ID: 1156224175

View in Genome Browser
Species Human (GRCh38)
Location 18:35086623-35086645
Sequence AATTATATGTAAAAATTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 1, 1: 0, 2: 7, 3: 115, 4: 1084}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156224175_1156224177 2 Left 1156224175 18:35086623-35086645 CCTTTCAATTTTTACATATAATT 0: 1
1: 0
2: 7
3: 115
4: 1084
Right 1156224177 18:35086648-35086670 CTAAAAGCAGCATAGAAAAAAGG 0: 1
1: 0
2: 7
3: 60
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156224175 Original CRISPR AATTATATGTAAAAATTGAA AGG (reversed) Intronic
900256174 1:1699488-1699510 ACATAAATGTAAACATTGAATGG + Intronic
900264843 1:1752098-1752120 ACATAAATGTAAACATTGAATGG + Exonic
901687737 1:10953142-10953164 AACTATATTTAAAGATTAAAAGG - Intronic
901984361 1:13062423-13062445 AATTAAAAGCAAAAATTGCAGGG - Intronic
901997449 1:13164347-13164369 AATTAAAAGCAAAAATTGCAGGG + Intergenic
902094546 1:13932152-13932174 TATTAAATGTAAAACTTGACTGG - Intergenic
902545637 1:17188122-17188144 AATTATATGTAAACATACATTGG - Intergenic
902730020 1:18363167-18363189 TATAAAATGTCAAAATTGAAAGG - Intronic
904816003 1:33199425-33199447 AAATATATTTCAAAAATGAAGGG + Intergenic
904981405 1:34505858-34505880 AATCAAATTTAAAAATTGCAGGG - Intergenic
905087628 1:35396287-35396309 ATTTAGATGGATAAATTGAAAGG - Intronic
905097386 1:35485483-35485505 AATAAAAAGTAAAAATTAAAGGG - Intronic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
906830268 1:49023718-49023740 AATTATATGTGAAAAGTTAATGG - Intronic
906888801 1:49684214-49684236 AATTTTATGTAAAATTTTATGGG - Intronic
907059134 1:51403221-51403243 TTTTATATGTATAAATTCAAGGG + Intronic
907196917 1:52694535-52694557 ATTTATTTGTATAAATTTAAGGG - Intronic
907489934 1:54802437-54802459 TTTTATATTTAAAAATTGACAGG - Intergenic
908100582 1:60786912-60786934 AATTATATGTACAAAGAGCAGGG - Intergenic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
908351931 1:63294464-63294486 AATTATAGGTACAATTTTAAGGG + Intergenic
908464597 1:64379783-64379805 AAGTCTATGTTAAAATTCAAAGG - Intergenic
908998451 1:70188044-70188066 AATTATATGAGAAAAGAGAAAGG + Intronic
909217466 1:72908697-72908719 AAATATATTTAAAAAATGGATGG + Intergenic
909253184 1:73384258-73384280 AAATATATGTAAAAATGGAATGG + Intergenic
909345133 1:74576253-74576275 AATTATTTGTAAGCAATGAAAGG - Intronic
909466849 1:75982409-75982431 AAATATATGTATATATGGAAGGG - Intergenic
909692807 1:78429110-78429132 AATTAAATGTAAAAAGTGGTTGG + Intronic
909702469 1:78542696-78542718 TATTATATATAAAAAATAAAAGG - Intergenic
910053337 1:83002489-83002511 AATTATCACTAAAAACTGAATGG + Intergenic
910135268 1:83960854-83960876 CATTGTGTGTACAAATTGAAAGG + Intronic
910403488 1:86859995-86860017 ATTAATATATTAAAATTGAATGG + Intergenic
910418029 1:87022176-87022198 AATTATCTTTAAAAAATGAAAGG - Intronic
910783563 1:90968777-90968799 ATTTATCTGTATATATTGAAAGG - Intronic
910896517 1:92075695-92075717 AACTATATATAAAAATTTAATGG - Intergenic
910914194 1:92271833-92271855 GATTATATGACAAAAGTGAAGGG + Intronic
911172868 1:94788013-94788035 AAATTTATGTGAAAATTCAAAGG + Intergenic
911373343 1:97020945-97020967 AATTATCTTTCAAAAGTGAAGGG + Intergenic
911502615 1:98706970-98706992 AGTTACATGTAAAAATTCATAGG + Intronic
911574566 1:99559744-99559766 AATTTTATGGTAATATTGAATGG - Intergenic
911824740 1:102467425-102467447 AATTATATATATAAATATAATGG - Intergenic
911906753 1:103578958-103578980 AATTACTTTTAAAAATTTAAAGG - Intronic
911925948 1:103832523-103832545 AAAAATATGTAAATATTGATAGG + Intergenic
912148584 1:106826556-106826578 AAATGTATGTAAAGATTTAAAGG - Intergenic
912360074 1:109087920-109087942 AATTATCTCTAAAAAGTGAGTGG + Intergenic
913232922 1:116756613-116756635 TAGTATATGGACAAATTGAATGG - Intronic
913350053 1:117847900-117847922 AGTTATTTGTAAAGATTGAAAGG - Intergenic
913404486 1:118474434-118474456 GAGTATATGTAAAAATGGGAGGG - Intergenic
915830334 1:159123181-159123203 ATTTGTATGTAAATATTAAAGGG - Intronic
916316404 1:163453154-163453176 AATTAGAAATAAAACTTGAAGGG + Intergenic
916352542 1:163867773-163867795 AATTCTAGGTGGAAATTGAAAGG - Intergenic
916384628 1:164253524-164253546 ACTTATTTCTAAAAATTGTAAGG - Intergenic
916549495 1:165836485-165836507 AATTATATGTCAAAATACAGTGG + Intronic
917185020 1:172343871-172343893 AATAACATGTAAAAATAAAATGG - Intronic
917576832 1:176331384-176331406 AATCATATGTAGAATTTGAATGG + Intergenic
917986851 1:180329034-180329056 AATTATATGCAAAAGTTTACAGG - Intronic
918212211 1:182361111-182361133 TATTAAATGTTAAAATTAAATGG - Intergenic
918456967 1:184731030-184731052 AATTATCTTCAAAAATTGTATGG - Intronic
918673201 1:187246849-187246871 AATTCTTTCCAAAAATTGAAGGG - Intergenic
918832141 1:189412163-189412185 AATTATATGAAAAAAGTCATTGG + Intergenic
918846417 1:189620776-189620798 TATTTTAAGTAAAAATTAAAGGG + Intergenic
919131404 1:193455534-193455556 AAATATATGTAAAAATATATGGG + Intergenic
919146022 1:193636044-193636066 CATTATATTTACAAATTAAACGG + Intergenic
919155480 1:193760011-193760033 AAATTTATGTGAGAATTGAAAGG + Intergenic
919284226 1:195532842-195532864 AATTAAATGTAAAAAAAGTAGGG + Intergenic
919410011 1:197231327-197231349 AATCACATTTAAAATTTGAAAGG + Intergenic
919424053 1:197406640-197406662 ATTTATATTTACAAAATGAATGG + Intronic
919468079 1:197946358-197946380 AATTATTTATATAAATTTAAGGG + Intergenic
919475867 1:198033251-198033273 AATAATATGTAAAAAGTTAAGGG + Intergenic
919862493 1:201749945-201749967 AGTTATATGTAGGACTTGAAAGG + Intronic
920385255 1:205567039-205567061 AAATATATGTAAAAACTTATTGG - Intergenic
920636685 1:207711063-207711085 AATTATATTGAAAAATTATATGG + Intronic
920998737 1:211020592-211020614 AACTATTTTTAAAAATTGAAGGG + Intronic
921059506 1:211571387-211571409 AATTGCAATTAAAAATTGAAAGG - Intergenic
921115841 1:212090444-212090466 AATTATAGTTAACAATTCAAAGG + Intronic
921241041 1:213182957-213182979 ATATATATGTAAAAAGTAAAAGG + Intronic
921274350 1:213504068-213504090 AACTATATGTATATATAGAACGG + Intergenic
921403160 1:214748971-214748993 ATTTATGGGTAAGAATTGAATGG - Intergenic
921553813 1:216571867-216571889 AATTATTAGTAAAAATTGACAGG + Intronic
921735838 1:218627409-218627431 ACTTATGTTTAAAAAATGAAAGG + Intergenic
921973426 1:221175753-221175775 AATTTAAAGTGAAAATTGAAAGG + Intergenic
922299604 1:224285792-224285814 AATTGCATGTTAAAATTGATAGG + Intronic
922993397 1:229936204-229936226 TACTATATATAAAAATTAAATGG + Intergenic
923392631 1:233529368-233529390 AATTAAATTAAAGAATTGAAAGG - Intergenic
923975676 1:239259323-239259345 TATTATATGTAAAAACTGTTTGG + Intergenic
924075764 1:240334692-240334714 AATTTTATGTAAAGCTTGACTGG - Intronic
924140205 1:241014193-241014215 AATAAAATGTAGAAAATGAAAGG - Intronic
924281952 1:242447198-242447220 AATTTTATTTACAAATTTAAAGG - Intronic
924313479 1:242771756-242771778 AATAACTTGTAAAAAGTGAAAGG + Intergenic
924482970 1:244453330-244453352 AATGATTTTAAAAAATTGAATGG - Intergenic
924533480 1:244913710-244913732 AATTATATATTAAATTGGAATGG - Intergenic
924818515 1:247464638-247464660 AATTATATGTTACAAATCAAGGG + Intergenic
924930781 1:248730527-248730549 AATTATATATAAAATCTTAATGG + Intronic
1063010378 10:2015940-2015962 AATTATACGTGCAAATTTAATGG + Intergenic
1063518400 10:6719224-6719246 AATTATTTGTATAGATTTAAGGG + Intergenic
1063576417 10:7265958-7265980 AATTAAATTTAAAAAATAAAAGG + Intronic
1064499825 10:15958504-15958526 ACAAAAATGTAAAAATTGAAAGG - Intergenic
1064547659 10:16466828-16466850 AAGTTTATTTAAAAATTAAACGG + Intronic
1064591441 10:16896127-16896149 AATGATATGGAAAAGTTGAAAGG - Intronic
1064697027 10:17977208-17977230 AATTATATTTAAAGAATTAAAGG - Intronic
1064745447 10:18474206-18474228 AATAATGTGTTAGAATTGAAAGG + Intronic
1064891503 10:20179630-20179652 AATTATATTAAAAAATGAAATGG - Intronic
1064917075 10:20470955-20470977 AATAATAGGTTAAAAGTGAAAGG + Intergenic
1065037989 10:21660123-21660145 AATTATAAGAAAAAATTAGATGG - Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1065420955 10:25543480-25543502 AATTTTTTGTATAAATTTAAGGG + Intronic
1065515717 10:26522585-26522607 AATTATGTTTACAAATTGATGGG + Intronic
1065727571 10:28680489-28680511 AATTACATGTAAAACTTGTGAGG + Intronic
1065917237 10:30364262-30364284 ATTTATTTGTAAAAAGTTAAAGG - Intronic
1066537339 10:36406245-36406267 AATAATATGTAAAACTTCAATGG - Intergenic
1066744434 10:38592371-38592393 AATCAAATGGAATAATTGAATGG + Intergenic
1066744445 10:38592492-38592514 AATCAAATGGAATAATTGAATGG + Intergenic
1066949679 10:42103800-42103822 AATTTAATGGAATAATTGAACGG + Intergenic
1066955474 10:42166268-42166290 AATTGAATGGAATAATTGAATGG + Intergenic
1067300528 10:45004086-45004108 AATAAAAAGTAAAAAATGAAAGG + Exonic
1067355531 10:45521669-45521691 AATTATACGAAATAATTTAAAGG - Intronic
1067574090 10:47396834-47396856 AAGGATATGTGAAAAGTGAAGGG + Intergenic
1068053260 10:51979507-51979529 AACTATTTCCAAAAATTGAAAGG - Intronic
1068383127 10:56285392-56285414 AATCATCTGTAATAATTGTAAGG + Intergenic
1068446518 10:57131689-57131711 AACTATATTTATTAATTGAATGG - Intergenic
1068642887 10:59430769-59430791 AAATATATTTAAAAACTTAATGG + Intergenic
1068782029 10:60930019-60930041 AAGTAAATGAAACAATTGAAAGG + Intronic
1068852055 10:61753947-61753969 AATTACATATAAAAATAGCATGG + Intronic
1069179918 10:65345728-65345750 AATTAAATTTACAAATTTAATGG - Intergenic
1069230258 10:66000003-66000025 AAGTATGTATAAAAATGGAATGG - Intronic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1070054280 10:72919987-72920009 AACTATTTCAAAAAATTGAAAGG - Intronic
1070185649 10:74059840-74059862 AAATATATGAAAGAATTTAAAGG + Intronic
1070687657 10:78501194-78501216 CATTATGTGTTAAAATTGAAAGG + Intergenic
1071195237 10:83151435-83151457 CAATATATGTAAAAGTTAAAAGG - Intergenic
1071371928 10:84960224-84960246 AATTATATATAAAGAATAAAAGG + Intergenic
1071697723 10:87895239-87895261 AATTAGATGTTAAAATGGATGGG + Intronic
1071855794 10:89623075-89623097 AATTTTGTCTAAAAATTAAATGG + Intronic
1072536327 10:96366620-96366642 AAGTATATGTAAAAGGTGAAAGG - Exonic
1073355780 10:102853017-102853039 AAATGTTTGTTAAAATTGAATGG + Intergenic
1073808144 10:107122465-107122487 AATTATAGATAAAAATAGCATGG + Intronic
1073861153 10:107742635-107742657 AATTATGTGTAATAAATTAAAGG + Intergenic
1073916162 10:108406787-108406809 AATTATTTTTAAAAACTGAAGGG + Intergenic
1074624178 10:115161422-115161444 ATTTAAATGTGAAAATTAAAAGG + Intronic
1074835607 10:117290024-117290046 TATTATAAATAAAAATTCAAAGG - Intronic
1074988312 10:118677782-118677804 CATTATGTGTAATAATTAAAAGG - Exonic
1075028642 10:119005527-119005549 AAATGTATGTAAAGATTTAATGG + Intergenic
1075259712 10:120952200-120952222 AATCATATGGAAAAAATTAAAGG + Intergenic
