ID: 1156223335

View in Genome Browser
Species Human (GRCh38)
Location 18:35076560-35076582
Sequence CCTAGCCTGGGGAGTCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156223335_1156223345 2 Left 1156223335 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1156223345 18:35076585-35076607 GGCCTTTGTCTTATGACACAGGG 0: 1
1: 0
2: 0
3: 19
4: 155
1156223335_1156223344 1 Left 1156223335 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1156223344 18:35076584-35076606 GGGCCTTTGTCTTATGACACAGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156223335 Original CRISPR CCTAGCCTGGGGAGTCTGTC AGG (reversed) Intronic
900092684 1:927293-927315 CCTAGCCTTGGGTCTCTGTTTGG + Intronic
902399348 1:16149637-16149659 CCTAACCTGGGAATTCTTTCTGG - Intronic
902593785 1:17494204-17494226 CCTAGCCTGGGCAGTCTGAGAGG - Intergenic
903861030 1:26364687-26364709 CCAGGCCTGGGGAGTCGGTTGGG + Exonic
904038505 1:27571341-27571363 CCTGCCCTGGGGAGTCTGATGGG + Intronic
904597479 1:31655952-31655974 CCCAGCCTGGGGAGTCGGAGAGG - Intronic
905240223 1:36576412-36576434 CCTGGACTGGGGAGTCAGGCTGG + Intergenic
909028101 1:70506369-70506391 GCAAACCTGGGGAGTCTGTGAGG + Intergenic
909672344 1:78203319-78203341 CCTAGCCAGGGGAGGCCGTGAGG + Intergenic
912167911 1:107061780-107061802 CTTAGCCTGGAAAGACTGTCAGG + Intergenic
915654549 1:157348498-157348520 CCTAGCCAAGGGAGGCTGTGAGG - Intergenic
917443551 1:175087782-175087804 CCTAACCTGGGGACTGTGACAGG - Intronic
917854354 1:179089044-179089066 CCTAGCTTGGGGAGTGTGGAGGG + Intronic
917869484 1:179229227-179229249 CCCAGCATGGTGAGTGTGTCTGG - Exonic
919990533 1:202705986-202706008 CCTGGCCTGGGGAGTCCTTCTGG + Intronic
920260362 1:204684673-204684695 CTCAGCCTGGGGACTCGGTCAGG - Intronic
1064650283 10:17501998-17502020 CCCAGGCTGGGAAGTATGTCAGG - Intergenic
1070324235 10:75377444-75377466 CCTGGGCTGGGGAGTTTTTCAGG + Intergenic
1070750949 10:78963734-78963756 TCTGGCCTGGGCAGCCTGTCAGG - Intergenic
1070934271 10:80281304-80281326 CCTGGCTTGGGGAGTCTGTCTGG - Intronic
1072780435 10:98247519-98247541 CTAAGCCTGGGGAGGCTGACTGG + Intergenic
1073806885 10:107108022-107108044 CCTACCCTGGGGACTCAGGCAGG - Intronic
1073936665 10:108640654-108640676 CCTAGCCAGGGGAGTTTGGTGGG + Intergenic
1074892674 10:117748628-117748650 CCTAGCCTGGTGGCTCTGTGTGG - Intergenic
1076980937 11:204364-204386 CACAGCCAGGGGAGTCTGGCAGG + Exonic
1080648012 11:34201230-34201252 CCTTGCCTGGGGGGTGTTTCTGG - Intronic
1081672430 11:44949688-44949710 CCTACCCGGGGGAGGCTGTGTGG - Intronic
1082057922 11:47835039-47835061 CCTAGCGTGGGGACTCAGTGGGG + Intronic
1083242677 11:61400911-61400933 TCTTGCCTTAGGAGTCTGTCTGG + Intergenic
1083718094 11:64590715-64590737 CCGAACCTGGGGAGTCTGTGGGG + Intronic
1084541863 11:69792041-69792063 ACTAGCCTGGTGAGTCTGTGTGG + Intergenic
1085040548 11:73324050-73324072 CCTGGCCAGGGGTCTCTGTCTGG - Intronic
1085350609 11:75795931-75795953 CTTAGACTGGAGAGTGTGTCTGG - Intronic
1085453901 11:76655192-76655214 CCTTCTCTGGGGAGACTGTCTGG - Intergenic
1090371969 11:126262376-126262398 TCTAGCCTGGGGAGTGGGTTGGG - Exonic
1090409360 11:126496986-126497008 CCCAGCCTGGGAATCCTGTCAGG + Intronic
