ID: 1156216433

View in Genome Browser
Species Human (GRCh38)
Location 18:35003104-35003126
Sequence CTACTCCTGCCAAACACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156216432_1156216433 30 Left 1156216432 18:35003051-35003073 CCATTTTGAGTTCGTTTTTACGT 0: 1
1: 0
2: 14
3: 185
4: 1529
Right 1156216433 18:35003104-35003126 CTACTCCTGCCAAACACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156216433 Original CRISPR CTACTCCTGCCAAACACAGC AGG Intronic
900624602 1:3602486-3602508 CCACGCCTGCCACCCACAGCCGG + Exonic
901877908 1:12177408-12177430 AGACTCCTGCCCAACCCAGCCGG - Intronic
906850077 1:49238692-49238714 CTACTCCAGCCAAACACAATGGG - Intronic
909048356 1:70737562-70737584 CTACTCTAGCCAAACACCACAGG - Intergenic
913360438 1:117974952-117974974 AAACTCCTGCCACACACATCTGG + Intronic
917518705 1:175730354-175730376 CCACTCCTACCTGACACAGCTGG + Intronic
917527386 1:175800932-175800954 ATGCTCCAGCCAATCACAGCAGG - Intergenic
921830112 1:219718625-219718647 TTACTCCAGCCAAACACCACAGG + Intronic
921948448 1:220905120-220905142 CCATTCCTGGCAAACCCAGCTGG + Intergenic
1063220192 10:3960074-3960096 CATCTCCTCCCAGACACAGCTGG + Intergenic
1067758773 10:49027036-49027058 CTACTCCTTCAAAACCCACCAGG + Intronic
1069727935 10:70593192-70593214 CTCCTCCGTCCAAACACATCAGG + Intergenic
1070097538 10:73352358-73352380 GTACTCCAGCCAAACACCGTAGG - Intronic
1071601191 10:86959459-86959481 CCACTTCTTCCAGACACAGCAGG + Intronic
1075299962 10:121313557-121313579 TTGCTCCTGGAAAACACAGCCGG - Intergenic
1076474955 10:130745413-130745435 CGACTCCTGCCCAACCCAGGTGG + Intergenic
1076684708 10:132192904-132192926 CTCCTCCTCCCACACACACCTGG - Intronic
1078192754 11:9105456-9105478 CTACCCCTGAAAAAAACAGCAGG + Intronic
1080691733 11:34564300-34564322 CTACACCCTCCAAAGACAGCTGG - Intergenic
1080741540 11:35069135-35069157 CTACTCCAGTCAGACACAACAGG + Intergenic
1083919710 11:65775726-65775748 CCCCTTCTGCCAAAAACAGCTGG + Intergenic
1085038975 11:73315846-73315868 CTCCGCCTCCCAAACCCAGCTGG - Intronic
1085337337 11:75706289-75706311 CTCCTCCAGCCAAAGGCAGCAGG + Intergenic
1089759176 11:120710527-120710549 CCACTGCTGCCTCACACAGCTGG - Intronic
1091657131 12:2353933-2353955 CTCATCCTGCCACACACAGAAGG - Intronic
1094395955 12:30006224-30006246 CTACTCTAGCCAAACACCACAGG + Intergenic
1096321780 12:50620551-50620573 CCACTCCTGCCAAGCGCTGCAGG + Intronic
1098213040 12:68186295-68186317 TTTGTCCTCCCAAACACAGCAGG + Intergenic
1101851057 12:108402620-108402642 CTACCCCTTCCAACCCCAGCTGG - Intergenic
1103933634 12:124463737-124463759 CTGCTCCTGCCAAAGGCGGCTGG + Intronic
1104752822 12:131250865-131250887 CTTCTCCTGCCTGACACACCCGG + Intergenic
1104790958 12:131481935-131481957 CTACTCCTGCTTAATGCAGCTGG - Intergenic
