ID: 1156223603

View in Genome Browser
Species Human (GRCh38)
Location 18:35079723-35079745
Sequence CTGGATACAGAAATCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156223603_1156223609 26 Left 1156223603 18:35079723-35079745 CCCTGTTAGATTTCTGTATCCAG 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1156223609 18:35079772-35079794 ACAGGAAAGCTTCGTAGAGGAGG 0: 1
1: 0
2: 5
3: 40
4: 383
1156223603_1156223607 8 Left 1156223603 18:35079723-35079745 CCCTGTTAGATTTCTGTATCCAG 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1156223607 18:35079754-35079776 AACAATTTTGTGTTGGAAACAGG 0: 1
1: 0
2: 2
3: 36
4: 360
1156223603_1156223608 23 Left 1156223603 18:35079723-35079745 CCCTGTTAGATTTCTGTATCCAG 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1156223608 18:35079769-35079791 GAAACAGGAAAGCTTCGTAGAGG 0: 1
1: 0
2: 1
3: 15
4: 136
1156223603_1156223606 1 Left 1156223603 18:35079723-35079745 CCCTGTTAGATTTCTGTATCCAG 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1156223606 18:35079747-35079769 ATAGTGAAACAATTTTGTGTTGG 0: 1
1: 0
2: 4
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156223603 Original CRISPR CTGGATACAGAAATCTAACA GGG (reversed) Intronic
900016708 1:155800-155822 CTGGATTCAGAAGTCTTTCATGG + Intergenic
900069172 1:756110-756132 CTGGATTCAGAAGTCTTTCATGG + Intergenic
900723111 1:4192973-4192995 CAGGATACAGAATTCTAGCCTGG + Intergenic
901743000 1:11354602-11354624 GGGGAAACAGAAAACTAACAAGG + Intergenic
904331843 1:29763935-29763957 CTTGATACAAAAATCTGACAAGG + Intergenic
904967076 1:34382987-34383009 CTGGATACAGAATTCTAGGTCGG - Intergenic
908575782 1:65458436-65458458 CTGGATACAGAATTCTAAATTGG + Intronic
909031877 1:70551017-70551039 CTGGATACAGAATTCTAGATTGG - Intergenic
909517742 1:76531543-76531565 CCAGATATAGAAATCTAGCAAGG + Intronic
910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG + Intergenic
911034678 1:93528441-93528463 CTGGATATAGAACTCTAAGTTGG - Intronic
912448642 1:109756534-109756556 CTGGACAAAAAAACCTAACAGGG - Intronic
912700300 1:111873293-111873315 CAGGAGACAGAAATCTAGCCAGG + Intronic
913386523 1:118263715-118263737 CTGGAGAGAAAATTCTAACAAGG + Intergenic
915384830 1:155480888-155480910 CTGGATTCAGAAGTCAAACTTGG + Exonic
915618690 1:157064436-157064458 ATGGATGCAGCAAACTAACATGG - Intergenic
915731801 1:158059205-158059227 CTGCAGAGAGAAATCTGACAGGG - Intronic
915877711 1:159629907-159629929 CAGGATAGAGAAATATTACAAGG + Intergenic
915965156 1:160300647-160300669 CTTGATACTAAAACCTAACAAGG + Intronic
916220517 1:162440189-162440211 CTGGTTACAGTATTCTAACATGG + Intergenic
917235305 1:172885485-172885507 CAGGAAATAGAAATGTAACATGG + Intergenic
917786151 1:178459677-178459699 TTGGATACAGAAATAGAAGAAGG + Intronic
918668532 1:187182546-187182568 CTTGATACTCAAATCAAACAAGG + Intergenic
921430094 1:215055707-215055729 CCAGATACAGAAATCCAACCAGG - Intronic
922102171 1:222486090-222486112 CTGGATTCAGAAGTCTTTCATGG + Intergenic
922104535 1:222501502-222501524 CTGGATTCAGAAGTCTTTCATGG + Intergenic
922263255 1:223961201-223961223 CTGGATTCAGAAGTCTTTCATGG + Intergenic
922264851 1:223974015-223974037 CTGGATTCAGAAGTCTTTCATGG + Intergenic
