGAGATAGG + Intronic
934162598 2:89266384-89266406 CTATCTCACACCAGTGAGAATGG - Intergenic
934204675 2:89916140-89916162 CTATCTCACACCAGTGAGAATGG + Intergenic
935373561 2:102372773-102372795 CTAACTAATCCCATTGTTATTGG + Intronic
938107499 2:128543344-128543366 CTAAGTCACCTCACTGAGACAGG - Intergenic
939937859 2:148313981-148314003 CCAACTTACCACATTGAGATTGG - Intronic
946287843 2:218718741-218718763 CAAAATCACCCCATAAAGATTGG + Intronic
946451672 2:219785198-219785220 CTTTCTCACCCCATTGATGTTGG + Intergenic
946790306 2:223293964-223293986 CCAGCTCATCTCATTGAGATTGG - Intergenic
946908774 2:224441176-224441198 CTGACTCACCCAAGTGAGAAGGG + Intergenic
948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG + Intronic
1177582828 21:23049785-23049807 CTCACTCACTCCAGTGAGAATGG + Intergenic
1179206438 21:39284614-39284636 CTACCTCACCCCAGTCAGAATGG - Intronic
950290388 3:11779388-11779410 CTCACTCACTCCAGTGAGAATGG + Intergenic
953249840 3:41235013-41235035 TTAAGTCACCTCATGGAGATGGG - Intronic
953523375 3:43664831-43664853 CTATCTCACCCCAGTTAGAATGG + Intronic
954201947 3:49028664-49028686 CTAACTCACCAGATTGGGCTTGG - Intronic
955547725 3:60049075-60049097 CTACCTCACCCTATAGACATAGG + Intronic
955909129 3:63842265-63842287 CTAGCTCACCCCACTGAGAGAGG + Intronic
960734839 3:120767532-120767554 CTATCGCACCCCATGGAAATTGG + Intronic
961926044 3:130481733-130481755 CTATCTCACGCCAGTTAGATTGG - Intronic
962322217 3:134400884-134400906 CCATCTCACCCCATTTAGAATGG + Intergenic
965113893 3:164462567-164462589 CTATCTCACACCAGTGAGAATGG - Intergenic
965421116 3:168459611-168459633 TTAAGTCATCCCAGTGAGATGGG + Intergenic
966076985 3:175948435-175948457 CTAACTCACACCAGTCAGAATGG + Intergenic
971760811 4:30762890-30762912 TTTACTCACTCCAATGAGATGGG + Intronic
972756056 4:42047532-42047554 CTATCTCACGCCAGTTAGATTGG + Intronic
974728976 4:65836527-65836549 CTATCTCACACCATTTAGAATGG - Intergenic
974969049 4:68802800-68802822 CTGACTCAGATCATTGAGATTGG + Intergenic
975004597 4:69269806-69269828 CTGACTCACATCATGGAGATTGG + Intergenic
981079901 4:140629127-140629149 CTCACACACCCCAGTGAGACAGG + Intronic
984428064 4:179613550-179613572 CTATCTCACTCCATTTAGAATGG + Intergenic
987490056 5:18568475-18568497 CTATCTCACCCCAGTTAGAATGG - Intergenic
992437587 5:76770160-76770182 CTATCTCACCCCAGTCAGAATGG + Intergenic
994511136 5:100705108-100705130 CTATCTCACCCCAGTTAGAATGG + Intergenic
998405863 5:141874425-141874447 CTACCTCCCCCCAGTGACATGGG + Intronic
1004513508 6:16302396-16302418 CTAACTCACCCAGTTTAGTTTGG - Exonic
1006841161 6:37028578-37028600 CCAACTCAGCCCATTTAAATCGG - Exonic
1008411739 6:51188352-51188374 CTATCTCACCCCAGTTAGAATGG - Intergenic
1012410463 6:98949890-98949912 ATATCTCACCCCAGTGAGAATGG - Intergenic
1013566996 6:111375500-111375522 CTACCTCATCCCATGGAAATTGG - Exonic
1013867943 6:114721411-114721433 CCATCTCACCCCATTTAGAATGG - Intergenic
1013873885 6:114800594-114800616 CCATCTCACCCCATTTAGAATGG - Intergenic
1014836043 6:126161771-126161793 CTATCTCACCCCAGTTAGAATGG - Intergenic
1015756316 6:136610052-136610074 CTACCTCACAGAATTGAGATGGG + Intronic
1018508183 6:164494090-164494112 CTAAATCAGCCTCTTGAGATGGG + Intergenic
1020098783 7:5382786-5382808 GTTACTCTCCCCATTCAGATGGG - Intronic
1020591639 7:10146628-10146650 CTAACTCACTCCCATGAGAATGG + Intergenic
1028643003 7:93064733-93064755 ATATCTCACCCCATTTAGAATGG - Intergenic
1030582100 7:111370241-111370263 CTGACTCTCTCCATTGAAATTGG - Intronic
1031567091 7:123313800-123313822 CTCCCTCACCCCATTAAAATGGG - Intergenic
1033919756 7:146376063-146376085 CTACCTCTCCCCAGTAAGATAGG + Intronic
1034663900 7:152798224-152798246 TCAACTCACCCCACTGAGAATGG - Intronic
1038030790 8:23637516-23637538 CTAACTACCCCCATTGCTATGGG + Intergenic
1039167948 8:34707393-34707415 CTATCTCACCCCAGTCAGAATGG - Intergenic
1044874679 8:96653259-96653281 CTATCTCACCCCAGTTAGAATGG - Intronic
1047265635 8:123305673-123305695 CTAACTCATCCTAATGTGATTGG + Intergenic
1054805242 9:69391186-69391208 CTAACTGTCCCCATTGCTATGGG + Intronic
1055218464 9:73897290-73897312 CCATCTCACACCATTGAGAATGG - Intergenic
1058957149 9:109959729-109959751 CTAACTAACCCCATTCAACTTGG - Intronic
1061508442 9:131045934-131045956 CCCACTCACCCCGTTGAGACTGG + Intronic
1186439852 X:9576417-9576439 CTAACGCATATCATTGAGATGGG + Intronic
1187289556 X:17939985-17940007 CTTACTCACTCCCTTGAGAATGG - Intergenic
1195431007 X:104789452-104789474 CTAACTTATCCCATTGACAGGGG - Intronic
1200036121 X:153332333-153332355 CTATCTCACTCCAGTGAGAATGG + Intergenic