ID: 1156228333

View in Genome Browser
Species Human (GRCh38)
Location 18:35130557-35130579
Sequence CAGAATTATTAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156228328_1156228333 5 Left 1156228328 18:35130529-35130551 CCAGATGGATAAAGCATACACAA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG 0: 1
1: 0
2: 1
3: 26
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156228333 Original CRISPR CAGAATTATTAGAAGGAGAG AGG Intronic
903745043 1:25581263-25581285 CTGAATTCTGAGAAGCAGAGAGG + Intergenic
904713982 1:32452916-32452938 CATATTTATTAGAAGCAAAGAGG + Intergenic
905832996 1:41089389-41089411 CAGGAATATAAGAAGAAGAGAGG - Intronic
906341025 1:44980932-44980954 CAGCGTTATGAGAATGAGAGAGG - Intronic
907695904 1:56728748-56728770 CAGGATTTTTTGAAAGAGAGTGG - Intronic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
913372781 1:118118995-118119017 AGGAATGCTTAGAAGGAGAGAGG - Intronic
913529229 1:119721693-119721715 CAGCATTAATAGAGGCAGAGGGG - Intronic
915504277 1:156343312-156343334 CAGAATAATGGGAAGAAGAGCGG + Intronic
915576468 1:156781920-156781942 CAGAATTATAGGAAGAAGAATGG + Intronic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
918640114 1:186829532-186829554 CAGAATTATGCGAAAGAAAGAGG + Intronic
919327705 1:196130057-196130079 GAGAAATATTAAATGGAGAGGGG + Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919716094 1:200778273-200778295 CAGAATTATTACTAAGAGAGTGG + Intronic
920492152 1:206424783-206424805 CAGAAACATTATAAGGAGAGAGG + Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921316073 1:213892449-213892471 CAGAATTTTTAAAAAGAAAGAGG + Intergenic
924018421 1:239753709-239753731 CAGAAGTCTTAGCATGAGAGTGG + Intronic
1063313472 10:4978986-4979008 AAGCATTATGAGAAGGACAGTGG + Exonic
1063314484 10:4988730-4988752 AAGCATTATGAGAAGGACAGTGG - Exonic
1063399080 10:5723756-5723778 CAGAATTACTTGGAGGAGAAAGG + Exonic
1063910738 10:10827306-10827328 CAGAGTTAATAAAATGAGAGAGG - Intergenic
1068307665 10:55234801-55234823 CCTAATTATTACAATGAGAGTGG + Intronic
1068872008 10:61955450-61955472 TAGCATTCTTAGAAGGAGAGGGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070790121 10:79184151-79184173 CAGAATGTTTAGAAGAAAAGGGG + Intronic
1071945101 10:90635098-90635120 CACAATTACTAGAACAAGAGAGG + Intergenic
1071970504 10:90901449-90901471 TAGAATTTGTGGAAGGAGAGAGG + Intronic
1072522316 10:96239301-96239323 CAGAATAATTAGTATTAGAGGGG + Intronic
1072525594 10:96268721-96268743 AGGAATTACTAGGAGGAGAGGGG - Intronic
1075150276 10:119923120-119923142 AAGAATTTCTAGAAGGAGACTGG + Intronic
1075513916 10:123094445-123094467 GAGAAAGATAAGAAGGAGAGAGG - Intergenic
1076230401 10:128815906-128815928 TATAAATATTAGAAGGATAGAGG + Intergenic
1076601700 10:131660916-131660938 GAGAACTTTCAGAAGGAGAGTGG + Intergenic
1077517784 11:3012217-3012239 CAGAATTCCGAGAAGGAGTGCGG - Exonic