924345094 1:243066210-243066232 CTGGATTCAGAAGTCTTTCATGG + Intergenic
924346708 1:243079021-243079043 CTGGATTCAGAAGTCTTTCATGG + Intergenic
924754158 1:246926692-246926714 CTAAATACAGAAAACTAACCAGG + Intronic
924794086 1:247279857-247279879 CTGGAGTCAGACATCTCACATGG + Intergenic
1063526482 10:6791247-6791269 CTGGATATAGAAAGCAAAGAGGG - Intergenic
1065860631 10:29869919-29869941 CTGGATACAGTAATCTATTTGGG + Intergenic
1066267190 10:33787756-33787778 CTGGATGCAGAGCTCTAGCAAGG + Intergenic
1066679105 10:37919247-37919269 CTGGATACAGAATTCTAGACTGG - Intergenic
1066729640 10:38425828-38425850 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1066731242 10:38438867-38438889 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1067870677 10:49957857-49957879 CTGGGCACAGAAATCCAGCAAGG + Intronic
1067907858 10:50312629-50312651 CTGGGTACAGAATTCTAAGTGGG - Intronic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1069892879 10:71662847-71662869 CTGGAGTCAGAAATCTGAAATGG + Intronic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1071174816 10:82913558-82913580 CTGGCTACAGAATTCTAAATTGG + Intronic
1072382381 10:94888545-94888567 CTGGATACAGAAAGCAAAATGGG + Intergenic
1072393301 10:95012129-95012151 CTGGATACAGAAAGCAAAGTGGG + Intergenic
1073278534 10:102333968-102333990 CTGGATACAGAAATGTTAGAGGG + Intronic
1075143642 10:119864261-119864283 CTGGAGACAGAAGTCTGACATGG - Intronic
1075232696 10:120695817-120695839 CTCGATACTAAAACCTAACAAGG - Intergenic
1075858279 10:125650086-125650108 CATGAGACAGAAAGCTAACAAGG + Intronic
1076973298 11:150869-150891 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1077202923 11:1321365-1321387 CAGGATACAGAATTCTAGCTTGG - Intergenic
1078307123 11:10200600-10200622 CTGACTAAAGAAATTTAACAGGG - Intronic
1079914777 11:26355309-26355331 CTGGATAAAGAATTCTAAGATGG + Intronic
1080369012 11:31612395-31612417 CTGACTACAGAAATCTCAAATGG + Intronic
1081974967 11:47227822-47227844 CTTGATACACAAATGTGACAAGG - Intronic
1082907869 11:58331443-58331465 CTGGATACTAAAACCAAACAAGG - Intergenic
1083518978 11:63289400-63289422 CTGGATTCCCAAAACTAACATGG + Intronic
1083783538 11:64930841-64930863 TTGGATACACAAATCTATTATGG + Intronic
1085586955 11:77717552-77717574 CTGAATACTGAAACCTAAGAAGG + Intronic
1086066038 11:82746011-82746033 CTGGCTACAGCAATCAGACAAGG + Intergenic
1086435425 11:86775295-86775317 CTGGAGGCAGAAGCCTAACATGG - Intergenic
1087351319 11:97036192-97036214 CTGTATGCAGAAATCCAACATGG - Intergenic
1087626910 11:100605633-100605655 CTGGATACAAAATTCTGACTTGG - Intergenic
1087729222 11:101759579-101759601 CAGAATCCAGAAATCTATCAAGG - Intronic
1088823115 11:113473610-113473632 CTGAATGCAGACATCTGACAAGG - Intronic
1091013447 11:132027506-132027528 CTGGATACAGAATTCTAGATTGG + Intronic
1091953647 12:4617205-4617227 CTGGATATAGAATTCTAATTTGG - Intronic
1095608026 12:44093572-44093594 TTGGATTGAGAAATCAAACATGG - Intronic
1095750134 12:45701388-45701410 CTGGGTACAGAATTCTAAGTTGG + Intergenic
1098087398 12:66861566-66861588 CTGAATACAGAAATCCCACATGG + Intergenic
1098653138 12:73000270-73000292 CTGCATATAGAAATCTAAATAGG + Intergenic
1099093694 12:78344655-78344677 CTGGATACAGAATTCTTGAATGG - Intergenic