1090473120 11:126997425-126997447 CCAGGCCTGGGGACTCTGGCGGG + Intronic
1093791222 12:23252652-23252674 TATAGCCTGGGCAGTCAGTCTGG + Intergenic
1095152482 12:38811952-38811974 CCTAGCCTAGAGAGTCTCTTGGG + Intronic
1096298306 12:50402797-50402819 TCTAACCTGGGGAGTCGGACAGG - Intronic
1096784188 12:54007968-54007990 CCTGGCCTGGGCAGCCTGCCTGG + Intronic
1097419965 12:59364723-59364745 CCTAGACTGAGGAGTTTCTCAGG + Intergenic
1100885221 12:99062668-99062690 CCTAGGTTGGGGAGTTTGTATGG + Intronic
1104104850 12:125649696-125649718 CAGTGCCTGGGGATTCTGTCAGG - Intronic
1104450248 12:128863243-128863265 CCCAGCAAGGCGAGTCTGTCTGG + Intronic
1107071298 13:36272474-36272496 CCTGTCCTGGGAAGTCTGTGAGG + Intronic
1108950639 13:56088025-56088047 CCTAGGTGGGGGACTCTGTCTGG - Intergenic
1109661667 13:65467647-65467669 CCTAGCCAAGGGAATCTGTGAGG - Intergenic
1111014127 13:82355157-82355179 ACTAGCCTGTGAAGTATGTCTGG - Intergenic
1118500223 14:66355563-66355585 CCTAGCCAGGGAAGGCTCTCAGG - Intergenic
1119748111 14:77058869-77058891 CCTATCCTCGGGAAGCTGTCAGG + Intergenic
1119756765 14:77125194-77125216 CGCAGCGTGGGGCGTCTGTCTGG - Intronic
1121109500 14:91303142-91303164 CCAGGCCTGGGGAGTCTGTCAGG - Intronic
1121238310 14:92409628-92409650 CCTATCCTGGGGAGCATGTTAGG - Intronic
1124685114 15:31776150-31776172 CCTGGCCTGGGGCAGCTGTCAGG - Intronic
1127707597 15:61562483-61562505 CTTAGCCTGGGGAGACTCCCAGG - Intergenic
1127992952 15:64134121-64134143 CTTAGCCTGGGAAATATGTCAGG - Intronic
1129351532 15:74958417-74958439 CCTAGCCAGGGGACTGTGACGGG + Intronic
1132611630 16:819640-819662 CCTGGCCTGGGGAGGCCCTCTGG + Intergenic
1132930769 16:2458108-2458130 CCACGCCTGGGGAGCCTGCCTGG + Exonic
1135323556 16:21512304-21512326 CCACGCCTGGGGAGTCTGGTGGG - Intergenic
1135396978 16:22138819-22138841 CTTATCCTGGAGAGTCTCTCGGG + Intronic
1136335046 16:29605569-29605591 CCACGCCTGGGGAGTCTGGTGGG - Intergenic
1141932893 16:87217439-87217461 CCTGGCTTGGGGAAGCTGTCAGG - Intronic
1142024503 16:87805189-87805211 CCCTGCCTGGGGAGTGTGTGTGG - Intergenic
1142035761 16:87861392-87861414 CCACGCCTGGGGAGTCTGGTGGG - Intronic
1143834584 17:9680345-9680367 CCCAGCCAGGGGACTCTCTCAGG + Exonic
1144833583 17:18144943-18144965 CCAAGTCTGGGGAGTCTGATGGG + Intronic
1145012069 17:19374216-19374238 CCTGTGCTGGGGAGGCTGTCAGG + Intronic
1147175575 17:38654275-38654297 CCCAGCCTGCAGAGCCTGTCAGG + Intergenic
1150072562 17:62164174-62164196 CCTAGCATGTGGACTCTGACAGG + Intergenic
1150953228 17:69825428-69825450 CCTAGCCAGGGTAGTATATCTGG + Intergenic
1152898693 17:82928032-82928054 CCGAGCTTGGGGAGGCTGGCGGG + Intronic
1153952952 18:10072300-10072322 CCCAGCCTGGGGTCCCTGTCAGG + Intergenic
1156223335 18:35076560-35076582 CCTAGCCTGGGGAGTCTGTCAGG - Intronic
1156702405 18:39841502-39841524 CCTCGCCAGCGGCGTCTGTCCGG + Intergenic
1159365405 18:67460011-67460033 CCTAGCCAGAGGAGTCAGGCAGG - Intergenic
1160228816 18:77031295-77031317 CACAGCCTCGGGGGTCTGTCTGG - Intronic
1160462137 18:79047434-79047456 CAAAGCCTGGGGACTCTCTCAGG - Intergenic
1162286608 19:9743604-9743626 CTATACCTGGGGAGTCTGTCTGG - Intergenic
1162353529 19:10166181-10166203 ACTAGACTGGGGAGGCTGGCAGG + Intronic