1104877086 12:132042911-132042933 CAGCTCCTGACAGACACAGCAGG - Intronic
1105523108 13:21149478-21149500 TTACTTGTGCCAAACACAGATGG + Intergenic
1106514843 13:30444544-30444566 CTTGCCCTGCCACACACAGCGGG - Intergenic
1110555854 13:76858226-76858248 CTACTTCCTCCAAACACAACTGG - Intergenic
1112787596 13:102968341-102968363 ATACTCCTTCCAAACAAACCAGG + Intergenic
1117813984 14:59578207-59578229 TTACTCCTGCCACACAGAGGAGG - Intergenic
1122482446 14:102055743-102055765 CTCCTCCTTCCAAACCCCGCAGG + Intergenic
1122986425 14:105213777-105213799 CTACTCCTGCAGAACCCGGCTGG + Intronic
1129754184 15:78086377-78086399 CTTCTCCCACCAAACACAGGTGG - Intronic
1132754783 16:1477932-1477954 CTCCTTATGCCAAGCACAGCTGG - Intergenic
1133151726 16:3838007-3838029 CCACCCCTGCCACACACACCAGG + Intronic
1140272576 16:73479980-73480002 CCACGACTGCCAATCACAGCAGG - Intergenic
1141912606 16:87070356-87070378 CATCTCCTGCCAAACCCGGCAGG - Intergenic
1142123637 16:88399507-88399529 CTGCCCCTGCCACCCACAGCCGG - Intergenic
1144078909 17:11744496-11744518 CTACTCCTTGCACACTCAGCAGG - Intronic
1149432091 17:56602589-56602611 CTACACCTGCCAAACAAAACAGG + Intergenic
1155038529 18:22045521-22045543 CTACCTTTTCCAAACACAGCAGG + Intergenic
1156212476 18:34960235-34960257 CTACGGCTGCCAAACTCACCTGG + Intergenic
1156216433 18:35003104-35003126 CTACTCCTGCCAAACACAGCAGG + Intronic
1156220517 18:35046504-35046526 CTACCACTGCCCAACACACCTGG - Intronic
1160173378 18:76572795-76572817 CAACTGCAGGCAAACACAGCCGG - Intergenic
1163393711 19:17046275-17046297 CTAATCCTCCCAAGCACATCAGG - Intergenic
1167291085 19:48625596-48625618 CTAGGCCTAGCAAACACAGCAGG - Intronic
1167491698 19:49796237-49796259 CTGCACCTGCCGAACAGAGCTGG + Intronic
927387953 2:22558267-22558289 CTACTCCTGCCAATCTCTGAGGG + Intergenic
927534024 2:23837588-23837610 CTACACCTCCCCAATACAGCAGG + Intronic
927861758 2:26564333-26564355 CCACCCCTGCCAAACAGAGTTGG - Intronic
934014732 2:87867367-87867389 GTACTCTTGCAAAACACAGTTGG + Intergenic
935285355 2:101559705-101559727 CTACTCCTGCCAGCCACAGTTGG + Intergenic
937876752 2:126831767-126831789 CTACTTCCACCATACACAGCTGG + Intergenic
938407300 2:131039691-131039713 CTGCTCCTGCCAGCCCCAGCGGG - Intronic
946285850 2:218701948-218701970 CTGCCTCTGCCAAACACTGCAGG + Exonic
948011446 2:234652230-234652252 CCACCCCTGCCAAACACTGCAGG - Intergenic
948932303 2:241139822-241139844 CTGTTCCTGCCACACACTGCTGG + Intronic
1168957055 20:1841631-1841653 CTACTCCTGCCAGGCAAGGCTGG - Intergenic
1171158288 20:22897129-22897151 CCACTCATGCCAAAGACGGCAGG + Intergenic
1173706630 20:45115004-45115026 TTCTTCCTGCCAAAGACAGCAGG + Exonic
1174852448 20:54008109-54008131 CTACTCCAGCCAAATACCACAGG + Intronic