1078728735 11:13956707-13956729 CAGAAATACAAGAGGGAGAGAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079173403 11:18117300-18117322 CAGAAGTATTAGAAAGCAAGTGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1080764686 11:35284659-35284681 TGGAATGGTTAGAAGGAGAGAGG + Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1080849049 11:36051970-36051992 TAGAATTCTTAGAAACAGAGTGG + Intronic
1081191578 11:40109624-40109646 CAAAGTTGTTTGAAGGAGAGGGG - Intergenic
1082751121 11:57018871-57018893 GGGAATTATTAGAATGAGACTGG - Intergenic
1085401417 11:76238082-76238104 CAGAATTGTTTGAATGAGACAGG - Intergenic
1086121297 11:83306883-83306905 TAGAATTATCAGAGGAAGAGAGG + Intergenic
1086955121 11:92927557-92927579 CAGAATTATTAGAAGTTAGGAGG + Intergenic
1088422177 11:109660386-109660408 CAGAATGATAGGCAGGAGAGGGG + Intergenic
1088435441 11:109807158-109807180 CATAAATATTAGAAAGAAAGAGG + Intergenic
1089582819 11:119492134-119492156 CAGAATCAATTGATGGAGAGAGG + Intergenic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1095129941 12:38528842-38528864 CAGAAACATTTGAATGAGAGAGG + Intergenic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1096209995 12:49757691-49757713 TGGAATTATCAGAAGGAAAGAGG + Intronic
1096899344 12:54858750-54858772 CAGAGTTGTTAGAAGGTGACTGG + Intergenic
1101129419 12:101673345-101673367 CAGCATTATGAGAAGGACAGTGG - Intronic
1101973764 12:109336964-109336986 CACACTTACTAGAAGGAGGGAGG + Intergenic
1102648389 12:114418652-114418674 CAGAGTGATAAGATGGAGAGAGG - Intergenic
1106635864 13:31527844-31527866 CACAATTTTTAGGAGGAGGGAGG - Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108557387 13:51607942-51607964 CAGAAGGATTAGAATCAGAGAGG + Intronic
1109179811 13:59200252-59200274 CAAAATTCCAAGAAGGAGAGAGG + Intergenic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110794805 13:79623804-79623826 AAGAATTTTTAAAAGCAGAGAGG - Intergenic
1111512115 13:89279722-89279744 CAGAAATACAAGAAGGAGATTGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1114898566 14:27026341-27026363 CAGCATTATATCAAGGAGAGAGG - Intergenic
1114946720 14:27690879-27690901 CAAGACTTTTAGAAGGAGAGGGG + Intergenic
1115097239 14:29651609-29651631 AATAATAATGAGAAGGAGAGAGG - Intronic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115552605 14:34518071-34518093 CAACATTAATAGAAGGAAAGAGG - Intronic
1116473875 14:45317636-45317658 CAGAATTTTTAGAGTGAGTGGGG + Intergenic
1116728182 14:48589087-48589109 GAAAATTATTTGAAGGAGAACGG + Intergenic
1116766547 14:49078803-49078825 AAGACTTATTAGAAGCAAAGAGG + Intergenic
1116935399 14:50734390-50734412 CAGAATTATAAGAAGAAATGGGG - Intronic
1118142781 14:63102941-63102963 TAGAGTCATTAGAATGAGAGGGG - Intergenic
1118209778 14:63754538-63754560 CAGAACTATCACAAGCAGAGGGG + Intergenic
1118860194 14:69656991-69657013 CACAATTATTAGAGGGAAATGGG + Intronic
1119905201 14:78295661-78295683 CAGAATTTTGGGAAGGAGTGGGG - Intronic
1120383027 14:83807325-83807347 CAGAATTATGAGAGAGTGAGTGG + Intergenic
1120860127 14:89247494-89247516 CAGAATTATGATAAGGGGACAGG + Intronic