1164415043 19:28039918-28039940 CCTCCCCTGGGGAGTCTGCCAGG + Intergenic
1164519615 19:28968670-28968692 CCTCCCCTGGGGAGTCTGCCAGG + Intergenic
1166811280 19:45516087-45516109 CCCAGCCTGGAGAGTCAGGCAGG - Intronic
1167272083 19:48511487-48511509 CCCACCCCGGTGAGTCTGTCGGG - Exonic
1168325295 19:55535955-55535977 CCCAGGCTGGGGAGGCTGGCAGG - Intronic
925991608 2:9259422-9259444 CCCAGCCTGGGCAGCCTGGCAGG - Intronic
926316624 2:11714968-11714990 CCTGGCCTGGGCACTCTGTGAGG + Intronic
930155738 2:48106198-48106220 CCTAGCCTGGTCACTCTGTCTGG - Intergenic
932570618 2:72936542-72936564 CCTGGCCTCGGGAGACTGGCAGG - Intergenic
933693608 2:85198502-85198524 TTTAGCTTTGGGAGTCTGTCTGG - Intronic
937747831 2:125435854-125435876 CATGGCCTGGGGAGCCTGTGTGG - Intergenic
938611919 2:132956894-132956916 CTGAGCCTGGGGAGAGTGTCTGG - Intronic
938683196 2:133712759-133712781 CCGAGCATGGGGAGTCATTCAGG - Intergenic
938774286 2:134527663-134527685 CCTAGCCTTGGGAATCATTCCGG + Intronic
941682401 2:168413270-168413292 CCTAGCCAAGGGAGGCTGTGAGG - Intergenic
943980133 2:194539342-194539364 CCTATACTGGAGAGTCTCTCTGG - Intergenic
946243819 2:218373834-218373856 CCTAGCCTATTGAATCTGTCAGG + Intergenic
946577946 2:221096642-221096664 TCTAACCTGGGGAGTTTGGCAGG + Intergenic
948663189 2:239519193-239519215 CCTCTCCTGGGGTGGCTGTCGGG + Intergenic
1169257572 20:4110795-4110817 CCAAGCACGGGAAGTCTGTCTGG - Intergenic
1171438723 20:25144313-25144335 CCTAGCATGGGGACTCTTTCAGG + Intergenic
1173437786 20:43048318-43048340 CCCTGGCTGGGGAGACTGTCAGG + Intronic
1175987365 20:62770696-62770718 CCTCACCTGGGGACTCTGTGAGG - Intergenic
1176722043 21:10401228-10401250 GCCAGCCTCGGGAGGCTGTCGGG + Intergenic
1178007049 21:28233962-28233984 CCTAGCCAAGGGAATCTGTGAGG + Intergenic
1178283987 21:31309591-31309613 CCTAGACCGGAGAGTCTGGCTGG + Intronic
1179945351 21:44670525-44670547 CCTGGACTGGGGAGTCTCTGTGG - Intronic
1181571430 22:23769644-23769666 CCAGGCCTGGTGAGTCTGCCAGG - Intronic
1182362173 22:29753080-29753102 CTGTGCCTGGGGAGGCTGTCCGG + Intronic
951654660 3:24991998-24992020 CCTTGCCTGGGTAGTCTGTTTGG + Intergenic
953908962 3:46882393-46882415 GCTGGCTTGGGGAGGCTGTCGGG + Intronic
956288707 3:67638706-67638728 CGTAGACTTGGGAGTCTGACAGG + Intronic
959074480 3:101735611-101735633 CCTAGCCTGGGGAAGCCGTGAGG + Intronic
961371707 3:126435478-126435500 CCTGGCCTGGGGACTCCGTGTGG + Intronic
962106840 3:132398991-132399013 GCTAGCCTAGGGATTCTGTTTGG - Intergenic
964658405 3:159093535-159093557 CATAACCTGGGGAGCCTGGCAGG + Intronic
966854781 3:184186419-184186441 CCTGGACTGGGGCCTCTGTCTGG + Intronic
969540445 4:7785299-7785321 GCTGGCCTCGGGGGTCTGTCTGG - Intronic
969608195 4:8212642-8212664 CCTGGGCTGGGAAGTCTGTGGGG - Intronic
971353815 4:25876503-25876525 AGTAGCATGGGGTGTCTGTCAGG - Intronic
971648919 4:29246350-29246372 ACTAGACTGGGAAGTCTGACTGG + Intergenic
978371241 4:108031385-108031407 CCAAGCCTGAGGAGCCTGTGAGG + Intronic
985002479 4:185499816-185499838 CCTAGCAGGGGGAGCCTGTTGGG + Intergenic
986081407 5:4398624-4398646 CCTACCCTGGGGGGCCTGTGAGG - Intergenic
986158386 5:5199660-5199682 ACTCGCCTGGGGAGTTTGTTTGG + Intronic
986262520 5:6160645-6160667 CTGGGCCTGGGGAGGCTGTCAGG + Intergenic
