ID: 1156223336

View in Genome Browser
Species Human (GRCh38)
Location 18:35076560-35076582
Sequence CCTGACAGACTCCCCAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156223336 Original CRISPR CCTGACAGACTCCCCAGGCT AGG Intronic
900173526 1:1281865-1281887 CCTGGCAGACAGCCCAGCCTTGG - Intronic
900283635 1:1888896-1888918 TCTGAGAGCCTCCCCAGGGTAGG - Intronic
901922869 1:12548777-12548799 CGGGACAGACTCCCCAGCCAAGG - Intergenic
902469408 1:16638153-16638175 CAACACAGACTCCCCTGGCTGGG - Intergenic
902593786 1:17494204-17494226 CCTCTCAGACTGCCCAGGCTAGG + Intergenic
902965154 1:19995780-19995802 CCTCACAGATTCCCTTGGCTGGG + Intergenic
903861029 1:26364687-26364709 CCCAACCGACTCCCCAGGCCTGG - Exonic
904597480 1:31655952-31655974 CCTCTCCGACTCCCCAGGCTGGG + Intronic
904748380 1:32725374-32725396 CCTGCCTGTCTCACCAGGCTGGG + Intergenic
905246229 1:36615976-36615998 GCTTAGAGACTCCCAAGGCTAGG + Intergenic
906136716 1:43505299-43505321 AGTGACAGACTGGCCAGGCTTGG + Intergenic
906746552 1:48226078-48226100 CATGACAGAATCCCCAGGGATGG + Intronic
907888496 1:58616196-58616218 CCTGACCGTCCGCCCAGGCTGGG + Intergenic
909672343 1:78203319-78203341 CCTCACGGCCTCCCCTGGCTAGG - Intergenic
912945303 1:114079584-114079606 TCTGACAGGCTCCCCATGATGGG + Intergenic
913199397 1:116483926-116483948 CGTGCCTGACTCCCCAAGCTAGG + Intergenic
915654550 1:157348498-157348520 CCTCACAGCCTCCCTTGGCTAGG + Intergenic
917443552 1:175087782-175087804 CCTGTCACAGTCCCCAGGTTAGG + Intronic
917869485 1:179229227-179229249 CCAGACACACTCACCATGCTGGG + Exonic
918266802 1:182850189-182850211 TCTGACAGAATACCCAAGCTTGG - Intronic
919990532 1:202705986-202706008 CCAGAAGGACTCCCCAGGCCAGG - Intronic
922672227 1:227519264-227519286 CCTGAGAGTCTCCCCTGGCCTGG + Intergenic
923161393 1:231317604-231317626 GCTGCCAGAGTGCCCAGGCTAGG + Intergenic
1064650284 10:17501998-17502020 CCTGACATACTTCCCAGCCTGGG + Intergenic
1066393546 10:34998050-34998072 CTTCCCAGTCTCCCCAGGCTGGG + Intergenic
1067765106 10:49079717-49079739 TCTCTCAGCCTCCCCAGGCTGGG - Intronic
1069724286 10:70567355-70567377 CCTGCCAGCCCCACCAGGCTGGG - Exonic
1069725910 10:70578416-70578438 CCTGGAAGAGTGCCCAGGCTGGG + Intergenic
1070324234 10:75377444-75377466 CCTGAAAAACTCCCCAGCCCAGG - Intergenic
1070648042 10:78215066-78215088 CCTGACTTCCTCCCCAGGCCTGG + Intergenic
1070650683 10:78233401-78233423 TCTGATAGGCTCTCCAGGCTGGG + Intergenic
1070934272 10:80281304-80281326 CCAGACAGACTCCCCAAGCCAGG + Intronic
1072805623 10:98422488-98422510 CCTAGAAGACTTCCCAGGCTTGG - Exonic
1073321411 10:102618343-102618365 CTTCACAGACTCCCCAGACTGGG - Intronic
1073565025 10:104527684-104527706 CCTGTCTGAGCCCCCAGGCTCGG + Intergenic
1073806886 10:107108022-107108044 CCTGCCTGAGTCCCCAGGGTAGG + Intronic