1123585648 15:21758841-21758863 CAGTAGTGTTAGAAAGAGAGTGG - Intergenic
1123622290 15:22201429-22201451 CAGTAGTGTTAGAAAGAGAGTGG - Intergenic
1124369856 15:29098474-29098496 CAGAATTCTAAGAAGGACAGTGG - Exonic
1125519326 15:40339407-40339429 CAGAATAGTTAGTAGGAGAGGGG + Intronic
1126849838 15:52790220-52790242 CAGAATTTTAAGAAAGAGAGGGG - Intronic
1131075825 15:89494283-89494305 CAGACTTTTTGGAAGCAGAGAGG - Intronic
1131955903 15:97736104-97736126 AAGAACTATTAGAAAGAGATTGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133175173 16:4009080-4009102 TAGTATTTTTACAAGGAGAGAGG - Intronic
1134105872 16:11485707-11485729 AAGAATAGATAGAAGGAGAGGGG - Intronic
1135316650 16:21452139-21452161 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135369573 16:21884384-21884406 CAGAATTAATAAAAGCACAGAGG + Intergenic
1135442241 16:22486743-22486765 CAGAATTAATAAAAGCACAGAGG - Intronic
1135565284 16:23507026-23507048 GGAGATTATTAGAAGGAGAGGGG - Intronic
1135608523 16:23844496-23844518 AAGAACTTTTAGAAGGAGAATGG - Intronic
1136296339 16:29305674-29305696 CAGAAAGATTAAAAGGGGAGGGG - Intergenic
1136313317 16:29430839-29430861 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136326760 16:29532605-29532627 CAGAATTAATAAAAGCACAGAGG + Intergenic
1136441451 16:30272589-30272611 CAGAATTAATAAAAGCACAGAGG + Intergenic
1138410561 16:56836361-56836383 CAGACTTACTAGAAGCACAGAGG - Intronic
1138685485 16:58721704-58721726 AAGAATTATTAGAAATAGTGTGG + Intronic
1139234923 16:65327735-65327757 CAGAATTATTTCTAGGAGATGGG - Intergenic
1139264017 16:65622723-65622745 CAGAATTCTGAATAGGAGAGAGG + Intergenic
1139293228 16:65876652-65876674 CAGAATAACTGGGAGGAGAGTGG + Intergenic
1139888244 16:70226330-70226352 CAGAATTAATAAAAGCACAGAGG + Intergenic
1142057932 16:88011818-88011840 CAGAAAGATTAAAAGGGGAGGGG - Intronic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1148622477 17:49044802-49044824 CAGAATTATTAGGAGGGCAGAGG - Intronic
1148955115 17:51347308-51347330 AAAAATGATGAGAAGGAGAGAGG - Intergenic
1150092635 17:62342123-62342145 CAGAATTCTCACAAGGATAGTGG + Intergenic
1151530277 17:74699831-74699853 CAGAATTTTGAGAAAGAGAGGGG - Intronic
1153316923 18:3731914-3731936 AAGCACTATTAGAGGGAGAGTGG - Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1155675944 18:28429021-28429043 CAGAAATATTAAAAGCAGAATGG - Intergenic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156276485 18:35588295-35588317 AAAAATTATTAGAATGACAGTGG - Intronic
1156370357 18:36467243-36467265 CAGAATTACTAGGAGGTGACTGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1158507044 18:58056165-58056187 CAGAATTATTAAAAGGCTGGGGG - Intronic
1158788659 18:60747339-60747361 CAAAATCATGAGAAGTAGAGTGG - Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1160039190 18:75330238-75330260 AGGAATGATGAGAAGGAGAGAGG + Intergenic
1161639777 19:5414469-5414491 CAGAATTATAAGATGAAGAATGG - Intergenic