1177360327 21:20060627-20060649 CTTCTTCTGCCAAACAAGGCTGG - Intergenic
1180124335 21:45778813-45778835 CCACCCCTGCCAACCAAAGCTGG - Intronic
1180134183 21:45850450-45850472 CTACTCTTTCCAAACACCTCAGG - Intronic
1184159289 22:42688409-42688431 CTGCCCCTGCCTAACAGAGCCGG + Intergenic
949653814 3:6193261-6193283 CTCCTCCTGCCAAAAACAAGAGG + Intergenic
950644586 3:14369501-14369523 CTCCTCCTGCCAGACTCATCTGG + Intergenic
953848293 3:46446010-46446032 CTCCTCCTGCCCACCAGAGCTGG - Intronic
956092403 3:65681995-65682017 TTAAACCTGCCAAACTCAGCTGG - Intronic
957159145 3:76585786-76585808 CAAATTCTGCCAAACACACCTGG - Intronic
957506363 3:81125872-81125894 GCACTGCTGCCAAAGACAGCAGG + Intergenic
958958866 3:100490269-100490291 CTACTTCAGCCAAACACCACAGG - Intergenic
959608207 3:108265037-108265059 CTACTCCTCCCATCCAGAGCCGG + Intergenic
961314477 3:126025323-126025345 TTTCTCATGCCAAACACAGCTGG - Intronic
964198587 3:154092007-154092029 CTACTCCAGCCAAACACCAGTGG - Intergenic
966636725 3:182142968-182142990 CTTCTGCTGCCAGTCACAGCTGG + Intergenic
968038355 3:195567789-195567811 CAACCCCTGCCAGACACAGGTGG - Intergenic
973719898 4:53712571-53712593 CTACTGCTGCCAGAAACAGCAGG + Intronic
977069362 4:92364654-92364676 CTACTTCTGCTGAACACAGGTGG - Intronic
982578920 4:157153565-157153587 CTTCTCCTGCCACTCACTGCTGG - Intronic
983278270 4:165645289-165645311 CAACTGCTGTCAAACACAGTTGG - Intergenic
984040453 4:174726430-174726452 CTACTCCAGCCCAACACCACAGG - Intronic
989536894 5:42574261-42574283 CTACTCCTAGCAAGCCCAGCTGG - Intronic
991188936 5:63845780-63845802 ATCCTCCAGCCAAACACTGCAGG + Intergenic
992627929 5:78650790-78650812 CTACAGCTGCAAAACACAGCAGG - Intronic
992797582 5:80266794-80266816 CTACTCCTGTCAAAAGCAGGTGG - Intergenic
993571091 5:89539898-89539920 ATACTCCTGCCAAATACATTGGG - Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995718159 5:115101237-115101259 CTCCTCCTGCAAGACACTGCTGG - Intergenic
996821643 5:127636018-127636040 CTACTTCTGTCAAAGACAGAAGG - Intergenic
997510765 5:134452287-134452309 CTCCTCCTGCAAAGGACAGCTGG + Intergenic
997904641 5:137804341-137804363 CCACTCCTCCCTAACACAACTGG + Intergenic
999613518 5:153396855-153396877 CTGCTGCTGCAAAAAACAGCTGG - Intergenic
1001600074 5:172922963-172922985 CTCCACCTTCCAAACACACCTGG - Intronic
1004872854 6:19924569-19924591 CTCCTCCTGGTAAACACAGCTGG - Intergenic
1006584002 6:35093804-35093826 CTACTCCAGCCAAGCACCACAGG + Intergenic
1007809090 6:44473856-44473878 CTACTCCTGGCAACCGCAGTTGG + Intergenic
1008966034 6:57313727-57313749 CTTTTCATGGCAAACACAGCTGG + Intergenic
1010235206 6:73569400-73569422 TTACGTGTGCCAAACACAGCTGG - Intergenic
1011486910 6:87852263-87852285 TTACTTCTGCCAACCACAGTGGG - Intergenic