1075412157 10:122236307-122236329 AATTATGAGAAGAAATTGAATGG - Intronic
1075508271 10:123046191-123046213 AATAATATGTTAAAAATTAAAGG - Intronic
1075678018 10:124309812-124309834 AATTATAAAAAAAAATTAAATGG + Intergenic
1076205774 10:128601039-128601061 ATTTAAATGAAAAAAATGAAAGG - Intergenic
1076621459 10:131791613-131791635 AATTATCTGCAAAGACTGAACGG + Intergenic
1078201022 11:9183395-9183417 AAAAATATGTAAAAATTTAAAGG - Intronic
1078804863 11:14688654-14688676 AATTAGAAATAAAAAGTGAATGG - Intronic
1078817638 11:14842413-14842435 AAATATATTTTAAAATTGTAGGG + Intronic
1079073906 11:17371504-17371526 AAAAGAATGTAAAAATTGAATGG - Intronic
1079436943 11:20464867-20464889 AATTAAATGTAAAGAGTTAAAGG - Intronic
1079504891 11:21142478-21142500 AGTTATATATAAAAATAGGATGG + Intronic
1079607380 11:22387049-22387071 AATTTTATCTTATAATTGAAGGG + Intergenic
1079643965 11:22840284-22840306 AATTATAGGTTAAAAATAAAAGG + Intergenic
1079646129 11:22865656-22865678 AATTTTATGTAAAAATAAACAGG + Intergenic
1079776246 11:24532823-24532845 AATTATAGTTAAAAATTCAAAGG - Intronic
1079782681 11:24627887-24627909 AAATATATGCACACATTGAAGGG - Intronic
1079876420 11:25862894-25862916 AATTACATGTGAAAATTCCAGGG - Intergenic
1080177888 11:29388962-29388984 AATTACAATTGAAAATTGAAAGG - Intergenic
1080526372 11:33125176-33125198 AATTAGATGGAAAATATGAAAGG - Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080676229 11:34430111-34430133 AAATATATTTAAAAATGAAATGG + Intergenic
1080714019 11:34780656-34780678 AAATTTATGTGAAAATTTAATGG - Intergenic
1080939724 11:36901957-36901979 ATTTATCGGTAAAACTTGAAGGG + Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1081353685 11:42087280-42087302 AAATATATCTAAATATAGAAAGG + Intergenic
1081471301 11:43373680-43373702 ATTTATATGGGCAAATTGAAAGG + Intronic
1081949091 11:47027358-47027380 AATTATATGCAAAGATCCAATGG + Intronic
1082845510 11:57721990-57722012 AATTAATTTTAAAAATTGAGGGG + Intronic
1083449514 11:62733689-62733711 AATTTTATATAAAAAATTAATGG + Intronic
1083573267 11:63771281-63771303 AATTAGATGAAAAAAATGTAAGG - Intergenic
1085543468 11:77295298-77295320 CATTCTTTGTAAAAATTAAATGG + Intronic
1085992917 11:81872782-81872804 AATTAGATATAATAACTGAATGG + Intergenic
1086175855 11:83890129-83890151 AATTTTATATAAAAATAGAGAGG + Intronic
1086534155 11:87823421-87823443 AAATATATATGAAAATTCAATGG + Intergenic
1086678601 11:89640734-89640756 AAGTATAAGTAAAAATTGATAGG + Intergenic
1086848524 11:91781999-91782021 AATTAAATGTAAAAAGAAAAAGG + Intergenic
1087489529 11:98806591-98806613 TATTATTTGTATAAATTTAAAGG + Intergenic
1087527613 11:99337111-99337133 AATATTAGGAAAAAATTGAACGG - Intronic
1087763307 11:102124687-102124709 AATTAAAAGTTAAAGTTGAAGGG - Intronic
1088087489 11:105998469-105998491 AATTAAAATTATAAATTGAAAGG + Intronic
1088162588 11:106890643-106890665 AATTTTGTGTAAAAATTGATTGG - Intronic
1088648854 11:111939631-111939653 AGTAATATGTTAAATTTGAATGG + Intronic
1089111261 11:116059180-116059202 AATTAAATGAAAAAAAGGAAGGG - Intergenic
1090108805 11:123882728-123882750 AGTTATATCTATAAATTTAACGG + Intergenic
1090631058 11:128648380-128648402 AATTATGTATTAAAATTAAAAGG + Intergenic
1090675453 11:128990003-128990025 AATTAAATGTAAATTATGAAAGG - Intronic
1092110735 12:5962341-5962363 AAATTTATATAGAAATTGAAAGG + Intronic
1092443695 12:8533315-8533337 AATTTTATGCAATAAATGAATGG + Exonic
1092669128 12:10842558-10842580 AAATATATGAAAGAACTGAATGG - Intronic
1093077991 12:14776678-14776700 AATTATAGGTAAACATTAATAGG + Intronic
1093227168 12:16499108-16499130 GATTATATGTCAAAACTGGAGGG - Intronic
1093369320 12:18347996-18348018 AATTTTATGAAAAATTTTAAAGG + Intronic
1093424436 12:19012070-19012092 TATTATTTGTATAAATTTAAGGG - Intergenic
1093754875 12:22841500-22841522 AATTCTATATATAACTTGAAGGG - Intergenic
1093778832 12:23110347-23110369 AAACATATGCAAAAATTAAATGG - Intergenic
1093801981 12:23384690-23384712 AAAAATTTGTACAAATTGAAGGG - Intergenic
1093815725 12:23544006-23544028 AAATATATGTAAAACTGGTATGG + Intronic
1094036008 12:26072897-26072919 AATTGTATTTAAAAATATAAAGG - Intronic
1094244813 12:28276858-28276880 AATTATATGTATATTTTTAAAGG + Intronic
1094258324 12:28462355-28462377 GATAATATATAAAAATTGAAAGG - Intronic
1094462067 12:30707001-30707023 AATTATATGGAATAATTATATGG + Intergenic
1095170990 12:39036260-39036282 AATTTTATGTACAAACTGAAAGG - Intergenic
1095623010 12:44281204-44281226 AATTATACGTAAATATTTAAAGG - Intronic
1095801807 12:46276638-46276660 AATTAGATGTGAAGAGTGAAGGG - Intergenic
1097368828 12:58750126-58750148 AGGTATTTGTAAAAATTAAATGG - Intronic
1097547929 12:61028116-61028138 AATTATTTAAAAGAATTGAATGG - Intergenic
1097564003 12:61245260-61245282 TATTTTAATTAAAAATTGAAAGG - Intergenic
1097673420 12:62569146-62569168 AATAAAATATATAAATTGAATGG + Intronic
1097883608 12:64707792-64707814 AATTCTTTGTAGAAATGGAATGG - Intergenic
1098118350 12:67205511-67205533 AATTATAGGCAAAAATTATATGG + Intergenic
1098202634 12:68072435-68072457 AATTATATGTTATAACTAAATGG - Intergenic
1098239131 12:68448380-68448402 AATTCTTTGTAAAAAATAAATGG - Intergenic
1098376945 12:69826080-69826102 ATATATATTTAAAAGTTGAATGG + Intronic
1098950477 12:76635644-76635666 AAATATATTAAAAAGTTGAAAGG + Intergenic
1099282699 12:80672277-80672299 AAATATATTTAACAATTCAATGG + Intronic
1099362010 12:81714977-81714999 AATTATCTGTAAATAGTCAATGG + Intronic
1099520972 12:83662009-83662031 AAGTAAATGTAAAAATATAAGGG - Intergenic
1099582163 12:84463303-84463325 AAATATATTTTAAAACTGAAAGG + Intergenic
1099643795 12:85324656-85324678 AAACATATGTTAAAAGTGAAAGG - Intergenic
1099767625 12:87008670-87008692 ACTTGTATGAAAAAAATGAACGG + Intergenic
1100437774 12:94587719-94587741 AAATGTATGTAAAAACTGAAAGG + Intronic
1100696177 12:97096504-97096526 ACTTATATAGAAAAATTAAAAGG - Intergenic
1100814141 12:98369351-98369373 AATGCTATGTGAGAATTGAATGG - Intergenic
1100881520 12:99023072-99023094 AATAATATGTAAAAACAGAAGGG - Intronic
1101260291 12:103022294-103022316 AAATATGTGTAAATATTGATGGG - Intergenic
1101384834 12:104247458-104247480 AATTTTATTTCAAAATTGAGGGG + Intronic
1101387324 12:104269304-104269326 AATCTCATGTAAAATTTGAATGG - Intronic
1101619251 12:106368386-106368408 TAATATATGTAAAAATGGATAGG - Intronic
1102136153 12:110577537-110577559 AATTATATTTAGGAAGTGAATGG - Intronic
1102733746 12:115138666-115138688 AATTACATGTAAATAAGGAAAGG + Intergenic
1102856812 12:116301303-116301325 TATTATCTGTAAAAATGGAAAGG - Intergenic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1104296716 12:127522085-127522107 AATCATTTGTGAAAATGGAAAGG + Intergenic
1104369337 12:128209373-128209395 AATTGTATATAAATATTGAAAGG - Intergenic
1104888620 12:132127376-132127398 AAATATATGTAAAAATTACAGGG - Intronic
1105674307 13:22653817-22653839 AATTACAGATAAAATTTGAATGG - Intergenic
1105745217 13:23371334-23371356 AACTTTATTTAAAAATTTAAGGG + Intronic
1105840324 13:24248465-24248487 AATTATCTGAAAAAATTAGAAGG + Intronic
1105907354 13:24826138-24826160 AAGAATATATTAAAATTGAAGGG - Intronic
1106004909 13:25759818-25759840 CATTTCATGTAAAAGTTGAATGG - Intronic
1106100204 13:26688342-26688364 AATTATAGTTATAAATTGTAAGG + Exonic
1106150765 13:27099472-27099494 AATGAACTTTAAAAATTGAAAGG - Intronic
1106525229 13:30534495-30534517 AAGAATATTTAAAAATTTAAGGG - Intronic
1106802811 13:33273796-33273818 AAAGATATGTAAAACTGGAAAGG + Intronic
1107072640 13:36287692-36287714 AATTATTGATAAAAATAGAAAGG + Intronic
1107199801 13:37700736-37700758 ATTTATATGTATAAATTAGATGG - Intronic
1107257782 13:38450127-38450149 AATAGTATATAAATATTGAAAGG - Intergenic
1107277687 13:38695310-38695332 AATTATATGAAAAATATAAAAGG + Intronic
1108037030 13:46301528-46301550 AACTATTTTAAAAAATTGAAAGG + Intergenic
1108376637 13:49820000-49820022 ACTTATAGATAAAACTTGAAGGG - Intergenic
1108886809 13:55195869-55195891 AATTATATATAACAATCCAATGG - Intergenic
1108996663 13:56742941-56742963 ATATATATGTATAAATTAAATGG + Intergenic
1109038558 13:57299517-57299539 AAAAAAATGAAAAAATTGAAAGG + Intergenic
1109250926 13:60020168-60020190 TCTTATATGTAACAATAGAAGGG - Intronic
1109482114 13:62969449-62969471 AAATATATGTAAGAAATAAATGG - Intergenic
1109501646 13:63243935-63243957 AATAAAATATAAAATTTGAACGG + Intergenic
1109524069 13:63552879-63552901 AATTATATATATCAAATGAAAGG + Intergenic
1109533228 13:63681283-63681305 AATTATACTTAAAAACTAAAAGG + Intergenic
1109550389 13:63889985-63890007 AAATATATGTAAAAATACAAAGG + Intergenic
1109725608 13:66337256-66337278 AAATATATATATAAATTGAATGG - Intronic
1109824882 13:67705648-67705670 AATTATATATTACAATTAAAAGG + Intergenic
1109901798 13:68782406-68782428 AATTTTTTGTAAAAAATGTAAGG + Intergenic
1110124520 13:71926049-71926071 AATTATATGTATAATTTAAGAGG - Intergenic
1110747134 13:79067407-79067429 CTTTATATTTAAAAACTGAAAGG - Intergenic
1110755553 13:79169728-79169750 TATTATTTGTATAAATTTAAAGG - Intergenic
1110886607 13:80645302-80645324 TATTATTTGTACAAATTGATGGG + Intergenic
1111005781 13:82246628-82246650 AATTATGTTTAAAATTTGCATGG + Intergenic
1111136712 13:84055805-84055827 ATTTATATTTAAAAATTCAGTGG - Intergenic
1111157097 13:84342040-84342062 AAATATATATAAAAATAGAATGG - Intergenic
1111249445 13:85584619-85584641 AATTTTATTTAAAAAATAAAAGG + Intergenic
1111376834 13:87391184-87391206 AATTATACCAAAAAATTGAAGGG - Intergenic
1111551950 13:89824832-89824854 TATTATATGTAAATATTCATTGG + Intergenic
1111567092 13:90030128-90030150 AAATCTATATAAAAATTCAATGG + Intergenic
1111702909 13:91713283-91713305 ATATTTATGAAAAAATTGAAAGG + Intronic
1112069523 13:95833858-95833880 AATTCTTTGTAAATAGTGAATGG - Intronic
1112155999 13:96817376-96817398 AATTTCATATAAAAATTCAAGGG - Intronic
1112165577 13:96916569-96916591 AAATAAAAGTAAAAATTGGATGG - Intergenic
1112319030 13:98390446-98390468 AATGATTTGTTAAAAATGAATGG - Intronic
1112752944 13:102600064-102600086 AATTAAAAAAAAAAATTGAATGG + Intronic
1112995078 13:105564500-105564522 ACTAATATGTAATAATTAAAAGG + Intergenic
1113077525 13:106481861-106481883 AGTTATACAGAAAAATTGAAAGG - Intergenic
1113255711 13:108502259-108502281 AATTTTAAGAAAAAAATGAAGGG + Intergenic
1114151869 14:20049719-20049741 AATTATATGTAGGAATTTATGGG - Intergenic
1115097625 14:29657130-29657152 AATTATATTTCAACCTTGAACGG - Intronic
1115170998 14:30506816-30506838 AATTAAATTTAAAAATTAAATGG - Intergenic
1115436121 14:33376324-33376346 CATTATATATAAAAACTGATGGG + Intronic
1115730263 14:36260862-36260884 AATTATATATAGAAAATGAGAGG - Intergenic
1115765566 14:36619606-36619628 AAAAATATGTACAAATTAAAGGG - Intergenic
1116145689 14:41065330-41065352 AATAAAATGAAAAAATGGAATGG - Intergenic
1116371454 14:44138895-44138917 AATTATTTGTATAAATTTAAGGG + Intergenic