1161656910 19:5521956-5521978 CACAATTTTTAAAAGGGGAGAGG + Intergenic
1163163048 19:15476818-15476840 CAGATTTATGAGCAGGACAGAGG + Intronic
1166017306 19:39992174-39992196 CAGAATTATGACAAAGAGACAGG - Intronic
1166190798 19:41175322-41175344 CAGAATTCTTAGCCGGAGAGTGG - Intergenic
1166618018 19:44268765-44268787 GAGAAAGAATAGAAGGAGAGGGG - Intronic
1167241659 19:48347300-48347322 CTGAATTAGTGGAAGGAGAGAGG + Intronic
927140622 2:20128293-20128315 CAGAATTATTAGAATAGAAGTGG + Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
929864358 2:45705538-45705560 CAGGCTTATTGGAAGGAGGGAGG + Intronic
931617562 2:64175796-64175818 CAGCATTGTCTGAAGGAGAGGGG - Intergenic
931676154 2:64698241-64698263 TAGAAGGATTAGAAGGAGAGGGG + Intronic
931840358 2:66142006-66142028 CAGAATTAAAAGAACTAGAGAGG - Intergenic
933051465 2:77607998-77608020 CATAATTATTAGAAAGAAATAGG + Intergenic
933120026 2:78524656-78524678 CAGAAATAATTGAAGGATAGAGG - Intergenic
935257955 2:101329147-101329169 AGGAGATATTAGAAGGAGAGAGG + Intergenic
935398190 2:102632603-102632625 CAGAATTATTAGAGAGGAAGAGG - Intronic
938822876 2:134976623-134976645 CAAAATTATTAAAAGAGGAGGGG - Intronic
939568265 2:143810420-143810442 CACAATTTTTTGAAGGAGTGGGG + Intergenic
939654155 2:144801968-144801990 CAGAATTGTCAGAAGGACAGAGG + Intergenic
939804721 2:146760436-146760458 AAGAATTATTAGTAGAAGAAAGG - Intergenic
940354144 2:152719573-152719595 CAAAATTATTAGAGGACGAGTGG - Intronic
941893106 2:170602662-170602684 CAGAATAATTTAGAGGAGAGAGG - Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942743370 2:179204623-179204645 CAAAATTAATATAAGTAGAGAGG - Intronic
943764659 2:191647889-191647911 CTGTATTATTAGAAGAAGATGGG - Intergenic
944529233 2:200651121-200651143 GAGAATTATTGGAAGAAGAAAGG + Exonic
944537672 2:200727119-200727141 TGGAATTATTGGAAGGAAAGAGG - Intergenic
944542174 2:200764749-200764771 AAGAATTATTGGAAGAAGAAAGG + Intergenic
944748113 2:202678647-202678669 CAGAATTGTTTGAAGCCGAGAGG - Intronic
947011146 2:225568380-225568402 CAAAATAAATAAAAGGAGAGTGG - Intronic
1171074683 20:22110580-22110602 AAGAAGATTTAGAAGGAGAGTGG - Intergenic
1172226596 20:33309559-33309581 CAGAATTCTTAGAAGGGTCGGGG - Intronic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1173473615 20:43342384-43342406 CATAATTACAAGATGGAGAGAGG + Intergenic
1173891753 20:46517808-46517830 CAGAAATACTAGGAAGAGAGAGG - Intergenic
1175917952 20:62436082-62436104 CTGAATTTTTAGAAAAAGAGTGG - Intergenic
1177345276 21:19859745-19859767 CAGACTTCTTTGAATGAGAGTGG - Intergenic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1181149511 22:20873128-20873150 CAGAATTAAAACAAAGAGAGAGG - Intronic
1181566325 22:23740911-23740933 CACAAAAATTAGAAAGAGAGAGG + Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1183602519 22:38848221-38848243 GAGAATGATTAGATGGACAGGGG - Intergenic
1184464113 22:44659012-44659034 CTGAACTACTGGAAGGAGAGGGG + Intergenic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185141916 22:49107327-49107349 CAGGATCATTAGAAGCAGAAAGG - Intergenic
