ID: 1156224548

View in Genome Browser
Species Human (GRCh38)
Location 18:35091224-35091246
Sequence AATCTCATGTGACAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156224545_1156224548 0 Left 1156224545 18:35091201-35091223 CCACAAGTGAAAAATCCACACCT 0: 1
1: 4
2: 6
3: 34
4: 237
Right 1156224548 18:35091224-35091246 AATCTCATGTGACAGTTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156224548 Original CRISPR AATCTCATGTGACAGTTCAC AGG Intronic
903347184 1:22694262-22694284 CATTTCATTTGACAGTTAACAGG + Intergenic
903562462 1:24238171-24238193 ATTCTCATGGGAGAGTTCAAAGG - Intergenic
905910838 1:41652890-41652912 AAGCTCATGTGACAAATCAATGG - Intronic
907368400 1:53981263-53981285 AATCTGATGTGGCAGATCCCAGG + Intergenic
907803567 1:57796107-57796129 ACTCTCATATGACAGTTGGCAGG + Intronic
910420933 1:87062385-87062407 AATGTCACCTGTCAGTTCACTGG + Intronic
911289307 1:96037554-96037576 GATCTCATGTGAAAGTTGACAGG - Intergenic
912634887 1:111282779-111282801 CATCTCATATGAAAGATCACTGG + Intergenic
913209033 1:116568335-116568357 AAACTAATGTGACAGTTAACTGG + Intronic
913419440 1:118648809-118648831 AAACTCATGTGCAATTTCACAGG + Intergenic
913453749 1:119010024-119010046 GATCTCATGTTACAGTTCAGTGG - Intergenic
915665162 1:157437718-157437740 AATCTGAGGTGACAGTTTTCTGG - Intergenic
916203142 1:162290390-162290412 GTTCTCATATGACAGTTCTCTGG + Intronic
919527802 1:198676594-198676616 AATCACAGGTGACAGGTCATTGG + Intronic
921271649 1:213475517-213475539 AGTCTCATGTGAAATTTCAATGG + Intergenic
924617382 1:245623645-245623667 GACCGCATGTGACAGGTCACAGG + Intronic
1065712414 10:28531734-28531756 AAATTCATGTGAAAGTTCTCAGG - Intergenic
1066450514 10:35523997-35524019 AATCTAATGTTACATTTCAAAGG - Intronic
1068539770 10:58278816-58278838 GACCTCATGTGACAGTTCACCGG + Intronic
1069616820 10:69811514-69811536 AACCTCAAGTGCCAGTTCAGGGG - Intronic
1071864477 10:89712070-89712092 AAGAACATGTGACAATTCACAGG - Intronic
1078731323 11:13976972-13976994 AATCTCAAGTGACAGAAGACAGG - Intronic
1078877391 11:15412215-15412237 AAGCTGATGTCACAGATCACTGG + Intergenic
1079692560 11:23438020-23438042 AATCTGATGGAACAGTACACTGG - Intergenic
1080520510 11:33064458-33064480 AATCTGATCTGAGAGTTTACAGG - Intronic
1081916144 11:46731762-46731784 GTTCTCATGTGCCAGTTAACAGG - Intronic
1087733902 11:101810176-101810198 CATTTCATGTAACAGTTCACTGG + Intronic
1087833117 11:102841344-102841366 AATCTCATTTGAGAGTTTGCAGG + Intronic
1094038343 12:26094999-26095021 AATTTTATGTGCCAGTTTACTGG - Intergenic
1095366473 12:41412370-41412392 AATGTCATGTGGCAATTCCCAGG - Intronic
1096645689 12:53033702-53033724 AATCTCATGTAGCATTTCATAGG + Intronic
1096852750 12:54452391-54452413 ATTTTCATGTGCCAGTTCAATGG - Intergenic
1098179782 12:67833493-67833515 AATCTCATGTGTCATGCCACTGG - Intergenic
1099051311 12:77784552-77784574 AATCTATTGGGACACTTCACTGG + Intergenic
1101489466 12:105197873-105197895 AATCTCATGTGTCAGCCCAGGGG - Exonic