1116514296 14:45787033-45787055 AAATGAATGTAAGAATTGAATGG - Intergenic
1116554488 14:46286278-46286300 CATTATATTTAAAAATTTATTGG + Intergenic
1116743533 14:48788081-48788103 AATTATATGTATATATTTAATGG - Intergenic
1116974948 14:51105555-51105577 AATTGTATTTAAAAATGGAAGGG - Intergenic
1117237475 14:53793645-53793667 TATTATATATAAAATTTGCAGGG - Intergenic
1117553868 14:56864403-56864425 AATTATATGTATATATAAAAAGG + Intergenic
1118329867 14:64806883-64806905 AAATACATGTAAAATTTAAACGG + Intronic
1118335824 14:64852902-64852924 AATTATTTGTAATAATTCACTGG - Intronic
1118375736 14:65175493-65175515 AATAAAATGTAAAAAATAAAAGG - Intergenic
1118634394 14:67734411-67734433 TATTTTCTCTAAAAATTGAAAGG - Exonic
1119066431 14:71532093-71532115 TATAATATGTATAAATTAAAGGG - Intronic
1119086768 14:71746301-71746323 AAGTAGTTGTAAAAATTAAAGGG - Intergenic
1119168528 14:72515342-72515364 ACTTTTATGTAAAAATAAAAAGG - Intronic
1119372510 14:74159260-74159282 TATTTTATTTAAAAATTGTAGGG - Intronic
1120683993 14:87516573-87516595 AATAATATGGCTAAATTGAAAGG - Intergenic
1120740991 14:88108783-88108805 AATTAGAAGTGGAAATTGAAAGG - Intergenic
1120810846 14:88802036-88802058 AATGTTATGTAAGATTTGAAAGG - Intergenic
1121635492 14:95451348-95451370 AATTATTCGTAGAAATTAAATGG - Intronic
1121669904 14:95701069-95701091 AATTATATGATAAAGATGAAAGG + Intergenic
1121966905 14:98317222-98317244 TATAATATTTAAAAATAGAATGG - Intergenic
1123402168 15:19998199-19998221 ATTTATTTGTATAAATTTAAGGG + Intergenic
1123419958 15:20123537-20123559 AATTAAATGGAAAATTTAAATGG + Intergenic
1123445903 15:20329995-20330017 AATTAAATGGAAAATTTAAATGG - Intergenic
1124008980 15:25820036-25820058 AAAAATTTGTATAAATTGAAGGG - Intronic
1124597957 15:31106472-31106494 ATTTATACTTAAAAAGTGAAAGG - Intronic
1125036636 15:35132733-35132755 AATTATTTATTAAAATTAAAGGG + Intergenic
1125218045 15:37301088-37301110 AACTATATGTATAAAGTCAAGGG + Intergenic
1125259430 15:37805861-37805883 AAATATATGTCAAAATAGTATGG + Intergenic
1125545730 15:40503091-40503113 AAATTTATGTAAAATGTGAAAGG + Intergenic
1125804544 15:42481903-42481925 AAATATATTTAAAAATTTAATGG - Intronic
1126205897 15:46044391-46044413 AATTATATGGCATAAGTGAATGG - Intergenic
1126256351 15:46630353-46630375 AACTATATGTAAAATTTTATTGG + Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1126859226 15:52868244-52868266 AAATAAATGTATAAATTAAAGGG - Intergenic
1127304746 15:57694279-57694301 CATTAGATATAAAAATTAAATGG + Intronic
1127485835 15:59416821-59416843 AATGATATTTGAAAATAGAATGG - Intronic
1127552675 15:60056562-60056584 AATTATAAGTAAATATGCAAAGG - Intronic
1127590853 15:60421547-60421569 AGTAATATTTAAAAATTAAAAGG + Exonic
1127597436 15:60500201-60500223 AAGTATTGGTAAAAATGGAAAGG - Intronic
1127708523 15:61571373-61571395 AATTATAAGTACAAATTAGATGG - Intergenic
1127802852 15:62492747-62492769 AATTATTTGGAATAAATGAATGG - Intronic
1128030554 15:64476349-64476371 AATAATATATAAAATTAGAAAGG + Intronic
1128485946 15:68089315-68089337 AATTAACTGTAAGAATTGAGAGG + Intronic
1128622730 15:69164684-69164706 TATAATATGTAAAAATTACATGG - Intronic
1129038773 15:72666560-72666582 ATTTATTTGTAAAAAGTTAAGGG + Intergenic
1129211116 15:74070670-74070692 ATTTATTTGTAAAAAGTTAAGGG - Exonic
1129399290 15:75270414-75270436 ATTTATTTGTAAAAAGTTAAGGG + Intronic
1129402894 15:75294693-75294715 ATTTATTTGTAAAAAGTTAAGGG + Intronic
1129476431 15:75787108-75787130 ATTTATTTGTAAAAAGTTAAGGG + Intergenic
1129558056 15:76534815-76534837 AATTATATTTATAAATTACAAGG + Intronic
1129611023 15:77057317-77057339 ATTTATATGTTAAATTTTAAAGG - Intronic
1129632980 15:77282039-77282061 AATTATATGGAAATATTGATTGG - Intronic
1129728250 15:77914944-77914966 ATTTATTTGTAAAAAGTTAAGGG - Intergenic
1130385689 15:83409560-83409582 ATTTATATCTATAAATTAAAAGG + Intergenic
1130399823 15:83539907-83539929 AATTATTTTTAAGAATAGAAAGG + Intronic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1131366042 15:91841469-91841491 AATAAAATGTAAAAGTAGAAGGG - Intergenic
1131688292 15:94795181-94795203 ACATATATGTGAAAATTAAACGG - Intergenic
1131844854 15:96478966-96478988 AAATTTATATAAAAATTCAAAGG - Intergenic
1131964933 15:97831811-97831833 AAATATATATAAAAATTGAGAGG + Intergenic
1132477867 16:150967-150989 ACTTATTTGTAAAAAATGAATGG - Intergenic
1133501385 16:6370435-6370457 AATGATTAGTTAAAATTGAAGGG - Intronic
1133879612 16:9768377-9768399 ACTAATATTTAAAAATGGAAAGG + Intronic
1134335433 16:13295182-13295204 TATTAAGTGTAAAACTTGAATGG - Intergenic
1134339997 16:13336037-13336059 AATTATAGTTAAATACTGAAGGG + Intergenic
1135568012 16:23526943-23526965 AATTATTTTTAAAAACTGAGAGG - Intronic
1136599278 16:31273579-31273601 AATAATATTTGCAAATTGAAGGG - Intronic
1136937235 16:34482915-34482937 AATCAAATGGAAACATTGAATGG + Intergenic
1136937304 16:34483846-34483868 AATCAAATGGAAAAATCGAATGG + Intergenic
1136937401 16:34485097-34485119 AATGAAATGGAGAAATTGAATGG + Intergenic
1136942324 16:34599246-34599268 AATCAAATGTAATCATTGAATGG - Intergenic
1136942771 16:34605181-34605203 AATTGAATGGAAACATTGAATGG - Intergenic
1136944257 16:34628027-34628049 AATCAAATGTAATCATTGAACGG - Intergenic
1136950487 16:34711820-34711842 AATCAAATGGAGAAATTGAATGG - Intergenic
1136950764 16:34715431-34715453 AATTAAATGGAATCATTGAATGG - Intergenic
1136954320 16:34762838-34762860 AATCAAATGAAGAAATTGAATGG - Intergenic
1136959198 16:34826578-34826600 AATTATATGTGAATAAAGAATGG + Intergenic
1136961954 16:34857019-34857041 AATCAAATGGAAACATTGAATGG - Intergenic
1136962416 16:34863450-34863472 AATGAAATGGAGAAATTGAATGG - Intergenic
1136962515 16:34864724-34864746 AATCAAATGGAAAAATCGAATGG - Intergenic
1136962584 16:34865655-34865677 AATCAAATGGAAACATTGAATGG - Intergenic
1136969130 16:34952321-34952343 AATTGAATGGAAACATTGAATGG - Intergenic
1136969357 16:34955385-34955407 AATTAAATGGAATAATTGAATGG - Intergenic
1137086589 16:36132287-36132309 AATCAAATGGAAACATTGAATGG - Intergenic
1137086740 16:36134468-36134490 AATCAAATGGAAACATTGAATGG - Intergenic
1137086855 16:36136110-36136132 AATGAAATGGAGAAATTGAATGG - Intergenic
1137087248 16:36141389-36141411 AATTGAATGGAGAAATTGAATGG - Intergenic
1137090744 16:36187365-36187387 AATTAAATGGAATCATTGAATGG - Intergenic
1137090765 16:36187584-36187606 AATTGAATGGAAACATTGAATGG - Intergenic
1137091306 16:36194813-36194835 AATCAAATGGAGAAATTGAATGG - Intergenic
1137091413 16:36196059-36196081 AATTGAATGGAGAAATTGAATGG - Intergenic
1137094808 16:36240796-36240818 AATTAAATGGAATCATTGAATGG - Intergenic
1137217256 16:46407813-46407835 AATCAAATGGAATAATTGAATGG + Intergenic
1137217951 16:46417328-46417350 AATCAAATGTAAACATTGAATGG + Intergenic
1137218046 16:46418549-46418571 AATCAAATGGAGAAATTGAATGG + Intergenic
1137330960 16:47495538-47495560 ATGTATATATAAAAATTAAAGGG - Intronic
1138637790 16:58356152-58356174 AACAATTTTTAAAAATTGAATGG - Intronic
1139058220 16:63214157-63214179 AATAAAATGTAAAAGTGGAAAGG + Intergenic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1139818397 16:69697067-69697089 AATTATCTGTAAAAAATGAAGGG + Exonic
1140753936 16:78050405-78050427 AAATATCTGAAAAAACTGAAAGG - Intronic
1143436419 17:6931254-6931276 AACTATATGTATAATTAGAATGG + Intronic
1143821753 17:9570157-9570179 AATGATATGTGGGAATTGAAAGG - Intronic
1145255576 17:21320441-21320463 AATTAAATGTAATCATTTAATGG - Intergenic
1145321037 17:21767508-21767530 AATTAAATGTAATCATTTAATGG + Intergenic
1145356529 17:22160418-22160440 AAATATGTTTAAAGATTGAATGG + Intergenic
1146353623 17:32116377-32116399 AATTATTTTTAAAAAGAGAAAGG + Intergenic
1146425129 17:32731331-32731353 AATTAAAATTAAAAATTCAATGG - Intronic
1147394973 17:40135326-40135348 AATTATTTTTACAAAGTGAATGG - Intronic
1147410522 17:40247942-40247964 GAAAATAAGTAAAAATTGAATGG - Intronic
1148285174 17:46383108-46383130 AAACATATGTAAATATAGAAAGG - Intergenic
1148307337 17:46600704-46600726 AAACATATGTAAATATAGAAAGG - Intronic
1148343284 17:46886354-46886376 AATTTTATTTATTAATTGAAAGG - Intronic
1148405385 17:47409214-47409236 AATTAAATGTAATTAATGAATGG - Intronic
1149248752 17:54743138-54743160 AAACATTTGTAAAAATTGACAGG - Intergenic
1149287731 17:55184776-55184798 AACAATAGGCAAAAATTGAAGGG + Intergenic
1149709867 17:58730813-58730835 AACTATATGTAAACATAAAATGG - Intronic
1149742288 17:59058063-59058085 ATTTATATTTTAAAATTGCAAGG - Intronic
1150056271 17:62020313-62020335 ATTCATATGTAAAAAATTAAAGG - Intronic
1150296623 17:64012436-64012458 AAATATATATAAAAATTGGCCGG + Intronic
1150661899 17:67088447-67088469 AATTAAATGTGAAAATTGTGGGG + Intronic
1150838887 17:68589890-68589912 AATAATATATAGAAATTGATTGG - Intronic
1203187688 17_KI270729v1_random:142599-142621 AATCAAATGGAATAATTGAATGG - Intergenic
1203188169 17_KI270729v1_random:149006-149028 AATCAAATGGAAACATTGAATGG - Intergenic
1203207363 17_KI270730v1_random:48645-48667 AATAGAATGGAAAAATTGAAGGG + Intergenic
1153110629 18:1582094-1582116 CATTATATGGCAAAAGTGAAAGG - Intergenic
1153132235 18:1868010-1868032 AATTATATATAACAATTGGAGGG + Intergenic
1153188911 18:2516663-2516685 AAATGTATGTAAAAATTTTAGGG - Intergenic
1153937111 18:9937772-9937794 AATAATATGGATAAATAGAATGG + Intronic
1155292838 18:24358520-24358542 AATTATATGTATATATTTCAAGG + Intronic
1155407424 18:25504112-25504134 ATTTACATGAAAAAAATGAAAGG - Intergenic
1155610996 18:27667523-27667545 AATTATATTTAAAAATTAGCTGG + Intergenic
1155711202 18:28881924-28881946 AATTTTATATAAAAATTCAAGGG - Intergenic
1155761904 18:29578561-29578583 AATAATATGTCATAATTGTATGG + Intergenic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156198544 18:34804065-34804087 CATAATAAGTAAAAAGTGAAGGG + Intronic
1156210556 18:34936597-34936619 GAATATATTTAAAATTTGAATGG - Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156289680 18:35735395-35735417 AAGAAAATGTAAAAACTGAAAGG + Intergenic
1156768795 18:40694005-40694027 AATAATATTTAACAATTAAAAGG + Intergenic
1156947273 18:42850018-42850040 TAGTATATTTAAAAATTGGAGGG - Intronic
1157115810 18:44861850-44861872 AATTATATGTCAAGTTTTAAAGG + Intronic
1157376279 18:47168946-47168968 AATTATATGTATGAATTGTAAGG - Intronic
1157785477 18:50478260-50478282 AATGATAAGTGAAAAGTGAATGG - Intergenic
1158135675 18:54205249-54205271 AAAAATATGTAAAATTAGAATGG - Intronic
1158256493 18:55555820-55555842 TATTATCTTTAAATATTGAAAGG - Intronic
1158289443 18:55922750-55922772 ATTTATATTAAAAAATGGAAAGG - Intergenic
1159271439 18:66157371-66157393 AATTATTTTTAAAAATTGCAGGG + Intergenic
1159285394 18:66343023-66343045 TTTTTTATGTAAATATTGAAAGG + Intergenic
1159650604 18:70973199-70973221 AATTCTATGAAAATATTCAAAGG - Intergenic
1159704616 18:71672084-71672106 AATTATATGATAAAAATTAAAGG - Intergenic