1185269096 22:49920289-49920311 AAGAATCATGAGAAGAAGAGGGG - Intronic
949884566 3:8683020-8683042 CGCAATGATTAGAAGCAGAGTGG + Intronic
952063929 3:29543933-29543955 TAAAAGTATTAGAAGGAGATTGG + Intronic
952145596 3:30528546-30528568 AAGAATTCTGAGAAGGAGATAGG - Intergenic
953416796 3:42725963-42725985 CAAAATTATTTAAAGGAGAAAGG + Intronic
953550436 3:43898366-43898388 AGGAAGTATTAGTAGGAGAGTGG + Intergenic
954538482 3:51378738-51378760 CAGACTTTTCAGGAGGAGAGAGG - Intronic
954971016 3:54651816-54651838 CAGAACTATCAGGAGAAGAGGGG - Intronic
955138763 3:56248026-56248048 AAGAATTATTAGAGGAAGATAGG - Intronic
955460012 3:59171664-59171686 AAAAATTAATAAAAGGAGAGAGG + Intergenic
955651407 3:61198181-61198203 AAGAATTATTGGAAGGATACTGG + Intronic
955889533 3:63635213-63635235 AAAACTTATTAGAGGGAGAGAGG + Intergenic
956699890 3:71949509-71949531 CTGAAATATTAGATGGATAGTGG + Intergenic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957579318 3:82050374-82050396 GAGAATAATTAGAAGCAGAGGGG + Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962401114 3:135059510-135059532 GAGAATGATTACATGGAGAGTGG + Intronic
962653580 3:137519837-137519859 GAGAATAATGCGAAGGAGAGAGG + Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965182503 3:165422484-165422506 CAGAAAGATTAGAGGGACAGGGG + Intergenic
965374969 3:167911621-167911643 TAGAACTATTAAAAGGAGAAGGG - Intergenic
965587653 3:170333232-170333254 AAAAATTATCAGAAGGTGAGAGG + Intergenic
965895600 3:173571813-173571835 CAGTATTATTAATAGGAGAAAGG - Intronic
966223445 3:177572907-177572929 CAGAAATAGTAGAAAGAGAAAGG - Intergenic
967592094 3:191289740-191289762 GTGAACTATTAGAAGCAGAGAGG + Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
970557952 4:17254440-17254462 CAGAAGCATTAGAATAAGAGTGG + Intergenic
971579147 4:28311449-28311471 CAGAATTATTGCTAGGAGACAGG - Intergenic
972789243 4:42354847-42354869 AAGAATAATTGGAAGCAGAGGGG + Intergenic
972948794 4:44292461-44292483 GAGGATTACTAGAAGTAGAGAGG + Intronic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
973589836 4:52429835-52429857 TAGAATTTTTAAAAGGAGAGTGG + Intergenic
973834536 4:54796053-54796075 CAGAATTGCTAGAAGTAGGGGGG - Intergenic
974326411 4:60419833-60419855 GAATATTATTTGAAGGAGAGTGG - Intergenic
974902254 4:68015107-68015129 TATAATTATGAGAAGTAGAGGGG + Intergenic
975382125 4:73713078-73713100 AAGAATAGCTAGAAGGAGAGAGG + Intergenic
976344436 4:83984344-83984366 CTGAGATATTAGAAAGAGAGGGG + Intergenic
977145256 4:93431664-93431686 CAGAAATTTTAGATGGAGAGGGG + Intronic
977310298 4:95377982-95378004 AATAATTATTGGAAGGAGGGTGG - Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
978870430 4:113569454-113569476 CAGAATTATTAGAACAAAACTGG - Intronic
979051679 4:115942995-115943017 CATAATTATTATAGGGAGATAGG + Intergenic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
981238234 4:142443277-142443299 GAGAATGATTGGAAGCAGAGTGG + Intronic