1013409852 6:109874278-109874300 CTACTCATGCCTAAGGCAGCAGG + Intergenic
1014561522 6:122897034-122897056 CTGCACCTCTCAAACACAGCTGG - Intergenic
1018421700 6:163645736-163645758 CTAAACATGCCAAACACACCGGG - Intergenic
1019479977 7:1261860-1261882 CTTCTGCTGACAAACCCAGCTGG - Intergenic
1019607552 7:1917790-1917812 GCACTTCTGCCAGACACAGCAGG + Intronic
1019776935 7:2917414-2917436 CCCCTCCTGCCAAGCCCAGCAGG - Intronic
1020042225 7:5012819-5012841 CTACTCCTGACAACCGAAGCCGG + Intronic
1021025215 7:15658358-15658380 CTACTCCAGTCAAACACCGTAGG - Intronic
1021421614 7:20451243-20451265 TTACTCATACCAAACACAGTAGG + Intergenic
1022268155 7:28779265-28779287 CTTCTCCTCCGAAACAGAGCTGG - Intronic
1022306830 7:29154414-29154436 ATGTTCCTGCCAAACTCAGCAGG + Intronic
1023581919 7:41692642-41692664 CAACTCCTGCCAAAGACATGAGG - Intronic
1024016968 7:45325818-45325840 CTCCTCCATCCAAACACTGCAGG - Intergenic
1025057203 7:55774913-55774935 CTGCTCCTGCCATGCACACCGGG - Intergenic
1025084280 7:56009848-56009870 CTGCTCCTGCCATGCACACCAGG + Intergenic
1025115255 7:56252474-56252496 CTACTTTTACCAAGCACAGCAGG - Intergenic
1025801988 7:64795018-64795040 CCACTACTGCAAACCACAGCTGG - Intronic
1026308459 7:69163254-69163276 CTCATCCTACCAAACACAGGTGG - Intergenic
1032074150 7:128828466-128828488 CACCTCCAGCCACACACAGCAGG + Intergenic
1032119943 7:129148438-129148460 CAATTTATGCCAAACACAGCTGG - Intronic
1041406449 8:57504482-57504504 CTACTCCAGCCAAACACCAATGG - Intergenic
1045514519 8:102846123-102846145 CAACTGCTGCCAAATACAGAAGG + Intronic
1048504548 8:135009041-135009063 CTACTATTGTCACACACAGCTGG - Intergenic
1049200337 8:141336972-141336994 CTATGCCTCCCACACACAGCTGG - Intergenic
1054782256 9:69175950-69175972 CTACTCCTGCCAGTCACTGTGGG + Intronic
1054802542 9:69364867-69364889 CCACTCCTGCAAAACCCAGAAGG - Intronic
1054935067 9:70678058-70678080 CTGCCCCTGCCACACACACCAGG - Intronic
1055766423 9:79668341-79668363 CTACTCCTGCCAAGCCCTCCTGG - Intronic
1056547386 9:87624145-87624167 CTACTCCTTGCAGCCACAGCTGG + Intronic
1058194700 9:101957903-101957925 CAACTCCTGCCAAACACCAATGG - Intergenic
1060793138 9:126498936-126498958 CCACTCCTGCCAACCACAGGTGG + Intronic
1060878438 9:127100453-127100475 CTCCTCCTGCCCAACAGCGCTGG - Intronic
1061102582 9:128503564-128503586 TTCCTCCTGCCAAACAGGGCTGG + Intergenic
1186776782 X:12872735-12872757 CTACTCCTTCAAAACATATCTGG + Intronic
1194734870 X:97500204-97500226 CTATTACAGCCCAACACAGCTGG + Intronic
1196818820 X:119686636-119686658 CTCCTCCTGCCAAACTGAGGAGG + Intronic
1197289343 X:124636629-124636651 CTACTCCTGCCAAAGGAAGAAGG - Intronic
1199129746 X:144171144-144171166 GTACTCTTGCAAAACACAGTTGG - Intergenic
1199418853 X:147619607-147619629 CTATTCCTGTCAATAACAGCAGG + Intergenic