1099706533 12:86160625-86160647 ATTGAGACAGAAAACTAACAAGG - Intronic
1099864482 12:88261613-88261635 TTGGATATATAAATCTCACAAGG + Intergenic
1099892485 12:88606930-88606952 ATGGAGACAGAAAATTAACAAGG + Intergenic
1100512883 12:95294399-95294421 TTAGAAACAGAAATCCAACAAGG - Intronic
1102733349 12:115134737-115134759 CCGGATCCAGAAATCTTAGAAGG + Intergenic
1104868906 12:131980008-131980030 ATGCATACAGAAAACCAACACGG - Intronic
1105294969 13:19080149-19080171 CTGGATACAGAATTCTAGGTTGG - Intergenic
1106298947 13:28445174-28445196 CTAGATTCAGAAATGAAACAGGG + Intronic
1106356437 13:28987674-28987696 CTGGCAACAGAAAGCTAATATGG - Intronic
1106856645 13:33860688-33860710 CTGCAGACAGAAATATAACACGG - Intronic
1106994497 13:35465624-35465646 CTGGAAACAGAAATCTCAGCTGG + Intronic
1109356617 13:61237535-61237557 CTTGATAGAGAAATCTGATAAGG + Intergenic
1110819440 13:79897484-79897506 CAGGAAATAGACATCTAACAAGG - Intergenic
1111469219 13:88655686-88655708 CGGGATACAGAAATCTATCAAGG - Intergenic
1111866640 13:93776972-93776994 ATGGATAAGGAAATCTGACAGGG - Intronic
1112258395 13:97855994-97856016 CTGTTTACAGTAATCTACCATGG + Intergenic
1116594698 14:46826040-46826062 CTGGGAACATAAAACTAACAAGG + Intergenic
1117537088 14:56712843-56712865 CTGCAGGCAGAAATCTGACATGG - Intronic
1117709553 14:58511248-58511270 CTAGCTAAAGAAATCTAACAAGG - Intronic
1119163272 14:72471031-72471053 CTGCATGCAGAAAACTTACAGGG - Intronic
1119376516 14:74198436-74198458 CTGGATACTGTAATATAACAGGG - Intronic
1124875825 15:33592471-33592493 CTGGATACAGATATCCAACAAGG - Intronic
1125056520 15:35364561-35364583 CTGGGTACAGAATTCTAGGATGG + Intronic
1126670781 15:51113401-51113423 CTGGATACCGAATTTCAACATGG + Intergenic
1127747697 15:61997431-61997453 CTGGATATAGAAATGTAGGAAGG - Intronic
1131600428 15:93842300-93842322 CTGGATACAAAATTCTAAGTTGG + Intergenic
1131892724 15:96991145-96991167 CTGGATACAGAATTCTAGGTTGG + Intergenic
1135815055 16:25624968-25624990 CTGGATACAGGAATATTTCATGG - Intergenic
1142446953 16:90146657-90146679 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1142460538 17:88674-88696 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1143763369 17:9120973-9120995 CTGGAGACAGAAAACCATCAGGG + Intronic
1146488965 17:33266198-33266220 TTGTATACAGAACTCAAACAGGG - Intronic
1146688711 17:34858305-34858327 CTTGGTACAGATATCTAGCAAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149053098 17:52329976-52329998 CTTGATAAAAGAATCTAACATGG + Intergenic
1149946037 17:60928492-60928514 CTGAATACAGATATCTAAACAGG - Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156743196 18:40357993-40358015 CTGGACACAGAACTGTCACATGG - Intergenic
1156821606 18:41379726-41379748 CTGAATACACAAATCTGAGATGG + Intergenic
1158098894 18:53806760-53806782 ATGGAGACAGAAAATTAACAAGG + Intergenic
1159199259 18:65162634-65162656 CTTGTTACAGAAATCTATCTAGG - Intergenic
1159328390 18:66954158-66954180 ATGGATACAGCAAACCAACATGG + Intergenic
1160650254 19:221174-221196 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925455629 2:4014338-4014360 CTGGCTGCAGAAAGCTCACATGG + Intergenic
929040290 2:37738034-37738056 CTAGGTCCACAAATCTAACATGG - Intronic
929102280 2:38327076-38327098 CTGGATACAGAATTCTAGTTTGG - Intronic