982771500 4:159401169-159401191 CAGAGTTCTTCCAAGGAGAGGGG - Intergenic
983328807 4:166296743-166296765 CACAATTAGTAAAAGGAAAGAGG - Intergenic
986570934 5:9165393-9165415 CAGAATTAATAAAAAGAGAATGG - Intronic
986751903 5:10794907-10794929 CAGAATTCTTAGGAGGAGGAGGG + Intergenic
987948296 5:24643960-24643982 CAGAAGTATTGGGGGGAGAGAGG - Intronic
988335802 5:29907888-29907910 AATAATTTTTAAAAGGAGAGAGG - Intergenic
988479976 5:31621356-31621378 CAATATGGTTAGAAGGAGAGTGG + Intergenic
990012403 5:51015467-51015489 CAGATTTATTTGAAGAGGAGAGG - Intergenic
990144834 5:52747688-52747710 TAGAAGTAGTAGTAGGAGAGGGG - Intergenic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
993040124 5:82804904-82804926 CAGAATGAAAAAAAGGAGAGGGG + Intergenic
993058721 5:83013558-83013580 CAAAAGTATTTGAAGAAGAGGGG - Intergenic
993115754 5:83718492-83718514 AACAATTATTAGGAGTAGAGAGG - Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
994472352 5:100224064-100224086 CAGAGTGATTAAAGGGAGAGAGG - Intergenic
994741146 5:103620915-103620937 AAGAATATTAAGAAGGAGAGTGG - Intergenic
994952834 5:106487197-106487219 CAAAATTATAAGAAAGAGAAAGG - Intergenic
996030521 5:118699599-118699621 CAGAATTATTTCAAGTTGAGTGG - Intergenic
997189224 5:131914769-131914791 GAGCATTATTAGAAAGAGAAGGG + Intronic
997629717 5:135357540-135357562 CAGTATTATTTGAAGGAGTTAGG - Intronic
997687938 5:135801692-135801714 TTGTAATATTAGAAGGAGAGGGG + Intergenic
998604141 5:143616195-143616217 CAGAAATAGTACAAGGAGTGGGG - Intergenic
998892114 5:146757254-146757276 CAGAAGGTTTAGAAGTAGAGCGG + Intronic
1000910485 5:167015949-167015971 CACCATTAAAAGAAGGAGAGAGG + Intergenic
1003904836 6:10689608-10689630 CAGAACTAGTAGAAGGGGATAGG + Intronic
1004814831 6:19301626-19301648 CAGAATAATTGGAAGAAGATTGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007807369 6:44460384-44460406 CTGAATTCCTAGAAGGAGACAGG + Intergenic
1007998299 6:46332279-46332301 AAGAATTTTTAAAATGAGAGAGG - Intronic
1008703091 6:54125136-54125158 AAGAATTATTTAAAGGAAAGAGG - Intronic
1009049919 6:58263515-58263537 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009225441 6:61016624-61016646 CCCAATATTTAGAAGGAGAGTGG - Intergenic
1009225464 6:61016774-61016796 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009763294 6:68036574-68036596 AAGAATGTTTAGAAGAAGAGAGG + Intergenic
1009882212 6:69582975-69582997 AAGAATTACTAGAAGGATATTGG + Intergenic
1011208707 6:84930832-84930854 AAGAAGTCTTAGAAGCAGAGAGG - Intergenic
1011220286 6:85047921-85047943 CAGAATCATAAGAAGTAAAGTGG - Intergenic
1013880009 6:114886222-114886244 AAGAAATATTAGAAAGAGAAAGG - Intergenic
1014009871 6:116462885-116462907 CAGAATTGTTAGAATTAAAGGGG + Intronic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1016861961 6:148729982-148730004 AAGAACAATTAGTAGGAGAGTGG - Intergenic
1017635670 6:156440628-156440650 AGGAAATATTAGAAGGGGAGTGG - Intergenic