986273501 5:6253951-6253973 CTTAGCATTGGGAGTCTGACTGG - Intergenic
987238992 5:15973217-15973239 CCTACCCTGTGGAGAATGTCGGG - Intergenic
994873835 5:105389491-105389513 CCTTGCCTGGAGAGTGTTTCAGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
999090537 5:148932070-148932092 TCAGGCCTGGGGAGGCTGTCAGG - Intronic
999440550 5:151597396-151597418 CCTAGCCTGGGCAGAATGTCTGG - Intergenic
1001282414 5:170396284-170396306 CCCAGCCTGGGGAGACCCTCAGG + Intronic
1002575696 5:180172564-180172586 CCTAGCCCCGGGTGTCTGCCAGG + Intronic
1004378826 6:15114822-15114844 CTCAGCCTCGGGAGTATGTCCGG - Intergenic
1005813278 6:29531884-29531906 CCTAGAGTGGGGAAGCTGTCAGG - Intergenic
1008448502 6:51621663-51621685 TTTCGGCTGGGGAGTCTGTCAGG - Intronic
1013015473 6:106157086-106157108 CATAGCTTGGGCAGTCAGTCAGG + Intergenic
1013498050 6:110718434-110718456 CCTGGCCTGGGGAGGCAGTAAGG + Intronic
1014191982 6:118506592-118506614 CCTTGCCTGGGGAGTTGGTGGGG + Intronic
1015811714 6:137167542-137167564 TCTAACCTGGAGACTCTGTCTGG + Intronic
1015858016 6:137646177-137646199 CCTACTCTGGGGAGCCTGCCTGG + Intergenic
1018885716 6:167934612-167934634 CCTAGCCTGGGTTCTCTGGCTGG - Intronic
1019119965 6:169794567-169794589 CCTGGCTTGGGGAGCCTGCCTGG - Intergenic
1023615030 7:42011214-42011236 CCTGGGCTGGGGACTCAGTCTGG - Intronic
1025182043 7:56828226-56828248 CCGAGCCTGGAGAGGCTGACTGG + Intergenic
1025689885 7:63748769-63748791 CCGAGCCTGGAGAGGCTGACTGG - Intergenic
1031325101 7:120386057-120386079 TCTAGCCTCAGGAGTCTGTCAGG + Intronic
1032984291 7:137319695-137319717 CCAAGCCTTGGCAGTTTGTCCGG - Intronic
1033660349 7:143398240-143398262 CCTAGCCTGGGGTGTGGGTTGGG - Intronic
1035233650 7:157482937-157482959 CCTGGCTTGGGGAGTTTCTCGGG + Intergenic
1037717558 8:21412729-21412751 CCTAGACTGGGTAGTCTATCAGG + Intergenic
1038404101 8:27309148-27309170 CCCAGCCTGGGGGCTCTGCCTGG + Intronic
1045432035 8:102123773-102123795 CCGGGCCTGCGGAGTCTGCCCGG - Intronic
1046872166 8:119215609-119215631 CCTGGCCAGGGAAGTCTTTCTGG + Intronic
1047010549 8:120668169-120668191 CCCAACCCAGGGAGTCTGTCAGG + Intronic
1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG + Intergenic
1049808325 8:144551508-144551530 CGTGGCCTGGGGAGAGTGTCTGG - Intronic
1052754412 9:32525946-32525968 ACAAACCTGGGGAGTCTGGCAGG + Intronic
1060261444 9:122078337-122078359 CCTAGCCTGGGGCATGTGTGTGG + Intronic
1060819887 9:126655181-126655203 CCTGGCCTGGGGCCACTGTCAGG + Intronic
1062297442 9:135840253-135840275 CCGAGGCTGGGGAGTGTCTCTGG - Intronic
1062463187 9:136670350-136670372 CCTGGCCTGGGGAGGCGGGCAGG + Intronic
1062634867 9:137485468-137485490 CCTCACCTGGAGAGTGTGTCTGG - Intronic
1186436682 X:9549181-9549203 CCAGGCCTGGGGAGACTGGCTGG - Intronic
1188980886 X:36726103-36726125 CCAAACCTGGGGAGACTGACTGG + Intergenic
1190598318 X:52067314-52067336 CCTGGGCCGGGGAGCCTGTCTGG + Exonic
1190610506 X:52186759-52186781 CCTGGGCCGGGGAGCCTGTCTGG - Exonic
1192066457 X:67890271-67890293 ACTAGCCTGGGTATTCTCTCAGG + Intergenic
1195010940 X:100731792-100731814 CCAAGCCTGGGGATGCGGTCGGG + Intronic
1197107859 X:122737110-122737132 CTTACCCTGGGGAGTGTGTGTGG + Intergenic