931489722 2:62731970-62731992 CTGGATACAGAATTCTAGGTTGG + Intronic
931751546 2:65334827-65334849 CTGGTTACAGAAGTCTAATTAGG + Intronic
932931762 2:76049458-76049480 CTGGATACAGCAATCTTGGATGG + Intergenic
936225382 2:110644786-110644808 CTGGATACAGAATTCTAGATTGG - Intronic
936243659 2:110808522-110808544 CTGGATACAGAAACAGAACTTGG - Intronic
936748952 2:115617026-115617048 CTGAATAATGAAATTTAACATGG - Intronic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
939431076 2:142108880-142108902 CTGGAGACAAAAATATAACTAGG - Intronic
941648227 2:168064973-168064995 CAGGTTACAGAAATCCAACCAGG + Intronic
941694109 2:168532617-168532639 AATGATACAAAAATCTAACATGG - Intronic
941845125 2:170124797-170124819 GTGGAGACAGAATTCTAACCAGG + Intergenic
941949716 2:171141696-171141718 CTGGATACAGAAATCTTGGTTGG - Intronic
942549584 2:177100979-177101001 CTGGATAAAGAAATCCCAAAAGG + Intergenic
944480297 2:200150859-200150881 CTGGATATAGAATTCTAAGTTGG - Intergenic
944783113 2:203040284-203040306 CTGGAGGCAGAAATGTGACAAGG + Intronic
945024032 2:205603402-205603424 ATGGAGACAGAAAATTAACAAGG - Intronic
948457389 2:238111991-238112013 TTTGATACCAAAATCTAACAAGG - Intronic
1168960544 20:1866510-1866532 CTGGATACAGGAACTCAACAGGG - Intergenic
1170151813 20:13234322-13234344 CTGGGTAAAGAAATATACCATGG - Intronic
1170903215 20:20486351-20486373 CTGGATACAGAATTCTAGGTTGG + Intronic
1172735196 20:37121618-37121640 CAGCATAAAGAAATCTAACTAGG + Intronic
1174220613 20:48951821-48951843 CTGGCAGCAGAAATCGAACAGGG - Intronic
1175395432 20:58655822-58655844 CTGGATGCTGAAATCTAAAAAGG - Intronic
1177290046 21:19099027-19099049 GTGGATACATAAATTTAACCAGG + Intergenic
1177957542 21:27618481-27618503 CTGGATAAAGAATTCTGACTTGG + Intergenic
1177969097 21:27766149-27766171 CTGCATATAAAAAACTAACAGGG - Intergenic
1178288423 21:31345371-31345393 CTGGAAACAGTACTCTAAAAAGG + Intronic
1179417100 21:41207800-41207822 TTGGATGCAGAAACCAAACATGG - Intronic
1183041999 22:35188094-35188116 CTTGATACAGAATTCTAATCTGG - Intergenic
1184112560 22:42403897-42403919 CTGGATCCAGAAAGCAAAGAAGG + Intronic
1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG + Intronic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
949127420 3:463053-463075 CTGGATATAGACTTCTGACAGGG + Intergenic
950852280 3:16073663-16073685 ATGGATACAGAAAATTACCAAGG - Intergenic
951142475 3:19180955-19180977 CTAGAGACAGAAATATAACATGG + Intronic
952505346 3:34002287-34002309 CAGGATACAGAAAGCTCCCAAGG - Intergenic
952842341 3:37658241-37658263 CATGAGACAGAAAACTAACAAGG - Intronic
953703838 3:45216542-45216564 CAGGATATTGAAATCTATCAAGG - Intergenic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
955555669 3:60134606-60134628 CTAGATTCACAAATCTTACAAGG + Intronic
957691050 3:83569072-83569094 CTGGAAACAGAAATCTGGTAGGG + Intergenic
958073661 3:88648254-88648276 CTGGATACTAAAACCTAATAAGG + Intergenic
958486830 3:94723056-94723078 CTGAATCCAGAAATCTATCTTGG - Intergenic
958684446 3:97375014-97375036 CTGGGTACACAAAATTAACAAGG + Intronic
959196554 3:103190096-103190118 CCTGACACAGAAATCTAACCAGG - Intergenic
960983202 3:123251152-123251174 AGGGAAACTGAAATCTAACATGG - Intronic
962674403 3:137743918-137743940 TTGGGCACAGAAATTTAACAAGG - Intergenic