1102847062 12:116196460-116196482 TATCTCATGTGTCATTTCTCTGG - Intronic
1102966032 12:117126399-117126421 AGTCACATGTGACATTTGACAGG - Intergenic
1104480359 12:129102207-129102229 AGACTCATTTGCCAGTTCACTGG - Intronic
1105896404 13:24720259-24720281 AAACACCTGTGACACTTCACTGG + Intergenic
1107402235 13:40080830-40080852 AATCTCATTTGACTGTTGAATGG + Intergenic
1107561966 13:41565319-41565341 CTTCTCCTCTGACAGTTCACAGG + Intergenic
1108463737 13:50693932-50693954 AAACCCATGTGACATTTCACAGG + Intronic
1108698208 13:52921347-52921369 AAGCTCATGTGACATGACACAGG + Intergenic
1110579028 13:77097381-77097403 TGTCTCATGTGATAGGTCACCGG + Exonic
1115502060 14:34059248-34059270 AATCTCATGTGTCATTTCTGTGG + Intronic
1115957677 14:38799219-38799241 AATTTCATTTGACAGCTGACAGG + Intergenic
1116905364 14:50397961-50397983 AATCTCATCTGAAAGCTCACTGG - Intronic
1117984933 14:61377942-61377964 AATCTAAGGTTACAGTTCTCTGG + Intronic
1119280763 14:73405620-73405642 ACTCTCATGTGTCAGTCCCCAGG + Intronic
1120532008 14:85643257-85643279 CATCTCATGAGAGAGTTCAGAGG + Exonic
1131713537 15:95082025-95082047 AAACTCATGTTACAGTTCCTTGG + Intergenic
1134421342 16:14092727-14092749 CATCTCTTGTGAGAGTTTACAGG - Intronic
1135792744 16:25412455-25412477 AATATCACCTGAAAGTTCACAGG - Intergenic
1136164937 16:28447309-28447331 TTTCTCATGTGACAGTTCAGAGG - Intergenic
1136198029 16:28667672-28667694 TTTCTCATGTGACAGTTCAGAGG + Intergenic
1136214375 16:28781848-28781870 TTTCTCATGTGACAGTTCAGAGG + Intergenic
1136259097 16:29061692-29061714 TTTCTCATGTGACAGTTCAGAGG + Intergenic
1138526186 16:57608748-57608770 TTCCTCAAGTGACAGTTCACTGG + Intergenic
1138947335 16:61867534-61867556 AATCTCAGGTCAATGTTCACAGG + Intronic
1138981881 16:62279676-62279698 AATCTCATTTGAGAGTTTAGGGG + Intergenic
1140679776 16:77373761-77373783 AATCTCAGGTCACAGTTTACTGG + Intronic
1142947224 17:3440593-3440615 AATTTCATGTGTCATTACACTGG - Intronic
1149956215 17:61053559-61053581 AATCTAATGTGACATTTGAAAGG - Intronic
1150147480 17:62781121-62781143 AATCTGATGAAACAGTTCACAGG + Intronic
1156224548 18:35091224-35091246 AATCTCATGTGACAGTTCACAGG + Intronic
1158760035 18:60374014-60374036 AATCTCATGTTACAGGTGGCAGG + Intergenic
1159715497 18:71816698-71816720 AATCTCATGTGATGGTTCCTGGG + Intergenic
1160067470 18:75589139-75589161 GATGCCATGTGAGAGTTCACAGG - Intergenic
1162971567 19:14183939-14183961 AACCTCCTGGGACAGCTCACGGG + Intronic
1164295598 19:23906919-23906941 AATCCCTAGTGACATTTCACAGG + Intergenic
927474746 2:23404211-23404233 AATCTCAGGTGATGGTTCCCTGG + Intronic
928767723 2:34667886-34667908 AATCTCATGTCACATTTCTAAGG - Intergenic
929851863 2:45598773-45598795 AATCACATGGGACAGATAACAGG + Intronic
933640581 2:84754769-84754791 AAACTCATGTGAAAGTTCAAGGG - Intronic
934537903 2:95151542-95151564 AAACTCATGTCATAGTTCATAGG - Intronic
934542318 2:95185905-95185927 GATCTCATGTGATGGGTCACAGG + Intergenic