1159751966 18:72313767-72313789 AATAAGATGTAAAAAATGCAAGG + Intergenic
1160011847 18:75111981-75112003 ACTAATAGGTAAAAAATGAAGGG - Intergenic
1160022910 18:75194324-75194346 AAGTATATGTACAAGTTGAAAGG + Intergenic
1160116918 18:76087340-76087362 CATTATATGTGCAAAATGAAAGG + Intergenic
1160176198 18:76596861-76596883 AATAATATGAAAATACTGAAAGG + Intergenic
1160252988 18:77220449-77220471 AATTATATGTAGAAATGGCTGGG + Intergenic
1160282612 18:77506576-77506598 AATTTTATGTGAGAATTGACTGG + Intergenic
1161146171 19:2679687-2679709 TAGGATATGTAAAAAGTGAAAGG - Intronic
1163072174 19:14853130-14853152 AAGTATAAGTACAAAGTGAATGG + Intergenic
1163251825 19:16130414-16130436 CATCAGATGTAAAACTTGAACGG - Intronic
1164212545 19:23112417-23112439 TTTTATAGGTAAAAAATGAAAGG + Intronic
1164465956 19:28487849-28487871 AATAAGATGTAAAAGTAGAAAGG - Intergenic
1164773871 19:30835232-30835254 AAATTTATTTAAAAATAGAAAGG - Intergenic
1164780772 19:30890183-30890205 AATTATAGCTAAAAAATGATGGG + Intergenic
1164922418 19:32098792-32098814 AATTATATGTAGAGTTTCAAAGG + Intergenic
1165269783 19:34696286-34696308 AAATAAATGAAAATATTGAATGG - Intergenic
1166968993 19:46549729-46549751 TATTATTTGTATAAATTTAAGGG + Intronic
1167130576 19:47582506-47582528 AATTCTTTTTAAAAAATGAATGG - Intergenic
1167405767 19:49307392-49307414 CAATATATGATAAAATTGAAGGG + Intronic
1168444778 19:56402672-56402694 AATTAAATGAAGCAATTGAAGGG + Intronic
1202668208 1_KI270709v1_random:19186-19208 AATCAAATGTAAACATCGAATGG - Intergenic
924983138 2:241792-241814 AAGTATATTTCAAAAATGAAGGG + Intronic
925688511 2:6496193-6496215 AATAATATGAGAAATTTGAAAGG - Intergenic
925811436 2:7704853-7704875 AATTACATTTAAAAATTGTTTGG + Intergenic
926256846 2:11210908-11210930 AATTACATGCAATAATTAAAAGG + Intronic
926495156 2:13577345-13577367 AAATATATTTGAAAATTAAAAGG + Intergenic
926530767 2:14041723-14041745 AATAATATTTCAAAATAGAATGG - Intergenic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
926820366 2:16845209-16845231 GATTCTTTGTAAAAATTAAAGGG - Intergenic
926876133 2:17481506-17481528 AATTCTATATAACAATTTAAGGG + Intergenic
926890020 2:17631161-17631183 AATTAAATGTGAATATTCAAAGG + Intronic
926941844 2:18145805-18145827 AATTATATTTAAAGACTGAAGGG + Intronic
927004190 2:18830745-18830767 AAATATTTGAAAAAAATGAAAGG - Intergenic
927048683 2:19305335-19305357 AATGATATGTAAAAGATTAAGGG - Intergenic
927123743 2:19994093-19994115 TTTTACATGTAAATATTGAATGG + Intronic
927227145 2:20779178-20779200 ACTTGCATGTAAAAATTGAAAGG + Intronic
927522584 2:23708785-23708807 AATTGAAGGTAAAAGTTGAAAGG + Intergenic
927580569 2:24242006-24242028 ATTTATTTGTAAAAAGTTAAAGG - Intronic
928280098 2:29938447-29938469 TACTATATTGAAAAATTGAATGG - Intergenic
928413583 2:31072875-31072897 CATTATGTGTAAAAAATGCAGGG - Intronic
928782726 2:34844691-34844713 AATTATAGGTAACAAATGAAGGG - Intergenic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
928990555 2:37229145-37229167 AGTTTTATGTCAAATTTGAAAGG - Intronic
929065653 2:37972048-37972070 AAAGATATGTGAAAATTCAATGG - Intronic
929427854 2:41862314-41862336 AATTATCTATGAAAATTAAAAGG + Intergenic
929543391 2:42839694-42839716 AATTATCTATTAAAATTAAAAGG + Intergenic
929654118 2:43712570-43712592 TATAATATGTAAAAATGTAAAGG + Intronic
930499491 2:52194409-52194431 AAATATATCTAAACATAGAAAGG + Intergenic
930756953 2:54985022-54985044 AATGATGTGTAAAATTGGAACGG + Intronic
930964234 2:57300957-57300979 ATTTATTTGTATAAATTTAAGGG - Intergenic
930971492 2:57400012-57400034 AATTGTATTTAAAAATTCACAGG - Intergenic
930997716 2:57741290-57741312 AATTCTTTGTATAAATTCAAGGG + Intergenic
931013646 2:57949188-57949210 AATTTTCTGCAAAAATAGAAGGG + Intronic
931509451 2:62974642-62974664 AATTATATCTAAAGGTTGAGTGG + Intronic
931743821 2:65274099-65274121 AATAATATATAAAAATCTAAGGG + Intergenic
931857718 2:66320874-66320896 AGTTAATTGTAAAACTTGAAAGG + Intergenic
932289255 2:70561488-70561510 AAATTTATTTAAAAATTTAAAGG + Intergenic
932558018 2:72842686-72842708 TATTAAAAGTCAAAATTGAAAGG + Intergenic
932692450 2:73924894-73924916 AATTATTTTTAAAAATTTTATGG - Intergenic
932999525 2:76904761-76904783 TAACATATGTAAAAAATGAAAGG + Intronic
933067308 2:77814038-77814060 ATTAATATGTACAAATTGAAAGG - Intergenic
933176734 2:79182568-79182590 TATTATAAGTGAAAATTAAATGG - Intergenic
933198755 2:79423564-79423586 ATGTAGATATAAAAATTGAATGG + Intronic
933326273 2:80842208-80842230 AATTATATTTAAAAAATTATGGG + Intergenic
933442614 2:82333168-82333190 AATTATATGTAAGAACTGAATGG + Intergenic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
934115527 2:88788269-88788291 AATCATATGTAAATATGGTAAGG - Intergenic
934189939 2:89779958-89779980 AATTGAATGGAATAATTGAATGG - Intergenic
934190731 2:89790441-89790463 AATCAAATGGAAAAATCGAAAGG - Intergenic
934628057 2:95880650-95880672 AATCATATGTAAATATGGTAAGG + Intronic
934805349 2:97219001-97219023 AATCATATGTAAATATGGTAAGG - Intronic
934832013 2:97536519-97536541 AATCATATGTAAATATGGTAAGG + Intronic
935169132 2:100596846-100596868 AAATATATATGAAAAGTGAAAGG - Intergenic
935178950 2:100673590-100673612 AATGATATGTGAAAATTACATGG - Intergenic
936109550 2:109653695-109653717 AAGAATATGAGAAAATTGAAAGG - Intergenic
936348024 2:111689927-111689949 TTTTATATGTAAACATTGTACGG + Intergenic
936739048 2:115482217-115482239 AATTATTTTTAAAAAATAAAAGG - Intronic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
936812658 2:116420821-116420843 AATTATATTTAATAATTAATAGG + Intergenic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
936898168 2:117453111-117453133 GATTTTAGATAAAAATTGAAAGG - Intergenic
937836413 2:126474888-126474910 AATTATATGTATAATATAAAGGG - Intergenic
937971417 2:127552162-127552184 AATTAAAAGTAAAAATTAAAAGG - Intronic
938205477 2:129417482-129417504 AATTATATGGAAAAATAAATAGG - Intergenic
939039570 2:137171994-137172016 AATTATATGTTAATATTCACAGG - Intronic
939431224 2:142111008-142111030 AACTACATATAAAAACTGAAAGG - Intronic
939511189 2:143107411-143107433 AAATATAAGTGAAAATTGATTGG + Intronic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939581222 2:143948460-143948482 AGTTTTATTTATAAATTGAATGG - Intronic
939588242 2:144031608-144031630 AATTTTAGGAAAAAATTAAAGGG + Intronic
939769180 2:146293035-146293057 ATTTAAATGTAGAACTTGAAAGG + Intergenic
939811220 2:146835119-146835141 ATTCATATGTAAATATAGAATGG + Intergenic
940364639 2:152834252-152834274 AATTAAATGTAAAAACAGACTGG - Intergenic
940477628 2:154184786-154184808 TATTATATGAAAAAATGTAAAGG - Intronic
940801989 2:158143591-158143613 AATAATAAGAAAAAAATGAAAGG + Intergenic
941052983 2:160756296-160756318 AAGCATATGTAAAAATTGCAAGG + Intergenic
941147151 2:161862629-161862651 AATTATATATTTAAATAGAATGG + Intronic
941175084 2:162187110-162187132 AATTATTTTTAAAAATAGAAAGG - Intronic
941252951 2:163189257-163189279 AATTGAATTTAAAAATGGAAAGG - Intergenic
941359646 2:164536142-164536164 ATTTATATCAAAAAATTAAAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941786176 2:169500990-169501012 AACTATATGAAAATATTCAAGGG - Intronic
942291173 2:174472713-174472735 AACTTTATGTAAAAGCTGAAGGG + Intronic
942489913 2:176479444-176479466 AACTATATTTAAATTTTGAATGG - Intergenic
942575381 2:177357518-177357540 AATTATTTGTATAAATTTAAGGG - Intronic
942622136 2:177856526-177856548 AATCATATCTAAAGACTGAAAGG + Intronic
942852879 2:180511435-180511457 AATATTATTTAAGAATTGAATGG - Intergenic
943028820 2:182661999-182662021 ATTTATATGAAAAAAATCAAAGG + Intergenic
943522434 2:188969658-188969680 AATTATATTTGAAAATTCATAGG - Intergenic
943745069 2:191453770-191453792 ATTAATATGTAAAATTTGCAGGG + Intergenic
943955789 2:194187756-194187778 AACTGTATGGAAAAATTAAAGGG + Intergenic
944224431 2:197335781-197335803 AATTATAGTTTAAAATTGCAAGG - Intergenic
944279294 2:197876389-197876411 TATTTTATGTAAAACTTGATAGG + Intronic
944377643 2:199065894-199065916 AATCATATTTAAAAACAGAATGG + Intergenic
944565298 2:200984431-200984453 TATTACATGTTGAAATTGAAGGG - Intronic
944714002 2:202360988-202361010 GATTCTATTTGAAAATTGAATGG - Intergenic
944798742 2:203214921-203214943 AATCATATGTAAAAATCAGATGG + Intronic
944965241 2:204924717-204924739 AATTTAATGTAAAAGTTGGAAGG + Intronic
945087418 2:206146252-206146274 AATCATATTTAAAAATTGAAGGG + Intronic
945637119 2:212369147-212369169 AATTATTTGCCAAAATTAAAAGG + Intronic
945696343 2:213110368-213110390 AATTATATTTAAAAACTCATAGG - Intronic
945853861 2:215043400-215043422 AATTTTATTTTAAAATTTAAAGG + Intronic
946118829 2:217490809-217490831 AATTTTTTTTAAAAAGTGAATGG - Intronic
946476225 2:220009131-220009153 AATTAAATGCAAAAATCGACAGG - Intergenic
946992525 2:225351367-225351389 AATTATATGCAACAATTTAAAGG + Intergenic
947052834 2:226066075-226066097 ATTTATATTTAAAAGTAGAAGGG - Intergenic
947164656 2:227249567-227249589 AATTATATGTAAAAATTCCTGGG + Intronic
947417014 2:229907044-229907066 AATGGAATCTAAAAATTGAAAGG - Intronic
947469703 2:230389708-230389730 AATTTTCTGTGAAATTTGAAAGG + Intronic
948326058 2:237122190-237122212 AATTATATTTAAAAGTTTAGCGG + Intergenic
949014954 2:241703505-241703527 AAGTAAAATTAAAAATTGAATGG + Intronic
1168987278 20:2060603-2060625 ATCTATATGGAAAAAATGAATGG + Intergenic
1169442614 20:5645270-5645292 ACCCATATCTAAAAATTGAAAGG + Intergenic
1169561604 20:6807272-6807294 AATTATATATGAAAATGCAAAGG + Intergenic
1170005083 20:11659091-11659113 AATTTTATGGAAATAATGAAAGG + Intergenic
1170171657 20:13420180-13420202 AATGATATTTAAAAAATAAAGGG - Intronic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1170473757 20:16693983-16694005 AATTTTATGACAAAAATGAAGGG + Intergenic
1170964565 20:21054788-21054810 AATTTTAGTTAAAAACTGAAAGG + Intergenic
1170974232 20:21147240-21147262 TATTATATGTAACATTTTAAGGG - Intronic
1171101383 20:22386572-22386594 AATAAAATGCAAAAAGTGAAAGG + Intergenic
1171555452 20:26079163-26079185 GATTATATGTCAGAATTTAAAGG + Intergenic
1172145990 20:32758888-32758910 AATTTTAAGTAAACATTGCAAGG + Intergenic
1172333584 20:34094765-34094787 AATGAAATGAAAATATTGAATGG - Intronic
1172728416 20:37065425-37065447 TATTATCAGTAAAACTTGAAAGG + Exonic
1172787169 20:37476286-37476308 AAATATAAGTAAAAAATAAAAGG - Intergenic
1173086824 20:39928193-39928215 AATTATATTTAAAGGATGAATGG + Intergenic
1173159164 20:40639556-40639578 AATTGTATGTATAAATGGAAGGG - Intergenic
1173414722 20:42845419-42845441 AATTATAATCATAAATTGAAGGG + Intronic
1173885574 20:46455424-46455446 TTTTATAAGTGAAAATTGAACGG - Intergenic
1174245590 20:49177376-49177398 AATAAAATTTAAAAATTTAAGGG + Intronic
1174668795 20:52286043-52286065 ATTTATTTGTAATAAGTGAATGG + Intergenic
1174723165 20:52835314-52835336 AACTCTATTTAAAAATGGAATGG + Intergenic