964467667 3:157015066-157015088 CTGGAAACAGAAGTCAAACAAGG + Intronic
966753455 3:183345008-183345030 ATGGATTCAGAAAATTAACAAGG + Intronic
966970102 3:185037238-185037260 CTGGATATAGAAATCTTAGTGGG + Intronic
967720125 3:192807388-192807410 AAGGATACAGAAATATATCAGGG + Intronic
968367592 3:198198955-198198977 CTGGATTCAGAAGTCTTTCATGG - Intergenic
969456147 4:7300782-7300804 CTGCAGACAGAAATCAAGCAAGG - Intronic
970517053 4:16843156-16843178 CTGGATATAGACATTGAACAAGG - Intronic
972058610 4:34837628-34837650 ATGGATGCAGCAATCTACCATGG - Intergenic
972577932 4:40369006-40369028 CTGGATAAGGAAATGTAAAAAGG - Intergenic
972876140 4:43362980-43363002 CTGCATACTGAATTCTAACCTGG + Intergenic
973203375 4:47531229-47531251 CTGGATACAGACATCTGATAGGG + Intronic
974338094 4:60577682-60577704 CTGGATATAGAAGTCTAGCTGGG - Intergenic
974720121 4:65727238-65727260 ATGGAGACAGAAAATTAACAAGG + Intergenic
975051827 4:69874816-69874838 TTGAATACAGGAATTTAACAGGG + Intergenic
975320211 4:73001633-73001655 CTGGAGAAAGAAAACTAACTAGG - Intergenic
977593241 4:98849788-98849810 CCTGATACAAAAATCCAACAAGG - Intergenic
978199642 4:106010888-106010910 CTGAAAACATAAATCTAACAGGG - Intergenic
978506509 4:109463531-109463553 CAGGATACAGTACTCTAACGTGG + Exonic
978647467 4:110953986-110954008 CTGATTTCAGAAATCTAACAAGG + Intergenic
978688457 4:111478530-111478552 CAGGAGACAGAAAACTAAGAAGG + Intergenic
979256006 4:118608667-118608689 CTGGATTCAGAAGTCTTTCATGG - Intergenic
979257620 4:118621472-118621494 CTGGATTCAGAAGTCTTTCATGG - Intergenic
979330727 4:119419075-119419097 CTGGATTCAGAAGTCTTTCATGG + Intergenic
979332338 4:119431870-119431892 CTGGATTCAGAAGTCTTTCATGG + Intergenic
979853953 4:125609144-125609166 CTGGAGACAATAATCTGACATGG + Intergenic
980593468 4:134923096-134923118 ATGGATACAGCAAACCAACATGG - Intergenic
982351777 4:154423252-154423274 CAGGATACAGAAATCTATAGAGG - Intronic
983546405 4:168969131-168969153 CTGGAGAAAGGAATCTAACCAGG - Intronic
985207667 4:187557314-187557336 CTGGATACAGAATTCTAGGTTGG + Intergenic
985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG + Intergenic
986792035 5:11171257-11171279 GTGGTTACAGAAATCTCCCATGG + Intronic
987155606 5:15086858-15086880 CACCAAACAGAAATCTAACACGG - Intergenic
988769393 5:34416049-34416071 CTAGAGACAGAAATGTAAGAGGG + Intergenic
988942280 5:36158619-36158641 ATGGAAACAGAAATCAATCAGGG - Intronic
990327078 5:54688861-54688883 CAGGATACAGAAATCTAAGCTGG + Intergenic
993815707 5:92542472-92542494 ATGGATGCAGAAAACCAACATGG + Intergenic
993946865 5:94125551-94125573 CTGGATACAGAACTCTAGGTTGG - Intergenic
994785378 5:104154655-104154677 CTGGATATAGAATTCTAAGTTGG + Intergenic
995564386 5:113418514-113418536 CTGGGTAAAGAAATTTCACATGG - Intronic
996041773 5:118822130-118822152 CTGTGCACAGAAATATAACATGG - Intergenic
997115300 5:131120388-131120410 ATCGAGACAGAAATTTAACAAGG - Intergenic
997292104 5:132744950-132744972 CTGAATACAGAATTCTAGGATGG + Intergenic
997785397 5:136706884-136706906 CTGACTACAGAAATATTACAAGG + Intergenic
999973542 5:156888845-156888867 CTGAATACAGATATCAGACAGGG + Intergenic
1002726815 5:181304184-181304206 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1003199734 6:3948161-3948183 CTGGACACAGAATTCTAAGTTGG + Intergenic