1073970357 10:109040894-109040916 GCTGCCAGAGTGCCCAGGCTGGG + Intergenic
1075686924 10:124370888-124370910 ACTGACAGTCTCCCCTGGTTTGG - Intergenic
1075797991 10:125134811-125134833 CCTGACTCCCTCTCCAGGCTGGG - Intronic
1076746618 10:132517784-132517806 CGTGGGAGACTCCCCAGGGTGGG - Intergenic
1077434222 11:2531035-2531057 GCTGACAGACAGCCCTGGCTGGG - Intronic
1077446328 11:2592709-2592731 AGTGTCAGGCTCCCCAGGCTGGG - Intronic
1083718093 11:64590715-64590737 CCCCACAGACTCCCCAGGTTCGG - Intronic
1085743253 11:79094634-79094656 TCTGACTGTCTCCCCAGCCTAGG + Intronic
1087404852 11:97717859-97717881 GCTGCCAGAGTGCCCAGGCTAGG - Intergenic
1090409359 11:126496986-126497008 CCTGACAGGATTCCCAGGCTGGG - Intronic
1090467808 11:126950742-126950764 CATTCCAGAATCCCCAGGCTAGG - Intronic
1090473119 11:126997425-126997447 CCCGCCAGAGTCCCCAGGCCTGG - Intronic
1090737404 11:129622117-129622139 CTTCACAGACTACCCTGGCTAGG - Intergenic
1090800977 11:130171941-130171963 ACCGACAGACTGCCCAGGCCAGG - Intronic
1090920663 11:131203588-131203610 CCTGCCTGATTCCCCGGGCTGGG + Intergenic
1091255253 11:134178547-134178569 CCTGACACAGTCCCATGGCTGGG + Intronic
1097419964 12:59364723-59364745 CCTGAGAAACTCCTCAGTCTAGG - Intergenic
1097547598 12:61023673-61023695 GCTGTCAGAATGCCCAGGCTAGG + Intergenic
1099498287 12:83379202-83379224 CCTCACAAGTTCCCCAGGCTTGG - Intergenic
1101130372 12:101684478-101684500 CATGCCATACTCCACAGGCTTGG - Intronic
1102778934 12:115546736-115546758 CCTGAGAGACTCTCCAGGAAGGG + Intergenic
1104450247 12:128863243-128863265 CCAGACAGACTCGCCTTGCTGGG - Intronic
1104508376 12:129353851-129353873 CCTGACTGACTCCACAGGTGTGG + Intronic
1104746965 12:131216719-131216741 CCTGTCAGAACCCACAGGCTGGG - Intergenic
1104785655 12:131446466-131446488 CCTGTCAGAACCCACAGGCTGGG + Intergenic
1104786787 12:131455397-131455419 CCTCAGAGTCTCCTCAGGCTGGG - Intergenic
1104890898 12:132139635-132139657 CTTGACAGACTCCTCCAGCTGGG + Exonic
1104968534 12:132520773-132520795 CCTCACAGTGTCCCCAGGCCTGG - Intronic
1105712431 13:23025514-23025536 TCCGACAAACTCCCAAGGCTGGG - Intergenic
1105806148 13:23952818-23952840 GCTGCCAGAGTGCCCAGGCTAGG - Intergenic
1107071297 13:36272474-36272496 CCTCACAGACTTCCCAGGACAGG - Intronic
1109661668 13:65467647-65467669 CCTCACAGATTCCCTTGGCTAGG + Intergenic
1111232615 13:85363306-85363328 GCTGCCGGACTGCCCAGGCTAGG + Intergenic
1111968558 13:94885954-94885976 GCTGACAGATTGCCCAGTCTAGG - Intergenic
1112010639 13:95291056-95291078 TCTGAATGACTGCCCAGGCTGGG + Intronic
1113504106 13:110801201-110801223 CATGGCAGACTCCCCAGCCCGGG + Intergenic
1117273106 14:54165158-54165180 TCTGACAGAATCCATAGGCTGGG + Intergenic
1117464528 14:55979140-55979162 ACTGGCAGAGTCCCCAGGATCGG + Intergenic
1117490381 14:56241030-56241052 CTTGACAGTCTCCCCTTGCTTGG + Intronic
