ID: 1156218615

View in Genome Browser
Species Human (GRCh38)
Location 18:35028107-35028129
Sequence GGTCTAGGTCAAGAACTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156218613_1156218615 -10 Left 1156218613 18:35028094-35028116 CCTGTCATTGTAAGGTCTAGGTC No data
Right 1156218615 18:35028107-35028129 GGTCTAGGTCAAGAACTGGTCGG No data
1156218610_1156218615 16 Left 1156218610 18:35028068-35028090 CCTTTAAGAGACAAAGGCAAAAG No data
Right 1156218615 18:35028107-35028129 GGTCTAGGTCAAGAACTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156218615 Original CRISPR GGTCTAGGTCAAGAACTGGT CGG Intronic