1004303386 6:14478352-14478374 ATAGATACAGAATTCAAACATGG - Intergenic
1004567292 6:16809790-16809812 CTGGATACAGAATTCTATGTTGG + Intergenic
1007944565 6:45813937-45813959 CTGGATGCAGGAAGCAAACAGGG + Intergenic
1008428970 6:51392458-51392480 CTCTATACAGATATCTAACCAGG - Intergenic
1009375876 6:62968066-62968088 CTGGATTCAGAAAGCAAAAATGG + Intergenic
1009711651 6:67329965-67329987 CAGTATACAGAACTCAAACAGGG - Intergenic
1009836328 6:69005933-69005955 CTGGCAACTGAAAACTAACAAGG - Intronic
1010147706 6:72690662-72690684 CTGCATACAGAACTCTAATGGGG + Intronic
1010595673 6:77760687-77760709 CAGGATACACTAATCTAACAAGG + Intronic
1010912897 6:81581125-81581147 CAGGAGACAGAAAGTTAACAAGG + Intronic
1013549270 6:111191097-111191119 ATGGATACAGCAAACTACCATGG - Intronic
1013726731 6:113106933-113106955 ATGGGTGCAGCAATCTAACATGG + Intergenic
1015986599 6:138890824-138890846 CTGGATACAGAATTCTAGGTTGG + Intronic
1016572458 6:145530454-145530476 ATTGATACAGAAATGTAGCAAGG + Intronic
1017669628 6:156757635-156757657 CTGGATAAAGAATTCTATCCTGG + Intergenic
1017921532 6:158876991-158877013 CTGGATACAGAATTCTAGGTTGG + Intronic
1017932402 6:158969276-158969298 CTGGATACAGAATTCTTGAATGG + Intergenic
1019750822 7:2728276-2728298 CTGGGCACAGACATCTAACCTGG - Exonic
1020827103 7:13042856-13042878 CATGATCCAGAAATGTAACAGGG - Intergenic
1022068372 7:26885059-26885081 CTGGGTACAAAATTCTTACATGG + Intronic
1022633414 7:32107531-32107553 CTGGCTACAGAATTCTAAGTTGG - Intronic
1023398139 7:39771036-39771058 CTGGATTCAGAAATCTTTCATGG - Intergenic
1023399604 7:39782744-39782766 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1023877677 7:44296796-44296818 CTGGATACAGAATTCTAGGTTGG - Intronic
1024071706 7:45791797-45791819 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1024072540 7:45798548-45798570 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1024427066 7:49238653-49238675 CTGGATACAGAATTCTGAGTTGG + Intergenic
1024650793 7:51401634-51401656 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1025009105 7:55381317-55381339 CGGGAACCAGAAATCTAAGATGG + Intronic
1025054914 7:55757214-55757236 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1025132986 7:56387440-56387462 CTGGATTCAGAAGTCTTTCATGG + Intergenic
1025134520 7:56399459-56399481 CTGGATTCAGAAATCTTTCATGG + Intergenic
1026213965 7:68331856-68331878 CTGGTTGAAGAAATCCAACAAGG - Intergenic
1028774269 7:94659828-94659850 CTGGAAACACAATTCTTACATGG - Intronic
1029018164 7:97336111-97336133 ATGGGTACAGCAAACTAACATGG + Intergenic
1029816376 7:103100100-103100122 CCTGATACAGAAATCAAACTTGG + Exonic
1030993719 7:116332703-116332725 CTGGATAAAGAAATATTATAAGG - Intronic
1031808645 7:126338528-126338550 GTGAATACAGCAATCTAAAAAGG - Intergenic
1032048325 7:128629403-128629425 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1032535646 7:132661272-132661294 CAGGATACAGACATCTGACTCGG - Intronic
1032987903 7:137359277-137359299 CTGGATACATAGATATAACCAGG - Intergenic
1033472378 7:141661650-141661672 CTGGATTCCAAAATCTAGCAAGG - Exonic
1034244661 7:149635385-149635407 CTGGGGACAGAACTCTAACTGGG - Intergenic