1118500224 14:66355563-66355585 CCTGAGAGCCTTCCCTGGCTAGG + Intergenic
1119265751 14:73262545-73262567 CCTTCCAGAAGCCCCAGGCTGGG - Exonic
1119748110 14:77058869-77058891 CCTGACAGCTTCCCGAGGATAGG - Intergenic
1121109501 14:91303142-91303164 CCTGACAGACTCCCCAGGCCTGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122207174 14:100153587-100153609 CAGGACAGAGTTCCCAGGCTGGG - Intronic
1124242193 15:28037845-28037867 CCTGGCACAATCCTCAGGCTGGG - Intronic
1124685115 15:31776150-31776172 CCTGACAGCTGCCCCAGGCCAGG + Intronic
1131821860 15:96281888-96281910 CTTGACAGATTACCCAGTCTCGG + Intergenic
1132553579 16:563495-563517 GCTGCTAGACTCCCCAGACTGGG + Exonic
1132722555 16:1323900-1323922 CCTGCCAGTCTCGCCAGGATTGG - Intronic
1132930768 16:2458108-2458130 CCAGGCAGGCTCCCCAGGCGTGG - Exonic
1133280205 16:4660835-4660857 CCTGACAGGCCCCCCAGACCGGG + Intronic
1134115962 16:11549123-11549145 CCTTACAGACTTTACAGGCTTGG - Exonic
1134322158 16:13173981-13174003 CCTGGCAGATTCCACAGTCTGGG + Intronic
1135089088 16:19498313-19498335 CCTGCCAGACTTCCCAGACCTGG + Exonic
1135323557 16:21512304-21512326 CCCACCAGACTCCCCAGGCGTGG + Intergenic
1136335047 16:29605569-29605591 CCCACCAGACTCCCCAGGCGTGG + Intergenic
1139849450 16:69941800-69941822 CCTCACAGACCCTCCAGGCCTGG + Intergenic
1141636084 16:85314647-85314669 CCTGGCAGGCTCCCCATGCATGG + Intergenic
1141656434 16:85419163-85419185 ACTGTCAGAATCCCCAGGCTCGG - Intergenic
1141932894 16:87217439-87217461 CCTGACAGCTTCCCCAAGCCAGG + Intronic
1142024504 16:87805189-87805211 CCACACACACTCCCCAGGCAGGG + Intergenic
1142035762 16:87861392-87861414 CCCACCAGACTCCCCAGGCGTGG + Intronic
1142118367 16:88373050-88373072 GCTGACAGAATCCCCTGGCTTGG + Intergenic
1142289772 16:89188168-89188190 CCTGCCAGGCTCCCCAAACTGGG + Exonic
1143137895 17:4722099-4722121 CTTGACCGAAGCCCCAGGCTGGG + Intergenic
1143834583 17:9680345-9680367 CCTGAGAGAGTCCCCTGGCTGGG - Exonic
1144833582 17:18144943-18144965 CCCATCAGACTCCCCAGACTTGG - Intronic
1145012068 17:19374216-19374238 CCTGACAGCCTCCCCAGCACAGG - Intronic
1146266373 17:31455712-31455734 CAAGACAGAAACCCCAGGCTGGG - Intronic
1146726608 17:35161526-35161548 CAACACAGACTCCCCAGCCTGGG - Intronic
1147175574 17:38654275-38654297 CCTGACAGGCTCTGCAGGCTGGG - Intergenic
1147370701 17:39990717-39990739 CCTGACAGTCATTCCAGGCTTGG + Intronic
1148577625 17:48722864-48722886 CCTGACCCTCCCCCCAGGCTGGG + Intergenic
1148859442 17:50596399-50596421 CAGGCCAGACCCCCCAGGCTTGG - Intronic
1149516809 17:57287281-57287303 CAGGACAGCCTCGCCAGGCTGGG - Intronic
1149692067 17:58585812-58585834 CATGGCAGACAGCCCAGGCTTGG - Exonic
1149866067 17:60151685-60151707 CCTGACACTGGCCCCAGGCTTGG - Intronic
1150072561 17:62164174-62164196 CCTGTCAGAGTCCACATGCTAGG - Intergenic
1151598054 17:75089803-75089825 CCTGACTCCCACCCCAGGCTGGG - Intronic