1175336128 20:58197493-58197515 AATTCAATGTAAAAATTCATTGG + Intergenic
1175431993 20:58911857-58911879 AATCACACGTAAAATTTGAATGG + Intergenic
1175548496 20:59798399-59798421 AATTATTTCAAAAAAGTGAAAGG - Intronic
1176313516 21:5219476-5219498 AATTAAATGTAGAAGTAGAAAGG - Intergenic
1176522003 21:7831193-7831215 AATTATTTGTAAACATTTTAAGG - Intergenic
1177123808 21:17170644-17170666 AATTATTTGTAGAAATTTATAGG + Intergenic
1177246842 21:18537005-18537027 TATTATATTAAAAAATTCAAAGG + Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177707199 21:24721711-24721733 AATTATATGTAAAAAAGGTCTGG - Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1177777055 21:25580086-25580108 AATGACATGAAAAAGTTGAAAGG + Intergenic
1177993025 21:28060319-28060341 AATTTTATATGAAAATTTAAGGG + Intergenic
1178656023 21:34461205-34461227 AATTATTTGTAAACATTTTAAGG - Intergenic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1178831688 21:36061790-36061812 AATACTATGTAAATAGTGAAGGG + Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180527857 22:16314220-16314242 AATTTAATGGAATAATTGAATGG - Intergenic
1180528632 22:16324647-16324669 AATTAAATGGAATCATTGAATGG - Intergenic
1180533105 22:16367329-16367351 AATCGAATGGAAAAATTGAATGG + Intergenic
1180533318 22:16369897-16369919 AATTCAATGTAATCATTGAATGG + Intergenic
1180533403 22:16370907-16370929 AATTAAATGGAGAAATCGAATGG + Intergenic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1181656646 22:24306357-24306379 AATTAAAATTAAAAATTAAAAGG - Intronic
1184251506 22:43262928-43262950 AATGATATGTAACAATCAAATGG + Intronic
1184913584 22:47551868-47551890 AATTATATATAACATTTCAAAGG - Intergenic
1203316240 22_KI270737v1_random:14889-14911 AATTAAATGGAGAAATCGAATGG - Intergenic
1203316325 22_KI270737v1_random:15899-15921 AATTCAATGTAATCATTGAATGG - Intergenic
1203316538 22_KI270737v1_random:18467-18489 AATCGAATGGAAAAATTGAATGG - Intergenic
1203321119 22_KI270737v1_random:62411-62433 AATTAAATGGAATCATTGAATGG + Intergenic
1203321902 22_KI270737v1_random:72898-72920 AATTTAATGGAATAATTGAATGG + Intergenic
1203326914 22_KI270738v1_random:32505-32527 AATAAAATGTAATAATCGAATGG + Intergenic
1203330025 22_KI270738v1_random:73518-73540 AATCAAATGGAAAAATCGAATGG + Intergenic
949090072 3:16973-16995 ACTTATAACTAAAAATTCAAGGG - Intergenic
949726893 3:7059437-7059459 CATTATATGTAAAAACAAAAGGG + Intronic
949740588 3:7229091-7229113 AACTATATGTCAAATTAGAAGGG + Intronic
949967459 3:9370096-9370118 AAGTATATTTAAAAGTTTAAGGG - Intronic
950011601 3:9728124-9728146 AAGTATCTGTGACAATTGAATGG + Intronic
950199309 3:11031809-11031831 TTTTATATGTATAAATTTAAGGG + Intronic
950878104 3:16296701-16296723 GATTCAATGGAAAAATTGAAAGG + Intronic
951152797 3:19312267-19312289 AATAATAAGGAAAAATAGAAGGG - Intronic
951165305 3:19478642-19478664 ATATATATGTGAAAACTGAATGG - Intronic
951241556 3:20291739-20291761 AACTATTTGAAAAAAATGAAGGG - Intergenic
951475185 3:23097734-23097756 AAATATATGTAAACATAGAAAGG - Intergenic
951774852 3:26298517-26298539 AATTATATTGAATAATTGATAGG + Intergenic
952173218 3:30832783-30832805 ACTTAAATTTAAAAATTAAATGG + Intronic
952233945 3:31459787-31459809 AATTATTTGTATAAATTTATGGG - Intergenic
952580578 3:34828821-34828843 ATTTATATGTAAATTTTAAAGGG + Intergenic
952708386 3:36403514-36403536 AGTTATATGTTCAAATTGAAAGG + Intronic
952757060 3:36878955-36878977 ATTTATATATAAAAATGCAATGG - Intronic
953012911 3:39045243-39045265 AATTATTCCAAAAAATTGAAGGG + Intergenic
953176276 3:40555762-40555784 AATTATAGGACAAAACTGAAAGG - Intronic
953728456 3:45422843-45422865 AATTAATTGAAAAAATTAAAAGG + Intronic
953939834 3:47084112-47084134 AATTATAAGTGAAAATAGCATGG - Exonic
954495251 3:50952694-50952716 AATTGTATGTAATAGTTGGAAGG + Intronic
954827617 3:53388484-53388506 ATTTTTATGCAAAAATTAAAGGG + Intergenic
954978357 3:54719732-54719754 AATTGTATGGAAGAATTCAATGG + Intronic
955432781 3:58866398-58866420 AATTTTATGTCAAACTTTAATGG - Intronic
955624707 3:60905682-60905704 AATTATATGAAATAATTGCCAGG + Intronic
955789117 3:62570149-62570171 CTATATATGTAAACATTGAAAGG + Intronic
955877165 3:63503805-63503827 AATTATATGTATAATCTTAAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956416441 3:69035232-69035254 AATCATATGTAAAAGTTCATTGG - Intronic
956494039 3:69805294-69805316 AATTTTATCTAAAATTTTAATGG + Intronic
957029739 3:75226661-75226683 ACTTATAACTAAAAATTCAAGGG - Intergenic
957111230 3:75961034-75961056 AGTTATTTGTAAAAATTTACAGG + Intronic
957276766 3:78100229-78100251 AAATATGTGTAAAAATGGAGAGG + Intergenic
957298011 3:78356454-78356476 AATTTGATGTAATAATTTAATGG - Intergenic
957314693 3:78562120-78562142 AATTATACGTGAAATTTGGATGG + Intergenic
957341681 3:78906482-78906504 AATCAAATGTGAAAACTGAAGGG + Intronic
957611880 3:82477892-82477914 AAACATATGTAAAAATTGAAAGG - Intergenic
957662241 3:83174429-83174451 AATAATATTTAAAAATGTAAGGG + Intergenic
957706969 3:83801594-83801616 AATCTTATGCTAAAATTGAACGG - Intergenic
957712678 3:83883500-83883522 ATTTAAATGTAAAAATCCAATGG + Intergenic
957722938 3:84028064-84028086 AAAAATATGGAAAAATAGAAAGG + Intergenic
958003848 3:87787258-87787280 AATTAAATGCAATACTTGAAGGG - Intergenic
958611671 3:96434587-96434609 AATTATATGAAAAAAAAAAACGG + Intergenic
958824446 3:99013529-99013551 ATTTATATGTGACAATGGAAAGG - Intergenic
958981287 3:100723150-100723172 AATAATATGTAAGAAAGGAAGGG + Intronic
959010915 3:101074919-101074941 AGATATATTTAAAAATTGATTGG + Intergenic
959040075 3:101411306-101411328 AATTATAAGTATTATTTGAAAGG - Intronic
959190650 3:103105996-103106018 AATTATTTGTATAAATTCAGGGG + Intergenic
959888896 3:111532335-111532357 AATTTTATGTAACGATTAAATGG - Intronic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960727612 3:120686222-120686244 TAATATATGTTAAAATTCAAAGG - Intergenic
960799188 3:121520959-121520981 AATTTTATTTAAAAATTTAAAGG + Intronic
960916637 3:122701835-122701857 AATTATTTGTGAGAACTGAAAGG + Intronic
961090342 3:124105778-124105800 AATGAAAGGTAAAAATAGAATGG + Intronic
961932570 3:130549021-130549043 AATTATATTTTAAAAATCAAAGG - Intergenic
962167517 3:133064812-133064834 ATTTATTTGTAAAGAATGAAGGG - Intronic
962360039 3:134732556-134732578 AATTTTTTTTAAAAACTGAAGGG + Intronic
962412265 3:135151494-135151516 AAGTACATGAAAAAATGGAAAGG - Intronic
963373256 3:144429424-144429446 ATTAATATGTAAATATTGAAAGG + Intergenic
963389914 3:144648076-144648098 GATAAGTTGTAAAAATTGAAAGG + Intergenic
964461476 3:156935430-156935452 AAATATGTGTAAAACTTTAAAGG + Intronic
964523207 3:157589064-157589086 TATTATTTGTATAAATTTAAGGG - Intronic
964536064 3:157723372-157723394 AATTAAATGTAAAAACTTTAAGG + Intergenic
964640924 3:158909800-158909822 AGTTATATGTAAAGTTTAAATGG + Intergenic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
965287679 3:166838072-166838094 ATAAATATGTAAAAATTGATCGG + Intergenic
965314208 3:167171018-167171040 AATTATATTTTTAAATTAAATGG + Intergenic
965334106 3:167414596-167414618 AACTATATTAAAAAATTTAAAGG + Intergenic
965374188 3:167901589-167901611 AATTATGAGAAAAAATTGAGGGG - Intergenic
965376018 3:167925373-167925395 AAATATATGTAATCATTGAACGG - Intergenic
965389387 3:168085952-168085974 AATTATAGTTAAAGATTGTATGG + Intronic
965775346 3:172224302-172224324 AATTATACTTAAGAATTAAATGG + Intronic
966045062 3:175538631-175538653 AATTATATCAAAAATATGAATGG - Intronic
966062152 3:175771159-175771181 TATTATAAGTCACAATTGAAAGG + Intronic
966083565 3:176037524-176037546 AAATATAAGTAAAAATAGAAAGG - Intergenic
966159463 3:176952712-176952734 AATTATATTTAAAAACTCTATGG - Intergenic
966501902 3:180651613-180651635 ATTTATTTGTATAACTTGAAGGG + Intronic
967238267 3:187410036-187410058 AATTATATTCAAGAATTTAAAGG + Intergenic
967654312 3:192028028-192028050 AATTATAATTAATAAGTGAAGGG + Intergenic
969270965 4:6101539-6101561 AATTTGATGTAAAAATTGAAAGG - Intronic
969921014 4:10539847-10539869 TATTTTATGTAAGAACTGAAAGG - Intronic
969928241 4:10605479-10605501 AAAGATATCTAAAAATAGAAAGG + Intronic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
970558838 4:17262497-17262519 TATTATTTGTATAAATTTAAGGG + Intergenic
970619152 4:17799242-17799264 AATCATATAAAAGAATTGAATGG - Intergenic
970631035 4:17944983-17945005 AATTATATGTAAAATAAAAATGG + Intronic
970948299 4:21721560-21721582 ACTTATAAGCAAAAATTGAGTGG - Intronic
970990339 4:22206463-22206485 AAATATATATAAAAAAAGAAAGG - Intergenic
971295966 4:25392035-25392057 AAATATATGTAAAAACTTAAAGG - Intronic
971470134 4:27016102-27016124 AATTAGAGTTAAAAATTCAAAGG - Intronic
971840516 4:31846263-31846285 AATTATATCTAAAATTGTAAAGG + Intergenic
971896873 4:32608039-32608061 AATTATTCCTTAAAATTGAAAGG - Intergenic
971963546 4:33520882-33520904 AACTATAAATAGAAATTGAAAGG + Intergenic
972463623 4:39330257-39330279 AATGATATGTAAAAATCAAAAGG + Intronic
972962615 4:44472773-44472795 AATTAGATGTAGAAAGGGAAGGG + Intergenic
973733574 4:53847616-53847638 AATTATATTTTTAAATTTAATGG - Intronic
973903566 4:55503637-55503659 AATTAAATTTAAAAAATCAAGGG - Intronic
973995498 4:56454633-56454655 AATTCTATTGAAAAAATGAAAGG - Intronic
974164458 4:58183749-58183771 ATTGATATGTGAAAAATGAAAGG - Intergenic
974390449 4:61260165-61260187 AAATATATGAAACATTTGAAGGG + Intronic
974660233 4:64878907-64878929 AATTCTATTTAAGAATGGAAAGG + Intergenic
975082943 4:70302266-70302288 AACTTTATGTAAAATTTGATAGG - Intergenic
975176446 4:71294804-71294826 AGTGATATGTAAAGAATGAATGG + Intronic
975302300 4:72804553-72804575 AATAATATTCATAAATTGAAAGG + Intergenic
976128325 4:81856901-81856923 AGTTATATGTAAAATTAGACAGG + Intronic
976237763 4:82917732-82917754 AATTAAACGTAAAAAATGGATGG - Exonic
976567495 4:86567653-86567675 ATTTATTTGTATAAATTTAAGGG - Intronic
976567695 4:86570616-86570638 AATTATTTGTAAATATTTCAGGG - Intronic
976627859 4:87206423-87206445 TACTTTATGTAAAAAATGAATGG - Intronic
976776939 4:88717521-88717543 AAGTATATTTAAAGAATGAATGG - Intergenic
976803164 4:89015695-89015717 ACATATATGTATAAATAGAATGG - Intronic
976881788 4:89933825-89933847 AATTATATTTTGAATTTGAATGG + Intronic
977188368 4:93969330-93969352 AATAATCTGTTAAAATTGAGAGG - Intergenic
977332775 4:95658650-95658672 AATTAAAAACAAAAATTGAAAGG - Intergenic
977420343 4:96791766-96791788 AAATATATGTAAAGAGTGAAGGG + Intergenic
977511151 4:97964684-97964706 AAATATGTGTAACAATTTAAAGG - Intronic
977523266 4:98112245-98112267 AAATACATCTAAACATTGAAAGG - Intronic
977663361 4:99616488-99616510 CATTATATCTTAAGATTGAAAGG - Intronic
977985537 4:103378553-103378575 AATTTTATCTTAAAATTAAATGG + Intergenic
978148319 4:105404324-105404346 AATTATATTTAAAAAATCAGGGG - Intronic
978159800 4:105532259-105532281 AATTAAAAAAAAAAATTGAATGG - Intergenic