1036151052 8:6299097-6299119 CTGGATACTAAAACCTAATAAGG - Intergenic
1036294861 8:7527597-7527619 CTGGAAGCAGAACTCTCACATGG - Intergenic
1036296496 8:7542177-7542199 CTGGAAGCAGAACTCTCACATGG - Exonic
1036326070 8:7778842-7778864 CTGGAAGCAGAACTCTCACATGG + Exonic
1036327702 8:7793394-7793416 CTGGAAGCAGAACTCTCACATGG + Intergenic
1036450783 8:8865407-8865429 CTGGATACAAAAATCAGAAATGG + Intronic
1039154328 8:34537995-34538017 ATTGAGACAGAAAACTAACAAGG + Intergenic
1041988031 8:63950245-63950267 CTGAATCCAGAAAACAAACATGG - Intergenic
1042358803 8:67859159-67859181 CTGGATACAGAATTCTAGGTTGG - Intergenic
1042582837 8:70300948-70300970 ATAGATACAGAAACCTAACTGGG + Intronic
1043190755 8:77219957-77219979 CTGGGTTCAGAAATCAAAGAAGG + Intergenic
1043292583 8:78621483-78621505 CTGGATATAGAATTCTAAGTTGG + Intergenic
1043748019 8:83900344-83900366 CTCGAGACAGAAAGTTAACAAGG + Intergenic
1043963749 8:86447822-86447844 CTGGATAAGGAAATATAAAAGGG - Intronic
1044686174 8:94827968-94827990 CTAGATACAGAGTTCTAAGAAGG + Intronic
1044758818 8:95495222-95495244 CAGTCTACAGAAATCAAACAAGG - Intergenic
1045268014 8:100637055-100637077 CTGGTTACAGAATTCCAATAAGG + Intronic
1046003826 8:108454840-108454862 CAGGATACAGAATTCTAAGTTGG + Intronic
1046281481 8:112038840-112038862 TTAGACACAGAATTCTAACATGG - Intergenic
1047368997 8:124239657-124239679 CTGGGTACAGCAAACCAACATGG - Intergenic
1048413384 8:134199074-134199096 CTGAACACAGAAAGCTAAAAGGG + Intergenic
1050035369 9:1430013-1430035 CTGGGTACACAAATGTAACCTGG - Intergenic
1050869477 9:10549271-10549293 TTGGATGTAGAAGTCTAACAGGG - Intronic
1053395780 9:37772883-37772905 CTCAATACAGAATTCAAACAAGG - Intronic
1055700981 9:78945691-78945713 CTGGATACAGAAATATTGCCTGG - Intergenic
1055780248 9:79813332-79813354 ATTGGTACAGAAATATAACAAGG - Intergenic
1055806581 9:80101984-80102006 TTGGATATAGAAATGTAAAATGG - Intergenic
1056289912 9:85132697-85132719 CTGGGTACAGCAAACTAACATGG + Intergenic
1056350404 9:85743002-85743024 CTGAATAAAGACATCTACCAAGG - Intergenic
1056352007 9:85759210-85759232 CATGAGACAGAAATTTAACAAGG + Intergenic
1057264860 9:93609531-93609553 CTGGATACAGAATTCTAGGTTGG + Intronic
1059078144 9:111217233-111217255 CTGGATGAAGAATTGTAACACGG + Intergenic
1060007120 9:120010402-120010424 CTAGGTAAAGAAAACTAACAGGG + Intergenic
1062751933 9:138261660-138261682 CTGGATTCAGAAGTCTTTCATGG - Intergenic
1185711430 X:2306767-2306789 CTTGATACCAAAATCTGACAAGG - Intronic
1193237029 X:79119963-79119985 CTTGATACCAAAATCAAACAAGG - Intergenic
1193754873 X:85396125-85396147 TTGGATACAGAAAAATAAAATGG - Intergenic
1194205803 X:91009688-91009710 ATGACTACAGAGATCTAACATGG - Intergenic
1195339097 X:103887699-103887721 CAGGATACAGAAAGATAACTTGG + Intergenic
1195613709 X:106896291-106896313 CCAGATACAGAAAGCCAACAAGG - Intronic
1196213473 X:113022805-113022827 CTGGATACAGAATTCTAGGTTGG - Intergenic
1196800367 X:119537849-119537871 CTGGATACAGGAAAATAACTGGG + Intergenic
1199780848 X:151057957-151057979 CTGGATATAGAATTCTAAGTTGG + Intergenic
1200551561 Y:4584499-4584521 ATGACTACAGAGATCTAACATGG - Intergenic
1201013211 Y:9571359-9571381 AAGGAGACAGAAAGCTAACAAGG - Intergenic
1201520109 Y:14863678-14863700 AAGGAGACAGAAATTTAACAAGG + Intergenic