1152898692 17:82928032-82928054 CCCGCCAGCCTCCCCAAGCTCGG - Intronic
1153244778 18:3063142-3063164 ACTGACAGGCTCCCCCTGCTGGG + Intergenic
1153952951 18:10072300-10072322 CCTGACAGGGACCCCAGGCTGGG - Intergenic
1154082653 18:11273604-11273626 CTTGGCAGAGTCCCCAGCCTTGG - Intergenic
1154162836 18:11992639-11992661 CTTCACAGACCCCCCTGGCTCGG - Intronic
1156223336 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG + Intronic
1157330510 18:46700617-46700639 CCTCTCAGACTCCCAGGGCTTGG + Intronic
1159365406 18:67460011-67460033 CCTGCCTGACTCCTCTGGCTAGG + Intergenic
1160586716 18:79917333-79917355 CCTCACAGGGGCCCCAGGCTTGG - Intronic
1160956260 19:1693411-1693433 TCTCTCTGACTCCCCAGGCTGGG + Intergenic
1161091661 19:2363299-2363321 GCGGACAGAGTCCCCAGCCTGGG - Intergenic
1161581932 19:5085864-5085886 TCTAACAGACTCTCCAGCCTGGG - Intronic
1163830120 19:19543605-19543627 GCAGACAGAGTCCCCAGCCTTGG + Intronic
1164415042 19:28039918-28039940 CCTGGCAGACTCCCCAGGGGAGG - Intergenic
1164519614 19:28968670-28968692 CCTGGCAGACTCCCCAGGGGAGG - Intergenic
1165269833 19:34696589-34696611 CCTCACAGCTTCCCCTGGCTGGG - Intergenic
1166809724 19:45507948-45507970 CACGACTGACTCCCCAAGCTCGG + Intronic
1166811281 19:45516087-45516109 CCTGCCTGACTCTCCAGGCTGGG + Intronic
1167158395 19:47752815-47752837 CCTTCCTGACCCCCCAGGCTGGG - Intronic
1167236710 19:48320110-48320132 CCTGCCCCACTGCCCAGGCTTGG + Intronic
1167272084 19:48511487-48511509 CCCGACAGACTCACCGGGGTGGG + Exonic
1167472824 19:49684905-49684927 CCTGCCTGCCTCCCCAGGGTGGG + Exonic
1167975999 19:53226325-53226347 CCTGAGCGAATCCCCAGTCTGGG + Intergenic
1168325296 19:55535955-55535977 CCTGCCAGCCTCCCCAGCCTGGG + Intronic
1168671511 19:58244394-58244416 CCTCACGGACACCCCTGGCTGGG + Intronic
925026359 2:610271-610293 GCTGCCAGCCTCTCCAGGCTGGG - Intergenic
925091889 2:1163016-1163038 CCTGTCATGCTCCACAGGCTGGG - Intronic
925747217 2:7053767-7053789 CCTGCCAGACTCAGCAGGATTGG + Intronic
925851757 2:8088606-8088628 GCTGACAGCCTCCCCTTGCTGGG - Intergenic
925991609 2:9259422-9259444 CCTGCCAGGCTGCCCAGGCTGGG + Intronic
926316623 2:11714968-11714990 CCTCACAGAGTGCCCAGGCCAGG - Intronic
928166591 2:28976890-28976912 CCTTTCAGGCTCTCCAGGCTGGG + Intronic
929896430 2:45964446-45964468 CTTGGCAGATTTCCCAGGCTGGG + Intronic
930155739 2:48106198-48106220 CCAGACAGAGTGACCAGGCTAGG + Intergenic
932570619 2:72936542-72936564 CCTGCCAGTCTCCCGAGGCCAGG + Intergenic
938683197 2:133712759-133712781 CCTGAATGACTCCCCATGCTCGG + Intergenic
940485565 2:154291515-154291537 GCTGCCAGAGTGCCCAGGCTAGG - Intronic
941682402 2:168413270-168413292 CCTCACAGCCTCCCTTGGCTAGG + Intergenic
943075208 2:183186030-183186052 CAGGAGAGACTCCCCAAGCTTGG - Intergenic
946243818 2:218373834-218373856 CCTGACAGATTCAATAGGCTAGG - Intergenic