978326203 4:107559691-107559713 ACTTAAATCTAAATATTGAAAGG - Intergenic
978343714 4:107743474-107743496 AACTAGATGGAAAAGTTGAAGGG + Intergenic
978411122 4:108427074-108427096 AATTATATGTAGTAATTAATTGG - Intergenic
978803480 4:112776994-112777016 AGTTGTTTCTAAAAATTGAAAGG + Intergenic
978959462 4:114658601-114658623 AAGTATAATTAAAAGTTGAACGG - Intronic
979033735 4:115684989-115685011 AGTTAAATGTATAAATTAAATGG - Intergenic
979149374 4:117290087-117290109 AATTACCTGCAAAAATTAAATGG + Intergenic
979644931 4:123057444-123057466 AATTACATGAAATAATTTAATGG - Intronic
979786262 4:124718821-124718843 AGTTTTATATAAAAATGGAATGG + Intergenic
980191876 4:129535046-129535068 AAGTGGATCTAAAAATTGAATGG + Intergenic
980394719 4:132196293-132196315 AATTTTTTAAAAAAATTGAAAGG - Intergenic
980538026 4:134154492-134154514 AATCATATGTAAAATTCAAAAGG - Intergenic
980546840 4:134274887-134274909 AATTATATGTGAGAAATGACAGG - Intergenic
980656966 4:135801277-135801299 TTTTATATGTAAAAATTAAATGG + Intergenic
980763337 4:137266069-137266091 ATTGATATGTAAAAATTTTAAGG - Intergenic
980845610 4:138320805-138320827 AATTTTATTTAAAAATGTAAAGG + Intergenic
980888371 4:138787597-138787619 ATATATATTTAAAAATTCAAAGG + Intergenic
980979815 4:139644753-139644775 TATCATATGTAAAGATTGAATGG - Intergenic
980986368 4:139698927-139698949 TATTACAAGAAAAAATTGAATGG - Intronic
981128751 4:141134459-141134481 ATTTAAATTTAAAAAATGAAAGG + Intronic
981458829 4:144988276-144988298 AACTTTATGTAAAAATTGTGGGG - Intronic
981876517 4:149553069-149553091 AATTATATTTAAAATTCCAATGG + Intergenic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982005628 4:151060332-151060354 GATTATTTGTAGAAATAGAAAGG - Intergenic
982129651 4:152216836-152216858 AACTCTATGAAAATATTGAAAGG - Intergenic
982185281 4:152790178-152790200 AATTACCTGTGAATATTGAAGGG + Intronic
982273583 4:153616786-153616808 AATTTTCTATAAAAATTAAATGG + Intronic
982340920 4:154297820-154297842 CAATATATGAAAAACTTGAAGGG + Intronic
982476362 4:155856302-155856324 AATTATATGTATACATTGTGGGG - Intronic
982593789 4:157352109-157352131 AATTATATGTAGATATTTACTGG + Intronic
982608379 4:157541660-157541682 AAATAATTGTAAAAATTAAAAGG - Intergenic
982889329 4:160826925-160826947 AATTTATTTTAAAAATTGAAGGG + Intergenic
982929615 4:161386948-161386970 AATAACATATAAACATTGAAAGG - Intronic
983013976 4:162586326-162586348 AAATATATCTAAACATAGAAAGG + Intergenic
983050004 4:163034963-163034985 ATATATATGACAAAATTGAAAGG - Intergenic
983322969 4:166217611-166217633 AATTATCTGTGAAAATATAAAGG - Intergenic
983776772 4:171617451-171617473 AAATATATCTAAAAAGTAAAGGG - Intergenic
983801365 4:171934241-171934263 AAATATATGTAAATATTTAGGGG + Intronic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
984613064 4:181863490-181863512 AATTATAGGCAAAAAGTTAATGG + Intergenic
984710187 4:182878516-182878538 AGTTTTATGGAAAAATTGACTGG + Intergenic
985138895 4:186818541-186818563 AAGTTTATATAAAAATTCAAAGG - Intergenic
985144187 4:186876706-186876728 AATGATATGCAAAAATAGCAGGG - Intergenic
985215024 4:187642752-187642774 ATTTATAGGTCAAAAGTGAAGGG + Intergenic
985504089 5:268714-268736 GATTATATTTAAATATTAAAAGG + Intergenic
986569604 5:9151515-9151537 AATTATAAGGAAAAATTGTGGGG - Intronic
986611727 5:9575022-9575044 AATTCTATTTCAAAATTCAAGGG + Intergenic
986755144 5:10828769-10828791 AATTATTTGTACAAATTTATGGG + Intergenic
986897402 5:12386694-12386716 AATTATATGAAAGAATCCAATGG - Intergenic
986998577 5:13635550-13635572 AAATAAATGTAAAATTTTAAAGG + Intergenic
987512813 5:18862209-18862231 AATTATATCTAAAAAATTAAAGG + Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987646828 5:20684316-20684338 AAACATATCTAAAAATAGAAAGG - Intergenic
987689833 5:21252416-21252438 TATTATATTTAAGAAATGAAAGG - Intergenic
987847726 5:23307932-23307954 AATTATAAGAAAAAATCAAAAGG + Intergenic
987874606 5:23664820-23664842 AAATATATACAAACATTGAAAGG + Intergenic
987942602 5:24561366-24561388 AATTATATGAGAAAATTGTGAGG + Intronic
987953300 5:24704214-24704236 AATTATATTCAAAAGTGGAATGG - Intergenic
988005408 5:25403745-25403767 ATTTCAATGTAAAATTTGAAGGG - Intergenic
988007609 5:25437663-25437685 AATAATTCATAAAAATTGAATGG - Intergenic
988113135 5:26849291-26849313 TTTTATTTGTAAAAATTTAAAGG + Intergenic
988181067 5:27794829-27794851 AATAAAGTGTAAAAATTAAAGGG + Intergenic
988259457 5:28865553-28865575 AAATTTATATAAAAATAGAAAGG + Intergenic
988293420 5:29320998-29321020 AACCATATGTAAACATAGAAAGG + Intergenic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
988881049 5:35503098-35503120 AAAGATGTGTAAAACTTGAATGG + Intergenic
989194630 5:38704545-38704567 AATTATGTGAAAAAAGTCAATGG - Intergenic
989262349 5:39432391-39432413 AATTTTATGTAGAAATGAAAAGG + Intronic
989263050 5:39440552-39440574 ATATTTATGTTAAAATTGAAAGG - Intronic
989271391 5:39537636-39537658 AATTATTTGAAAAAATTAAATGG - Intergenic
989279869 5:39628315-39628337 TTTTATATGGAAAAATTGATGGG + Intergenic
989631714 5:43490320-43490342 AACTTTATGGAAAAATTTAAAGG - Intronic
989657113 5:43756587-43756609 AACTATTTCAAAAAATTGAAAGG - Intergenic
989676810 5:43982164-43982186 AATTAAATTTAAAAATTGATAGG - Intergenic
989681811 5:44038579-44038601 AATTATGTGAAAAAGTTCAATGG + Intergenic
990040220 5:51370466-51370488 CATTATATGGCAAAAGTGAAAGG + Intergenic
990128984 5:52556277-52556299 CATAATATTTAAAAATTGAAAGG + Intergenic
990247403 5:53876464-53876486 AAGTATATAAAAAAATTAAAAGG + Intergenic
990361772 5:55028008-55028030 AAGGATATCTAGAAATTGAAAGG + Intronic
990404990 5:55480322-55480344 AATTATATGTATACTTAGAATGG - Intronic
990590756 5:57261341-57261363 AATTATATGTAAGCATGGAGTGG + Intronic
990670260 5:58121053-58121075 AATTAAATGGATAAATTGTATGG + Intergenic
990794787 5:59527261-59527283 ATAAATTTGTAAAAATTGAATGG + Intronic
990821328 5:59843885-59843907 TCTTATATCTAAAAATTGAGGGG - Intronic
990841470 5:60084526-60084548 AATTGTATGTAAATTTTGGAGGG - Intronic
991135034 5:63172554-63172576 AAATATTTGTAGAAATTGTAGGG + Intergenic
991150921 5:63369022-63369044 AAATTTATATAAAAATTTAAAGG + Intergenic
991267227 5:64735416-64735438 AAATCTTTTTAAAAATTGAAGGG - Intronic
991725582 5:69532604-69532626 AGTGATATGTAATAATTTAAAGG + Intronic
992205700 5:74428338-74428360 AATTATATGTTAACATTATATGG + Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992504359 5:77371571-77371593 AAATTTATATAGAAATTGAAAGG - Intronic
992555831 5:77902509-77902531 AATTATTTGTTAAACTTAAAAGG + Intergenic
992938201 5:81733961-81733983 AATTATATGAAAAAAATCAAAGG + Intronic
993010302 5:82474911-82474933 AATTATATGCAAATATTTGAAGG - Intergenic
993017225 5:82548143-82548165 AAATATTTATAAAAATGGAATGG + Intergenic
993150798 5:84159878-84159900 AATTATATGTAACAAGAGATTGG - Intronic
993180406 5:84545591-84545613 ATTTATTGGCAAAAATTGAAAGG + Intergenic
993373703 5:87123056-87123078 CAATATATGTAAAAATGAAAAGG - Intergenic
993383697 5:87238091-87238113 AATTGCATGTAAAAATTTTAAGG + Intergenic
993594705 5:89839102-89839124 AATTATTGTTAAAAGTTGAAAGG + Intergenic
993802945 5:92366695-92366717 AATTATATGTAATAACAGATTGG - Intergenic
993970648 5:94415662-94415684 AATTATATGTGAAAGCTCAAAGG - Intronic
994403363 5:99311706-99311728 AAATAGATGAAAAAATTGAAGGG - Intergenic
994621575 5:102169880-102169902 ACTTATATGCAAAAAATAAAAGG + Intergenic
994655001 5:102581635-102581657 AATTATCATTAAAAATTAAAAGG - Intergenic
994731541 5:103497630-103497652 AATCATCTCTAAAACTTGAATGG - Intergenic
994874730 5:105404325-105404347 ATTGAAATGTAAAAATAGAAAGG - Intergenic
994898517 5:105738839-105738861 AATTATGTGGCAAAAATGAATGG - Intergenic
995748858 5:115432613-115432635 AATTTTACGCAAAAATAGAATGG + Intergenic
995949423 5:117691700-117691722 AAATATATATAAAGATTAAAAGG + Intergenic
996103191 5:119466351-119466373 AACTATTTCAAAAAATTGAAGGG - Intronic
996193520 5:120575055-120575077 AATAATAAGTAATAATTAAAAGG - Intronic
996531034 5:124527201-124527223 TCTTATGTGTAAAAATGGAATGG - Intergenic
996569382 5:124915787-124915809 AATTCTATGAAAAAAGTCAATGG - Intergenic
996833357 5:127764372-127764394 AATTAAATGTAGAAGTTGAAGGG + Intergenic
996946365 5:129074233-129074255 AAATACATGTATAAATTGACTGG - Intergenic
997380796 5:133436156-133436178 AAGTATATGTAAAATTACAATGG + Intronic
998024041 5:138798166-138798188 AAGTAGATGGAAAAATAGAAGGG + Intronic
998116870 5:139544714-139544736 ATTCATATGTAAAAAATTAAAGG - Intronic
998392197 5:141794486-141794508 AATAAAATGTAAAAAAGGAAAGG + Intergenic
998700585 5:144694169-144694191 AACTTTATGTACAAATTTAAAGG - Intergenic
998753897 5:145354326-145354348 AATAAAATGTAAACATAGAATGG - Intergenic
998821063 5:146058415-146058437 AAATAAATGTCTAAATTGAAAGG + Intronic
998859340 5:146427406-146427428 AAGTAAATGAAAAAATGGAATGG - Intergenic
998980833 5:147700315-147700337 AATTATAATTGAAAATTAAATGG + Intronic
999067194 5:148700445-148700467 AATTATATGTCAAAATCTATAGG + Intergenic
999137807 5:149334547-149334569 AATTATCTGGAAAAATGTAAGGG + Intronic
999211029 5:149888692-149888714 AAGTATAGGAAAAAGTTGAATGG + Intronic
999632160 5:153582441-153582463 AATTAAAAGGAAAAATTGATGGG - Intronic
999728935 5:154461066-154461088 AATTCTATATAAAAATTCAAAGG - Intergenic
999979586 5:156945024-156945046 AATTACATGAAAAAATGGAGAGG + Intronic
1000375567 5:160577939-160577961 AAATAGATGAAAAAATAGAAGGG - Intronic
1000561415 5:162793824-162793846 AAATATATTTAACAATAGAAAGG + Intergenic
1000654803 5:163863837-163863859 AATTATAATTTCAAATTGAAGGG + Intergenic
1000890495 5:166795988-166796010 AGTTATATGGAAAAGTCGAAGGG + Intergenic
1001790886 5:174457069-174457091 AATTATTTATTAAAATTAAAGGG - Intergenic
1001916199 5:175562603-175562625 AATTATAACTAAAAATAGTAAGG + Intergenic
1002333133 5:178459017-178459039 AATTGTAAGAAAAAATTAAAGGG + Intronic
1002403556 5:179009945-179009967 AAATATATGTAGAAAATCAAAGG + Intergenic
1002556384 5:180045206-180045228 AATAGTATGTAAATATTTAAAGG + Intronic
1002952008 6:1823371-1823393 AGTTATTTGTAAAAATGGGAAGG + Intronic
1003495837 6:6662459-6662481 AAGTATATATAAAAAATGACAGG - Intergenic
1003586787 6:7397441-7397463 AAGTATTTTTAAAAATTTAAGGG + Intronic
1003607466 6:7576690-7576712 AATTATCTTTATAAATTGAGGGG + Intronic
1003827095 6:9964996-9965018 CAATATTTTTAAAAATTGAAAGG + Intronic
1004055772 6:12137024-12137046 ATATATAGGTAAAAATTCAAAGG + Intronic
1004647646 6:17578107-17578129 TGTTATATGGAAAAGTTGAAGGG - Intergenic
1005191613 6:23229691-23229713 AAATATCTGTAAATATTGCAAGG + Intergenic
1005775199 6:29123785-29123807 AATACTATTTAAAAATTCAAAGG - Intergenic
1005781262 6:29195021-29195043 AATACTATTTAAAAATTCAAAGG - Intergenic
1006999217 6:38293284-38293306 AATTCTATGAAGAAATTCAATGG - Intronic
1007350082 6:41266021-41266043 AATTATTTGTATAAATTCACAGG - Intergenic