936891107 2:117371375-117371397 AGTCTCATGTGACAGTACCTGGG - Intergenic
937772232 2:125733062-125733084 AATCTCATTTGACATCTCTCTGG - Intergenic
939637985 2:144606472-144606494 CATCTCAGGTGGAAGTTCACAGG + Intergenic
944143021 2:196477510-196477532 AATCCCCTGTGACAGTTGAAGGG - Intronic
946762593 2:223009663-223009685 AAGCTCATGTTCCAGTTCAAAGG + Intergenic
1168843998 20:929739-929761 AATCTCATGTGATAGTCCCTGGG + Intergenic
1168904904 20:1395318-1395340 TCTCTCATGTAACAGTTCAGAGG + Intergenic
1172273733 20:33668619-33668641 AATCTCATGTGAAAGTCACCAGG + Intronic
1173370376 20:42429573-42429595 AATCTCCTGTGCCAGGGCACAGG + Intronic
1175905801 20:62378746-62378768 CCTCTCAGGTCACAGTTCACAGG + Intergenic
1176387606 21:6146605-6146627 AATCACATGAGCCAGTTCCCTGG - Intergenic
1177422840 21:20883824-20883846 AAAGTCATGTGACAATACACTGG - Intergenic
1177489740 21:21806941-21806963 GACTTCATGTGACAGTTAACAGG + Intergenic
1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG + Intergenic
1182727103 22:32456618-32456640 AATCTCAAGTAAAATTTCACAGG + Intronic
949757788 3:7433153-7433175 AGTCTCATCTTCCAGTTCACTGG + Intronic
950270132 3:11607433-11607455 AATGGGAGGTGACAGTTCACGGG + Intronic
951103773 3:18719551-18719573 AACCTCATGTCACAGTCCAATGG - Intergenic
953167178 3:40475940-40475962 AGTCTCATGTGACAGATAACAGG - Intergenic
957836719 3:85603460-85603482 AAACTTATGTGTCAGCTCACAGG + Intronic
958414449 3:93857318-93857340 GAGCTCATGTGACAGGTGACAGG - Intergenic
958578117 3:95978688-95978710 ATTCTCAAGTAACAGTTGACTGG + Intergenic
959931697 3:111991506-111991528 AATCTTATGGGGCAGTTCACAGG - Exonic
961461716 3:127054325-127054347 AATCACATGTGTCACTACACAGG + Intergenic
964406455 3:156353644-156353666 AAGCTCATGTGACTGTTGCCAGG + Intronic
966994502 3:185266635-185266657 AATCTCATGTGATAGTCCCTGGG - Intronic
968928733 4:3564406-3564428 AATGTCATGTGACTGTGCAGTGG - Intergenic
968928788 4:3564874-3564896 AATGTCATGTGACTGTGCAGTGG - Intergenic
969035963 4:4254184-4254206 AATCTTATGAAACAGTTCAGAGG - Intergenic
969600915 4:8175901-8175923 GGTCTCATCTGAAAGTTCACTGG + Intergenic
971215887 4:24661867-24661889 AATCTAAACTGACATTTCACTGG + Intergenic
972796551 4:42426684-42426706 AAGCTCATGGGACAGATCACTGG - Intronic
975230878 4:71931679-71931701 TAACTCATGTGACACTTCACTGG + Intergenic
976771671 4:88659801-88659823 AATTTCATGTTAAATTTCACAGG - Intronic
977027864 4:91843181-91843203 CACCTCATGTGACAGTTTTCAGG + Intergenic
977057150 4:92206726-92206748 AATTTTATGTGAAATTTCACTGG + Intergenic
977373813 4:96173794-96173816 AATCTCATGTCAGAGGGCACTGG - Intergenic
978868826 4:113549586-113549608 TATGTCAGATGACAGTTCACAGG - Intronic
978926385 4:114250820-114250842 AACCTCATGTGACTGTACACAGG + Intergenic
979194515 4:117904376-117904398 AATGGCATGTGGCAGTACACAGG + Intergenic
982501272 4:156159418-156159440 ATGATGATGTGACAGTTCACAGG + Intergenic