947815179 2:233032053-233032075 CCTGACAGCTAACCCAGGCTGGG - Intergenic
948825806 2:240573034-240573056 CCTGACAGGCTCCCCGGCCGGGG + Intronic
1169257573 20:4110795-4110817 CCAGACAGACTTCCCGTGCTTGG + Intergenic
1170850794 20:20002848-20002870 GCTGCCATACTCCCCATGCTTGG + Intergenic
1171438722 20:25144313-25144335 CCTGAAAGAGTCCCCATGCTAGG - Intergenic
1172323566 20:34016915-34016937 CCTCCCAGGCTCCCCAGGCCTGG - Intronic
1172432796 20:34906433-34906455 TCTGACATACACACCAGGCTGGG - Intronic
1173437785 20:43048318-43048340 CCTGACAGTCTCCCCAGCCAGGG - Intronic
1173658093 20:44714826-44714848 CCTGCCAGAAACCGCAGGCTGGG + Exonic
1174054564 20:47788953-47788975 GCTGAGTGACTTCCCAGGCTGGG - Intergenic
1174120383 20:48260525-48260547 GCTGAGTGACTTCCCAGGCTGGG - Intergenic
1174632090 20:51966889-51966911 CCTCACAGACTCCCATGGCGGGG + Intergenic
1175479521 20:59301425-59301447 CCTGCCAGCATCCCCAGACTGGG - Exonic
1175987366 20:62770696-62770718 CCTCACAGAGTCCCCAGGTGAGG + Intergenic
1176375195 21:6083525-6083547 CCTGACAGAGGCCACACGCTGGG + Intergenic
1176425709 21:6547194-6547216 CCTGACAGATGCCCCTGGTTTGG + Intergenic
1177430383 21:20985211-20985233 CCTTACAAATTCCCCAGTCTCGG - Intergenic
1178007048 21:28233962-28233984 CCTCACAGATTCCCTTGGCTAGG - Intergenic
1178442693 21:32611900-32611922 CCTGTCTGACACCCCGGGCTGGG - Intronic
1178460277 21:32796308-32796330 CCTGGCACACAGCCCAGGCTGGG - Intronic
1179116123 21:38494175-38494197 TCTGACAGAATCCCCAGGCCAGG + Intronic
1179701200 21:43155511-43155533 CCTGACAGATGCCCCTGGTTTGG + Intergenic
1179748279 21:43454719-43454741 CCTGACAGAGGCCACACGCTGGG - Intergenic
1180000591 21:44993683-44993705 CCTGGAAGACTCCCCAGGGATGG - Intergenic
1181571431 22:23769644-23769666 CCTGGCAGACTCACCAGGCCTGG + Intronic
1183662796 22:39231361-39231383 ACAGACAGACCCCCCGGGCTGGG - Intronic
1183736902 22:39649360-39649382 CCTGACCGCCTTTCCAGGCTGGG + Intronic
949397792 3:3633714-3633736 ACTGATAGTCTCCCCAGGATTGG + Intergenic
950592444 3:13948100-13948122 CCTGGCAGACTTCACAGGCACGG - Intronic
950649349 3:14397536-14397558 CTTCACAGACACCCCAGGCCAGG - Intergenic
951654659 3:24991998-24992020 CCAAACAGACTACCCAGGCAAGG - Intergenic
952483843 3:33789568-33789590 CTGGACAGAGTCCCCAGGATAGG + Intergenic
954300028 3:49696059-49696081 CAACACAGACTCCCCTGGCTGGG + Intronic
955554994 3:60127207-60127229 CCTGTCAGCCTCCCCTGGGTTGG - Intronic
959074479 3:101735611-101735633 CCTCACGGCTTCCCCAGGCTAGG - Intronic
960879815 3:122332864-122332886 GCTGAAAGACTCCCCAGGATGGG - Intronic
961511744 3:127407727-127407749 CCTCACAAAGTCCCCAGGCGGGG + Intergenic
962378048 3:134875124-134875146 CCTGACAGAATCTCCAGGGGTGG + Intronic
963692750 3:148525387-148525409 GCTGCCAGAGTGCCCAGGCTGGG + Intergenic
965404051 3:168249191-168249213 TCTAACCGACTCCCCAGACTCGG + Intergenic