1008189001 6:48431526-48431548 GAATGTTTGTAAAAATTGAAAGG + Intergenic
1008390051 6:50939944-50939966 AATTATATGTCAAAATTTGTGGG - Intergenic
1008845255 6:55955585-55955607 AATTATATAAAATAATTAAAAGG + Intergenic
1009194211 6:60665130-60665152 AATTTTATATAAAAAATTAAGGG - Intergenic
1009297220 6:61966972-61966994 AATTATGTTTAATAAATGAATGG + Intronic
1009386649 6:63092193-63092215 AATTATATGTCAGAAATGATAGG + Intergenic
1009459139 6:63891697-63891719 AATAGTATGTAGAAATGGAATGG - Intronic
1009626234 6:66141397-66141419 AATGATCTGCAAAAATAGAATGG - Intergenic
1009642649 6:66358052-66358074 ATGTATATGTAGAATTTGAATGG + Intergenic
1010158566 6:72824537-72824559 AAGTACATGTGCAAATTGAAAGG - Intronic
1010241110 6:73616453-73616475 AATTGTAAGAAAAAAATGAATGG - Intronic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1010481318 6:76357777-76357799 ATTTATATTGAAAAATAGAATGG - Intergenic
1010688916 6:78885952-78885974 ACTTATATTTAAAGATTTAATGG + Intronic
1011273938 6:85609571-85609593 AATCAGATGTTAAAAATGAAGGG - Intronic
1011544447 6:88468581-88468603 AATAATTTTTAAAAATTAAAAGG + Intergenic
1012013003 6:93815382-93815404 AATTATTTGTATAAATTTAATGG - Intergenic
1012124415 6:95409683-95409705 AATTATAATTATAAAATGAAAGG - Intergenic
1012467787 6:99534784-99534806 AATTGTATGTGAAAATTGTAAGG - Intergenic
1012745739 6:103085836-103085858 AATTATTTTAAAAAATGGAAAGG - Intergenic
1013569353 6:111405877-111405899 AACTATATTTAAAAATTAAAAGG + Intronic
1013825367 6:114204797-114204819 AAATATAAGTACAAAATGAAAGG - Intronic
1013878257 6:114861225-114861247 TATTATCTGTAAAATTAGAAAGG + Intergenic
1013890091 6:115016358-115016380 AATTTTATGGAAACATTGGAAGG + Intergenic
1013901290 6:115159898-115159920 ATTTTTATGCAAACATTGAAGGG - Intergenic
1013963138 6:115925778-115925800 AATTATAAGAAAAAATAAAAGGG - Intergenic
1014054347 6:116996570-116996592 ATTTATATATAAAAATTGCATGG - Intergenic
1014307611 6:119761288-119761310 AATTAGGTGAAAAAATAGAAGGG - Intergenic
1014411772 6:121132900-121132922 ATACATATGTAAAAATTCAAAGG + Intronic
1014480448 6:121929309-121929331 AATTATATAAATATATTGAAAGG + Intergenic
1014707700 6:124767813-124767835 AAATAAAAGTAAAAAATGAATGG - Intronic
1014724561 6:124959805-124959827 AATGATTTAAAAAAATTGAAGGG + Intergenic
1014783805 6:125594981-125595003 AATTATTCCTAAAAATTAAAAGG + Intergenic
1014879655 6:126707783-126707805 ATAAATATTTAAAAATTGAAGGG + Intergenic
1015078689 6:129196142-129196164 AACTATATGAACAAATTTAAAGG - Intronic
1015433902 6:133163547-133163569 AATTATGTGTAAAGATTTCAAGG + Intergenic
1015667070 6:135643898-135643920 AAGCATATCTAAAAATTCAATGG + Intergenic
1016028764 6:139316032-139316054 AATAATAAGTAAAAAATGACAGG + Intergenic
1016106284 6:140167233-140167255 AAATGTAAGTAAAAAGTGAAAGG - Intergenic
1016319226 6:142823943-142823965 AATCACATGTTAAAACTGAAAGG - Intronic
1016505768 6:144777336-144777358 AATTAAATGAAAAAATTAAATGG + Intronic
1017555440 6:155561089-155561111 AATTATTTTTAAAAATCCAAAGG + Intergenic
1017700847 6:157069240-157069262 AATAATATATAAAAAATAAATGG - Intronic
1017835573 6:158174523-158174545 ACTTTTATGTCAAAACTGAAAGG + Intronic
1018551729 6:165005975-165005997 AATAATATGAAAGAATAGAATGG - Intergenic
1018877183 6:167832780-167832802 AATTTAATGTTAAAATTGTATGG + Intronic
1019075593 6:169385015-169385037 AATTATATGTAAAACTGAATTGG - Intergenic
1019697781 7:2456840-2456862 AACTATGTGTAAAGAATGAAAGG - Intergenic
1020416362 7:7950657-7950679 AATTCAAGGTAAAAATTCAAAGG - Intronic
1020732608 7:11902011-11902033 AACTATTTCAAAAAATTGAAAGG + Intergenic
1020917504 7:14214488-14214510 AAATATATGTAAATATTATATGG + Intronic
1021060205 7:16101922-16101944 AATTCTGTGAAAAAATTCAATGG - Intronic
1021141760 7:17034163-17034185 CATTATGTGTTAAAATTGAAAGG - Intergenic
1021148010 7:17113149-17113171 AAATATATATAAAAATGAAAAGG - Intergenic
1021161698 7:17281216-17281238 AAATATATGAAAAACATGAATGG - Intergenic
1021712651 7:23431440-23431462 AAGTATCTGTAAAAGTGGAAAGG + Intronic
1022308911 7:29176556-29176578 ATTTATAGACAAAAATTGAAAGG + Intronic
1022397494 7:30002787-30002809 AATTATATGGATAATTTAAAGGG + Intergenic
1022608571 7:31843343-31843365 CATAAAATGTAAAAATTGATAGG - Intronic
1022750955 7:33225166-33225188 AATAATATCAATAAATTGAAAGG - Intronic
1022867846 7:34441014-34441036 AATAATAAATAAAAATAGAAGGG + Intergenic
1023209608 7:37789466-37789488 AATTATAAGTAATATCTGAAAGG - Intronic
1023505937 7:40899770-40899792 AATGATATTTCAACATTGAAAGG - Intergenic
1023701829 7:42899621-42899643 AAATATATATAATAATTCAAGGG + Intergenic
1024115000 7:46184394-46184416 AATTATCTGTCAACATTTAATGG + Intergenic
1024133441 7:46381215-46381237 AATTTCATGATAAAATTGAATGG + Intergenic
1024788808 7:52939208-52939230 AAAACTATTTAAAAATTGAATGG - Intergenic
1024858312 7:53807643-53807665 AAATATATGTAAAAACTGTCAGG + Intergenic
1024911108 7:54448444-54448466 AATTATATATAAAAAATGTATGG + Intergenic
1025316227 7:58033845-58033867 AATCATATGGAATCATTGAATGG + Intergenic
1025322605 7:58112883-58112905 AATCAAATGGAAAAATCGAATGG - Intergenic
1025322827 7:58115812-58115834 AATCAAATGGAATAATTGAATGG - Intergenic
1025476513 7:60928920-60928942 AATTGAATGTAATAATCGAAAGG - Intergenic
1025476671 7:60930945-60930967 AATCAAATGTAACCATTGAATGG - Intergenic
1025559006 7:62346770-62346792 AATCAAATGGAAAAATTGAATGG + Intergenic
1025559739 7:62356580-62356602 AATTGAATGTAATCATTGAATGG + Intergenic
1025566380 7:62439644-62439666 AATTGAATGGAAACATTGAATGG - Intergenic
1025929264 7:65981689-65981711 AATTAAAAATAAATATTGAAAGG + Intronic
1026269735 7:68825693-68825715 AATTATTTGTATAAATTAAAGGG + Intergenic
1027639878 7:80719886-80719908 AATTTTCTTTAAAAATTAAAAGG + Intergenic
1027860945 7:83580160-83580182 AATGATTTGTAAAACTTGATAGG + Intronic
1027886029 7:83906180-83906202 AATTAAATGTAGATTTTGAAAGG + Intergenic
1028076567 7:86524198-86524220 AGTTATATGTAAAAAGGTAACGG + Intergenic
1028114095 7:86978026-86978048 AATTAAAAGTAAAATTTGAGTGG - Intronic
1028188072 7:87812632-87812654 TATTATATTTAACAATGGAAAGG + Intronic
1028308868 7:89303838-89303860 AATTATGCATAAACATTGAAAGG + Intronic
1028496427 7:91466117-91466139 AATTCTCTTTATAAATTGAAAGG + Intergenic
1028697726 7:93735755-93735777 AATTCTATTTAAAAATTTCATGG + Intronic
1028861042 7:95650654-95650676 AATTTTTTTTAAAAAGTGAACGG - Intergenic
1028919662 7:96297242-96297264 GATTATAAGTAAAAAATGACAGG - Intronic
1028946506 7:96585978-96586000 AAATAATTTTAAAAATTGAAAGG - Intronic
1029016974 7:97325423-97325445 AATTATAAGAAAAAGTTAAATGG + Intergenic
1029299548 7:99568612-99568634 AATTAAAATTAAAAATTAAAAGG - Intronic
1029852016 7:103471732-103471754 AATTTTATGTAAGATTTGCAAGG - Intergenic
1030395329 7:108979274-108979296 AATTATGTGAAGAAATTCAATGG + Intergenic
1030654643 7:112153514-112153536 AATTATATTTTAAAAATGATAGG + Intronic
1030959300 7:115895066-115895088 TATTTTATGTAAAACTTTAAAGG + Intergenic
1030984438 7:116224493-116224515 AATTATATTTCAAAATTGAAAGG - Intronic
1031052592 7:116959233-116959255 AATTCCTTGTAAAACTTGAACGG - Exonic
1031194651 7:118597339-118597361 AATTATATGTATAAAGTTAATGG + Intergenic
1031210392 7:118817867-118817889 AGTCATATGTCAAATTTGAATGG - Intergenic
1031382000 7:121098287-121098309 AATTATAGTTAAAAATTAAGAGG + Intronic
1031522767 7:122786618-122786640 ATTTACATCTCAAAATTGAAAGG - Intronic
1031581532 7:123480960-123480982 TAGTATATGTAAAAATTAAATGG - Intronic
1032126541 7:129198636-129198658 AAACATATCTAAACATTGAAAGG - Intronic
1032290658 7:130587499-130587521 ATTTAAATTTAAAAATTTAAAGG - Intronic
1032608741 7:133388351-133388373 AATTATACCTAAAAATTGGCCGG + Intronic
1032671975 7:134092230-134092252 AATTATATGTACACTTTAAAAGG + Intergenic
1032924453 7:136587377-136587399 AATTATTTTTAAAAGATGAATGG - Intergenic
1033094514 7:138418889-138418911 AATTTTATGCAAAATTAGAAAGG - Intergenic
1033373802 7:140737290-140737312 CATTCTATGTAAAATTTTAAAGG - Intronic
1034033449 7:147793653-147793675 AATTTCATGTGAAAATTCAAGGG - Intronic
1034721340 7:153296535-153296557 AATAAGATGTAAAAATTAGAAGG + Intergenic
1035738896 8:1910727-1910749 AATTATTTGGAAACATTGATTGG + Intronic
1035814531 8:2525092-2525114 AATTAAAAGGAAAATTTGAAAGG + Intergenic
1037212403 8:16406974-16406996 AATTATATGAAAACCTTGAAAGG + Intronic
1037416561 8:18656959-18656981 AATTATATTTAACAAAAGAACGG + Intronic
1038097871 8:24335834-24335856 AATTTTAAGTTAAAATTTAACGG - Intronic
1038507824 8:28101028-28101050 CATTGTATGTAAAAATTTTAGGG - Intronic
1038512720 8:28155039-28155061 AATTGTATTTAACATTTGAAGGG + Intronic
1038826822 8:31012389-31012411 ATTTATATGTAAAATTAAAATGG + Intronic
1038891039 8:31723845-31723867 AATTATTTTTAAAAGTTAAATGG + Intronic
1039029205 8:33291554-33291576 ATTTATATGTAAAAATTATGGGG - Intergenic
1039200935 8:35093234-35093256 AATTCTATGGATAAACTGAAAGG + Intergenic
1039646630 8:39291435-39291457 AATTAAATGTAATAATACAAAGG - Intergenic
1039656676 8:39416911-39416933 AATTTTATTTTAAAATTGAAAGG - Intergenic
1039836907 8:41263858-41263880 AAATATATGTAAAAAGTGCGGGG + Exonic
1039873751 8:41568104-41568126 ATTTATATGTAATTATTGAAAGG + Intergenic
1040042515 8:42930962-42930984 CATTATTTTTAAAAATTTAAAGG + Intronic
1040733480 8:50477798-50477820 AATTGTTTGTAAAAATAGAATGG - Intronic
1040811531 8:51459726-51459748 AATCATATGTAAAAACACAAAGG + Intronic
1041151187 8:54936284-54936306 TTTTATAGGTGAAAATTGAAAGG - Intergenic
1041283448 8:56235414-56235436 AATTACAAGTAATAATTAAATGG - Intergenic
1041307813 8:56481403-56481425 AATTTTATTTAATAATTTAAAGG + Intergenic
1041321187 8:56614179-56614201 AAATCTATATAAAAATGGAAAGG - Intergenic
1041326106 8:56666339-56666361 AATTATATGTATATACTGATTGG + Intergenic
1041346649 8:56906034-56906056 AATTATTTTTTAAGATTGAAAGG - Intergenic
1041539340 8:58965411-58965433 TCTTTTATTTAAAAATTGAAAGG + Intronic
1041566382 8:59283899-59283921 AATTATCTGTGTAAATAGAAGGG - Intergenic
1041786809 8:61643671-61643693 AAGAATATTTGAAAATTGAAGGG - Intronic
1042062761 8:64839125-64839147 ATTCAAATATAAAAATTGAATGG + Intergenic
1042237773 8:66630985-66631007 AATTATATGATAACCTTGAATGG + Exonic
1042446076 8:68886314-68886336 AAATATAATTAAAAATTAAAAGG + Intergenic
1042591103 8:70400137-70400159 AATTATATTTAACCAATGAAGGG + Intronic
1042646228 8:70989248-70989270 AATTATTTGCAAAAATTTTATGG + Intergenic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1042782682 8:72509560-72509582 AATCATTTGCAAATATTGAAAGG + Intergenic
1042972654 8:74427876-74427898 AATTATTTTTAAAAATTAATAGG - Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043265462 8:78262135-78262157 AATTAGATATAGAAATAGAATGG - Intergenic
1043276007 8:78393698-78393720 TATTATATGTAATAACTTAATGG + Intergenic