983777285 4:171623575-171623597 ACTGTCATGTGGCAGTTCAAAGG - Intergenic
984059850 4:174978074-174978096 AACCTCATGTGACACCTTACCGG + Exonic
984399036 4:179238103-179238125 AATCCCATGGCACAGTTCTCAGG + Intergenic
987538234 5:19216508-19216530 ATTCTCAAGTGACTTTTCACAGG + Intergenic
989010047 5:36860359-36860381 TATCTCATTTTACAGTCCACGGG + Intergenic
990999892 5:61772154-61772176 ACTCTCATGAGAGAGTTCTCAGG + Intergenic
997573716 5:134956211-134956233 AATATTATGTGACAGTTGAAGGG + Intronic
1001133163 5:169080970-169080992 TATCTCATGTGACAGCTCAGGGG - Intronic
1001291445 5:170465578-170465600 AATCTCAAGGGACAGTCCACTGG + Intronic
1004201083 6:13548769-13548791 AATTTTATGTTACAGTTCAAAGG + Intergenic
1007827236 6:44609836-44609858 AGTCTCATCTGACAGTTCCATGG + Intergenic
1008260525 6:49360630-49360652 GATATCATGTTATAGTTCACTGG - Intergenic
1008724140 6:54395370-54395392 AATTTCTTGTGACAGTGCACTGG + Intergenic
1010051163 6:71505758-71505780 CTTCCCATGTGACAGCTCACTGG + Intergenic
1011991059 6:93518297-93518319 AATATCATGTGTCAATTCATAGG - Intergenic
1016157807 6:140834612-140834634 ATTCTCATGTGTCAATTCAATGG - Intergenic
1016974595 6:149794830-149794852 AAGGTCAAGTGACAGATCACGGG + Intronic
1016986305 6:149898201-149898223 ACTCACACGTGACAGTTGACAGG - Intergenic
1023351588 7:39325601-39325623 AATCTGAACTGACAGATCACTGG + Intronic
1024392326 7:48829420-48829442 AAGCTCATGCCACAGTGCACGGG - Intergenic
1027644863 7:80785294-80785316 AAACTTATGTGACAGTTCATTGG - Intronic
1028165087 7:87529573-87529595 AATCTCATGTGTCACTTCAAAGG + Intronic
1028905580 7:96150995-96151017 AAACTGATATGACAGTTCAAAGG + Intronic
1030287704 7:107843428-107843450 ATTTTCATGTGACAGTTGATTGG - Intergenic
1034033449 7:147793653-147793675 AATTTCATGTGAAAATTCAAGGG - Intronic
1034273684 7:149815032-149815054 TATCTCAAGGGACAGTTCCCAGG + Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1038315677 8:26482548-26482570 CATCTCAGGTCACAGTTGACGGG + Intronic
1038851552 8:31282765-31282787 ATTCTCATCTGAGAATTCACAGG - Intergenic
1040872566 8:52115990-52116012 AATGTCATGTGAAAGTTGAAGGG - Intronic
1043582323 8:81728212-81728234 AATCTCATGTGATTGTACTCCGG + Intronic
1044288588 8:90440194-90440216 ACTGTCAACTGACAGTTCACTGG - Intergenic
1044408821 8:91862186-91862208 AATCTCTTTTAAAAGTTCACTGG + Intergenic
1045645616 8:104294270-104294292 TATCTCATGTGTTAATTCACAGG + Intergenic
1045920351 8:107521874-107521896 AATGCCATTTGAAAGTTCACTGG + Intergenic
1051358962 9:16265125-16265147 AATGTCAAGTGACATTTCCCTGG - Intronic
1059641693 9:116223204-116223226 AACCTCGTGTGACACTTCAGAGG + Intronic
1187270874 X:17778195-17778217 GATCTCATCTGAAAGTTCAGTGG - Intergenic
1193965897 X:87986073-87986095 AATCCCATGCCACAGGTCACTGG + Intergenic
1194479586 X:94404333-94404355 TATCTCATATAACAGTTCAAAGG + Intergenic
1199581362 X:149363641-149363663 AGTCTCCTGTGAAACTTCACAGG - Intergenic
1202089041 Y:21170080-21170102 AGGCTCATGTGCCAGTTTACTGG + Intergenic