969227608 4:5809181-5809203 TCTGCCCGACTCCACAGGCTGGG - Intronic
969506483 4:7591330-7591352 CCTGCCAGAGTCCCAGGGCTGGG + Intronic
977706765 4:100080318-100080340 CATGACAGAATACACAGGCTGGG + Intergenic
978371240 4:108031385-108031407 CCTCACAGGCTCCTCAGGCTTGG - Intronic
983660643 4:170127817-170127839 GCTGCCAGAGTGCCCAGGCTAGG - Intergenic
984707097 4:182855595-182855617 CCTGACAGCCTGGCCAAGCTTGG + Intergenic
986081408 5:4398624-4398646 CCTCACAGGCCCCCCAGGGTAGG + Intergenic
993635090 5:90333356-90333378 TCTGTCAGGCTCCCCAGGTTAGG + Intergenic
993954735 5:94218376-94218398 CTTGACTGACTTCACAGGCTGGG + Intronic
994873834 5:105389491-105389513 CCTGAAACACTCTCCAGGCAAGG - Intergenic
999271317 5:150297848-150297870 CCTGCCAGACCCACCAGGGTCGG + Exonic
999440551 5:151597396-151597418 CCAGACATTCTGCCCAGGCTAGG + Intergenic
1001282413 5:170396284-170396306 CCTGAGGGTCTCCCCAGGCTGGG - Intronic
1002292176 5:178207387-178207409 CTTGAAAGACTTCTCAGGCTGGG + Intronic
1002463380 5:179388165-179388187 TCTCACAGATTCACCAGGCTGGG - Intergenic
1002575695 5:180172564-180172586 CCTGGCAGACACCCGGGGCTAGG - Intronic
1004606627 6:17200869-17200891 GCTGCCGGACTGCCCAGGCTGGG + Intergenic
1005813279 6:29531884-29531906 CCTGACAGCTTCCCCACTCTAGG + Intergenic
1007627549 6:43254939-43254961 CCTGACCACCTCCCCTGGCTGGG - Intronic
1008446556 6:51598515-51598537 GCTGCCAGAGTGCCCAGGCTAGG + Intergenic
1008527645 6:52422203-52422225 ACTCACAGACACCCCAGGCAAGG - Intronic
1009873113 6:69472980-69473002 GCTGAAAGACTCCCCAAGCATGG - Intergenic
1011464293 6:87639585-87639607 CTTGTCCCACTCCCCAGGCTGGG - Intronic
1013498049 6:110718434-110718456 CCTTACTGCCTCCCCAGGCCAGG - Intronic
1022818023 7:33932119-33932141 CCTCTCAGAGTCGCCAGGCTGGG + Intronic
1023656099 7:42422419-42422441 CCTGACACTCACCCCAGCCTGGG - Intergenic
1024351173 7:48366482-48366504 CTTCACAGACTACCCAGTCTCGG - Intronic
1024766775 7:52669155-52669177 CCTGCCCGACTCCTCAGGCATGG - Intergenic
1025182042 7:56828226-56828248 CCAGTCAGCCTCTCCAGGCTCGG - Intergenic
1025689886 7:63748769-63748791 CCAGTCAGCCTCTCCAGGCTCGG + Intergenic
1026199878 7:68205526-68205548 CATGACAGACTGCCCAGGGGAGG - Intergenic
1026446400 7:70488318-70488340 CCTGGCGCACTCTCCAGGCTGGG - Intronic
1026853071 7:73736859-73736881 CCTGGTAGGGTCCCCAGGCTGGG + Intronic
1029207883 7:98879668-98879690 CTTGACAAACTCCCCCGCCTTGG + Intronic
1029420131 7:100467916-100467938 CTTGACAGAGACCCCTGGCTGGG + Intronic
1029552832 7:101246911-101246933 CTTGAGAGAATCCCCAGGTTGGG + Intronic
1031730901 7:125299477-125299499 GCTGCCAGAGTGCCCAGGCTGGG - Intergenic
1032984292 7:137319695-137319717 CCGGACAAACTGCCAAGGCTTGG + Intronic
1034147986 7:148889165-148889187 CCTGGAACACACCCCAGGCTGGG + Intergenic
1034170167 7:149056676-149056698 ACTAAGAGACACCCCAGGCTGGG - Intergenic