1043740649 8:83807519-83807541 CAATATATGTGAAGATTGAAGGG - Intergenic
1043826156 8:84931096-84931118 AACAATATGTAAATATTTAATGG - Intergenic
1043885294 8:85592502-85592524 AATTGTATTTAAAAATCAAAAGG + Intergenic
1044313264 8:90720169-90720191 AATTATCTGTAAAAGTCAAATGG - Intronic
1044653981 8:94528624-94528646 CATTATTTTTAAAAATTCAAGGG - Intronic
1045148434 8:99374401-99374423 GATAATATGTTAGAATTGAAGGG - Intronic
1045205127 8:100030953-100030975 AATTATATGTAAAATGGGCAAGG + Intronic
1045475974 8:102552881-102552903 AATAATAAGTAAATATAGAAAGG + Intronic
1045633280 8:104153058-104153080 AATTATATGTAAATAATAATTGG + Intronic
1045962958 8:107990150-107990172 AATTCTATGGACAAATTGAATGG + Intronic
1046221464 8:111221952-111221974 ATTTACATGTACAAATTGAATGG - Intergenic
1046241105 8:111494774-111494796 AAATATATATTAAAATAGAAAGG - Intergenic
1046297389 8:112238640-112238662 AATTATTTATAAAAATTATATGG - Intronic
1046300585 8:112280855-112280877 AATTAAAATTAAAAATAGAATGG - Intronic
1046425408 8:114042180-114042202 AATAATATTTAAAAATAAAATGG + Intergenic
1046535635 8:115505628-115505650 TGTTATTTGTAAAAATTAAAAGG - Intronic
1046705801 8:117450228-117450250 AATTATTTGTAAATATAGATTGG - Intergenic
1046943247 8:119951827-119951849 AATAGTACGTAAAAATTGAGAGG + Intronic
1047135917 8:122078482-122078504 AATTATAAGCAAAATTTGAAAGG + Intergenic
1047310519 8:123687972-123687994 CATTATTTGAAAACATTGAAAGG + Intronic
1047918710 8:129610609-129610631 AAATATATGTAAATATGGGAGGG - Intergenic
1048375143 8:133816702-133816724 CATTAGATGTACAAAATGAAAGG - Intergenic
1048897637 8:139007229-139007251 AAATATATATAAAAATTAACTGG + Intergenic
1049722964 8:144129157-144129179 AACTATATATAAAAATTAAAAGG + Intergenic
1050056988 9:1666131-1666153 AACTAATTGTAAAAAATGAAAGG - Intergenic
1050218317 9:3355384-3355406 AATTATAAGAAAAAATGGACTGG + Intronic
1050224443 9:3435715-3435737 AATTATATTTATTGATTGAATGG + Intronic
1050328329 9:4519210-4519232 AACTATTTGTATAATTTGAATGG + Intronic
1050436588 9:5617190-5617212 AATTATCTGTCAAGTTTGAATGG - Intergenic
1050446704 9:5730478-5730500 CATTTTAGGTAAAAATTAAAGGG + Intronic
1050450297 9:5773672-5773694 AATTATATTTTACAATTGAAAGG - Intronic
1050795000 9:9528002-9528024 AATTATTTGGTATAATTGAATGG - Intronic
1050797916 9:9568230-9568252 AATTAAATTTAAAGCTTGAAAGG + Intronic
1050823249 9:9910253-9910275 TATTTTATGTAAAAATTCAGGGG - Intronic
1050949375 9:11568093-11568115 AATTATTAGTAAAGATTGCAGGG - Intergenic
1050979581 9:11992987-11993009 AATCAGATGTAAAAAGAGAAAGG + Intergenic
1051208600 9:14716577-14716599 AATTATCTGTAAAAATTCAGAGG + Intergenic
1051239315 9:15036141-15036163 TATTATATTTAAAAACTGTAAGG + Intergenic
1051517807 9:17950237-17950259 AATTATATTTAAAAACAGAAAGG + Intergenic
1051814088 9:21084562-21084584 ATTTATATGTAAAAAATAAAAGG + Intergenic
1051830542 9:21271098-21271120 AATTATGTGAACAAAGTGAAAGG + Intergenic
1051861950 9:21635329-21635351 AAATAGTTGGAAAAATTGAATGG - Intergenic
1051950643 9:22627455-22627477 AAATATTTGTAAAATTTTAAAGG + Intergenic
1051963801 9:22801248-22801270 AATGATATGTAACACTTGATTGG - Intergenic
1052018312 9:23495906-23495928 ACTTTTATGTAATAATGGAAAGG + Intergenic
1052160461 9:25251610-25251632 AATTATATCAACAAATTAAATGG + Intergenic
1052451102 9:28632262-28632284 AATCAAATATAAAAATGGAAAGG + Intronic
1052502619 9:29311733-29311755 TATTATCTGTAAAAATGAAAAGG - Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1052537407 9:29764470-29764492 ATTTATTTGTATAAATTTAAGGG - Intergenic
1053230479 9:36403605-36403627 ATTTTTATTTTAAAATTGAAGGG - Intronic
1053552203 9:39094834-39094856 AATTTTATTTAAATATTGATAGG + Intronic
1053816334 9:41914987-41915009 AATTTTATTTAAATATTGATAGG + Intronic
1053947013 9:43320885-43320907 AATCAAATGTAATCATTGAATGG - Intergenic
1053948881 9:43346185-43346207 AATTGAATGGAACAATTGAATGG - Intergenic
1053948920 9:43346642-43346664 AATTGAATGGAACAATTGAATGG - Intergenic
1053949112 9:43349042-43349064 AATTGAATGTAATAATCGAATGG - Intergenic
1053949542 9:43354487-43354509 AATCAAATGTAATCATTGAATGG - Intergenic
1054106594 9:61058671-61058693 AATTTTATTTAAATATTGATAGG + Intergenic
1054614263 9:67272454-67272476 AATTTTATTTAAATATTGATAGG - Intergenic
1055160083 9:73115753-73115775 AATTATTTGTAACAAAGGAAGGG - Intergenic
1055345639 9:75334662-75334684 AATAACATTTAAAAAATGAAGGG + Intergenic
1055635875 9:78278877-78278899 AATTATATGTGAAAATTCTCAGG - Intronic
1055794563 9:79961035-79961057 AATTTTATGTATTAAATGAAAGG + Intergenic
1055912599 9:81369393-81369415 AAGGATATGTAACATTTGAAGGG - Intergenic
1056236418 9:84599064-84599086 AATTATGTGTAAGAATCTAATGG - Intergenic
1056608658 9:88110177-88110199 AATTATAATTAAAAATTATAGGG - Intergenic
1057104229 9:92396334-92396356 AAATATATATAAAAATATAAAGG - Intronic
1057348177 9:94270566-94270588 ATATATATGAAAAAATTCAATGG - Intronic
1057370208 9:94464672-94464694 AATTATCTTTAATAGTTGAAAGG + Intergenic
1057459907 9:95251879-95251901 AAGATTATGTAAAAACTGAAAGG + Intronic
1058242000 9:102575479-102575501 AATTATATTTACATATTAAATGG + Intergenic
1058323724 9:103668360-103668382 AATTATGTGTATAAATAGATTGG - Intergenic
1058327758 9:103719255-103719277 AATTATTTGTGTAAATTTAAGGG + Intergenic
1058376324 9:104326139-104326161 AGTTAAATTTAAAAAATGAAGGG - Intergenic
1059208821 9:112491920-112491942 AAATATAAGAAAAAACTGAAGGG - Intronic
1059400580 9:114067557-114067579 AATTCTATTTAAAAATTTATTGG - Intronic
1060626181 9:125114263-125114285 AATGCTATGTGAAAATTGTATGG + Intronic
1061001006 9:127902888-127902910 AAATATATATAAAAATTGTGTGG - Intronic
1203590143 Un_KI270747v1:49443-49465 AATCAAATGTAATCATTGAATGG - Intergenic
1203592061 Un_KI270747v1:74386-74408 AATTGAATGGAACAATTGAATGG - Intergenic
1203592100 Un_KI270747v1:74843-74865 AATTGAATGGAACAATTGAATGG - Intergenic
1203592292 Un_KI270747v1:77243-77265 AATTGAATGTAATAATCGAATGG - Intergenic
1203592723 Un_KI270747v1:82688-82710 AATCAAATGTAATCATTGAATGG - Intergenic
1185923382 X:4119236-4119258 AACTTTATGTAAAAAATGGAGGG - Intergenic
1186111196 X:6257539-6257561 AATTAAAGTTAATAATTGAAAGG - Intergenic
1186349078 X:8724990-8725012 AGTTAAATGGAAAAGTTGAAAGG + Intronic
1186375397 X:8993272-8993294 AATTGTATTTGTAAATTGAATGG + Intergenic
1187089997 X:16086138-16086160 AATTATCTTTGGAAATTGAACGG - Intergenic
1187194253 X:17067176-17067198 AAAGATATGTAAGAATTGAAAGG - Intronic
1187317970 X:18215117-18215139 AATGATGTGTATACATTGAAAGG + Intronic
1188043012 X:25392243-25392265 ACATATATATACAAATTGAAAGG - Intergenic
1188146780 X:26624160-26624182 ATATATTTGTAAAAATTTAAGGG - Intergenic
1188268281 X:28105751-28105773 ACTTAGACTTAAAAATTGAAGGG - Intergenic
1188269469 X:28120964-28120986 AAATATATCTAAACATGGAAAGG + Intergenic
1188357222 X:29206791-29206813 AAAAAAATGTAAAAATTGGAAGG + Intronic
1188426544 X:30053884-30053906 AATTAAAAGTTAAAAATGAATGG - Intergenic
1188692125 X:33142412-33142434 TATTCAAAGTAAAAATTGAATGG - Intronic
1188762023 X:34044190-34044212 TATTATTTGTATAAATTTAAGGG - Intergenic
1188784286 X:34325304-34325326 AATGATATGGCAAAATTGGAGGG - Intergenic
1188843582 X:35045515-35045537 TTTAATATGTAAATATTGAAGGG + Intergenic
1188949516 X:36352317-36352339 AATGATATATATAAATTAAACGG - Intronic
1189394714 X:40611043-40611065 ATGTATATGTAAATATTGATTGG + Intergenic
1189649966 X:43178191-43178213 AATTATATTTAAAAAAAAAAAGG + Intergenic
1189708960 X:43789464-43789486 AATTAGATGTAAATATTCAAGGG + Intronic
1189781538 X:44518649-44518671 AATGATGTGTAAAACTTCAAAGG + Intergenic
1190487932 X:50948175-50948197 AATTAACGGTAAAAATTGAAGGG - Intergenic
1190818313 X:53948709-53948731 AAACATATGTAAAAGTAGAAGGG - Intronic
1190988909 X:55525589-55525611 AATTAGAGGTATAAATTGAGGGG - Intergenic
1191043398 X:56109631-56109653 AATTATATGCAAACACTGATAGG - Intergenic
1191753577 X:64569952-64569974 AATTTTGTGAAAAAATTCAATGG + Intergenic
1192085635 X:68094406-68094428 ACATATATGTAGAAATGGAAAGG - Intronic
1192957688 X:76090767-76090789 AATTCTGTGAAAAAATTCAATGG + Intergenic
1193446089 X:81604447-81604469 AAATATATCTAAACATAGAAAGG + Intergenic
1193481523 X:82034040-82034062 AATTTTATGTAAAAATTGCTAGG + Intergenic
1193519148 X:82507773-82507795 AAAAATATTTAAAAATTGATCGG - Intergenic
1193681300 X:84521818-84521840 AATTATCAGGAAAAATTGAAGGG + Intergenic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1193926368 X:87490655-87490677 AATTTTTTGAAAACATTGAAAGG + Intergenic
1194150456 X:90318732-90318754 AAATATATGAAAAAATAGCAGGG - Intergenic
1194280786 X:91951359-91951381 AATCACATGGAAAAATAGAAAGG - Intronic
1194372769 X:93094430-93094452 TATTCTCTGTATAAATTGAATGG - Intergenic
1194547055 X:95249667-95249689 AAATAGAAGAAAAAATTGAAGGG + Intergenic
1194642613 X:96420977-96420999 AAATATATGTGAAACATGAAGGG - Intergenic
1195371209 X:104175557-104175579 AATTATATCTTAAAATTGTATGG + Intronic
1195402570 X:104477224-104477246 AAATATCTGTGAAAATTGAGAGG + Intergenic
1195449351 X:104992775-104992797 AATTATAAATGAAAATTGAAAGG - Intronic
1195584117 X:106543949-106543971 TTTTATTTGTAAAAATTGAAGGG + Intergenic
1195712745 X:107787399-107787421 ATTTATTTGTACAAATTTAAGGG + Intronic
1196916724 X:120543916-120543938 AATCATATGTAAAAATTTATAGG + Intronic
1197085983 X:122476070-122476092 AATAAAATGTAATAATAGAAAGG + Intergenic
1197945062 X:131830012-131830034 AATTATAAGTAGAAAGTAAACGG + Intergenic
1198073801 X:133175657-133175679 AAATAGATATATAAATTGAAGGG + Intergenic
1198153926 X:133938978-133939000 AATTATTTAAGAAAATTGAATGG - Intronic
1198239325 X:134767669-134767691 AACTATAGGCAAAAACTGAATGG + Intergenic
1198596309 X:138239862-138239884 AATTATTTGTATAAATTTAAAGG - Intergenic
1198879884 X:141268578-141268600 AATTATATGCAAAATTTAGAAGG + Intergenic
1198952763 X:142091240-142091262 AAAGATATGTCAAATTTGAAAGG - Intergenic
1199231179 X:145437584-145437606 CAATATATGATAAAATTGAAGGG + Intergenic
1199382540 X:147187061-147187083 TATCATATGTAATAATTTAATGG + Intergenic
1200315171 X:155124801-155124823 AATTATTTGAAAACATGGAAAGG + Intronic
1200496819 Y:3895490-3895512 AAATATATGAAAAAATAGCAGGG - Intergenic
1200598269 Y:5174923-5174945 AATCACATGGAAAAATAGAAAGG - Intronic
1200680810 Y:6208468-6208490 TATTCTCTGTATAAATTGAATGG - Intergenic
1201231088 Y:11865229-11865251 AATTTTGTGTAGAAAGTGAATGG - Intergenic
1201365636 Y:13203758-13203780 ATTTATCTGTAAAATTTAAAGGG + Intergenic
1201934158 Y:19387963-19387985 AATTATTTCAAAAAATGGAAAGG - Intergenic
1201954233 Y:19604516-19604538 AATGATAAGTAAAACTTCAATGG + Intergenic
1202234012 Y:22688901-22688923 CATGATATATAAAACTTGAAAGG - Intergenic
1202309144 Y:23507257-23507279 CATGATATATAAAACTTGAAAGG + Intergenic
1202561657 Y:26163335-26163357 CATGATATATAAAACTTGAAAGG - Intergenic