1034669618 7:152848212-152848234 CCTGACTGTCACCCCAGACTTGG - Intronic
1037717557 8:21412729-21412751 CCTGATAGACTACCCAGTCTAGG - Intergenic
1038011445 8:23479704-23479726 CATGACAGAGCCCCCAGGATGGG + Intergenic
1038404100 8:27309148-27309170 CCAGGCAGAGCCCCCAGGCTGGG - Intronic
1040554912 8:48469860-48469882 GCCGACAGAATCCCCAGGCCAGG + Intergenic
1041287242 8:56273461-56273483 CCTCACAGCCTCCCTTGGCTGGG - Intergenic
1041816670 8:61980580-61980602 TCAGACAGACTCAACAGGCTGGG - Intergenic
1042845282 8:73163716-73163738 CCTGACAGCCACCCTATGCTTGG - Intergenic
1044302884 8:90606313-90606335 GCTGCCAGAGTGCCCAGGCTAGG - Intergenic
1045432036 8:102123773-102123795 CCGGGCAGACTCCGCAGGCCCGG + Intronic
1046055202 8:109071013-109071035 GCTGCCAGAGTGCCCAGGCTAGG - Intergenic
1046129838 8:109954038-109954060 CCTGAGAAAGTCCCCAGGCCTGG - Intergenic
1047010548 8:120668169-120668191 CCTGACAGACTCCCTGGGTTGGG - Intronic
1047708985 8:127531224-127531246 CCTTCCTGACCCCCCAGGCTGGG + Intergenic
1049175650 8:141190871-141190893 CCTGGCAAAATCCCCAGTCTGGG - Intronic
1049494020 8:142921252-142921274 CCTGTCTGACTCTCCAGTCTTGG + Intergenic
1049807242 8:144546630-144546652 CGTGCCAGAGGCCCCAGGCTGGG + Intronic
1055184559 9:73434952-73434974 GTTGGCAGACTCCCCAGGTTTGG + Intergenic
1058065124 9:100540410-100540432 GCTGCCAGAGTGCCCAGGCTAGG - Intronic
1059505334 9:114793668-114793690 CATCACAGAGTACCCAGGCTGGG - Intronic
1060217838 9:121749031-121749053 CCTGGAAGACTTCCCAGGCAGGG + Intronic
1060559298 9:124529709-124529731 CCTGACATCCTCCCAAGGTTGGG - Intronic
1060819886 9:126655181-126655203 CCTGACAGTGGCCCCAGGCCAGG - Intronic
1061082825 9:128382403-128382425 TCTGGCAGACTTCCCAGCCTAGG + Intronic
1062297443 9:135840253-135840275 CCAGAGACACTCCCCAGCCTCGG + Intronic
1062463186 9:136670350-136670372 CCTGCCCGCCTCCCCAGGCCAGG - Intronic
1186436683 X:9549181-9549203 CCAGCCAGTCTCCCCAGGCCTGG + Intronic
1187235046 X:17459208-17459230 CCTCACAGTCTCCGCAGACTTGG - Intronic
1187245944 X:17553050-17553072 CCTGGGAGACTCCCCAGTCCTGG + Intronic
1188980885 X:36726103-36726125 CCAGTCAGTCTCCCCAGGTTTGG - Intergenic
1190944032 X:55073283-55073305 CCTGACAGCTTCCCTTGGCTGGG + Intergenic
1191222978 X:58010590-58010612 CTTGTCTGACTGCCCAGGCTAGG + Intergenic
1192555667 X:72087040-72087062 CAGGTCAGACCCCCCAGGCTGGG - Intergenic
1192979101 X:76319410-76319432 GCTTACAGACTTCACAGGCTGGG - Intergenic
1195010939 X:100731792-100731814 CCCGACCGCATCCCCAGGCTTGG - Intronic
1197489473 X:127100340-127100362 CCTCACTGACTCCCTTGGCTGGG - Intergenic
1198654626 X:138900085-138900107 CCTGACTGACTTACCAGGCCTGG - Intronic
1200135569 X:153873035-153873057 GGTGACAGAGTACCCAGGCTGGG + Intronic
1200944044 Y:8814533-8814555 TCTCACAGACTCCTCAGCCTGGG + Intergenic