1017751105 6:157491204-157491226 CAGTCTTATTCGAAGGGGAGAGG + Intronic
1018304408 6:162439771-162439793 CAGCATTACAAAAAGGAGAGAGG - Intronic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1020218493 7:6215060-6215082 CAGAATTCTCAGAGGAAGAGAGG - Intronic
1020361516 7:7331579-7331601 CAGAATTAGAAGGAGGTGAGAGG + Intergenic
1020829206 7:13072516-13072538 TATCAATATTAGAAGGAGAGTGG - Intergenic
1021882184 7:25105801-25105823 CAGAATTTTAACAAGGAGACAGG + Intergenic
1021898315 7:25258254-25258276 CAGAATCTTTAGATTGAGAGGGG + Intergenic
1022581110 7:31555968-31555990 CTGAATTATTATGAGCAGAGAGG - Intronic
1023336607 7:39177215-39177237 CTGAATCATTAAAAGGAGGGTGG - Intronic
1023674195 7:42613473-42613495 CTGAATGGTTAGAAGCAGAGTGG - Intergenic
1023698324 7:42870003-42870025 CAGAATTATTACCAGGAAAGAGG + Intergenic
1024434566 7:49335288-49335310 CAAAAGTAATAGAAGTAGAGTGG + Intergenic
1024724066 7:52172075-52172097 CAGAAATATTACAAAGATAGTGG - Intergenic
1025724713 7:64045989-64046011 CACAATTTTTAAAAGGAGAAAGG - Intronic
1026618226 7:71926591-71926613 CAGAAGGATTAGAAAGAGATAGG - Intronic
1027624545 7:80530381-80530403 CAGAATTGATAGGAGGAGAAAGG + Intronic
1027966541 7:85017164-85017186 CAGATATATTAAAAGGAGAATGG - Intronic
1028003236 7:85528619-85528641 CAGAATTGTTATAATCAGAGAGG - Intergenic
1028271858 7:88801267-88801289 CAGAACTGCTAGAAGGTGAGTGG + Intronic
1028735350 7:94205269-94205291 CAGTATGATTAGAAGGTGAGAGG - Intergenic
1029230951 7:99068110-99068132 CAGAAATATAAGAAGAAGAGAGG - Intronic
1029910233 7:104137901-104137923 CTGCCTTATTGGAAGGAGAGAGG - Intronic
1030861674 7:114639440-114639462 CAGTTGTATTAGAAGGAGACTGG + Intronic
1030922154 7:115404489-115404511 CGGGATTACTAGAAGGGGAGGGG + Intergenic
1032512906 7:132486312-132486334 CAGAATTATTACAAGGAAAGGGG + Intronic
1032862627 7:135895069-135895091 AAGAATTATTCCAAGTAGAGAGG + Intergenic
1033964253 7:146954939-146954961 CAGCATCAATAGAAAGAGAGAGG + Intronic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1035009862 7:155705462-155705484 TAGTTTTATTTGAAGGAGAGAGG + Intronic
1037657206 8:20895162-20895184 CAGGAGGATTAAAAGGAGAGTGG - Intergenic
1038995353 8:32916850-32916872 CAGAATTAATAGAAAGTGAAGGG + Intergenic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041956904 8:63566213-63566235 CGGAAATAATAGAAGGAGAAAGG - Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042192012 8:66196683-66196705 CAGCTTTAGAAGAAGGAGAGTGG - Intergenic
1043008093 8:74845621-74845643 CAGAAATATTGGAAGGATGGTGG - Intronic
1043151121 8:76717297-76717319 CAGAATTTTGAGGAGGAGAGAGG - Intronic
1043376216 8:79652838-79652860 CGGAATTGTTACAGGGAGAGAGG - Intronic
1043606013 8:82000779-82000801 CAGAATTATTAGAATGATGAAGG - Intergenic
1044191863 8:89328435-89328457 AAGAGTTATTAGCAGGAAAGAGG + Intergenic
1044889191 8:96814319-96814341 CAAAATAATTAGAAGAAGAAAGG - Intronic
1045452222 8:102338802-102338824 CAGAATGATTACAAAGAGTGTGG - Intronic
1045567379 8:103334666-103334688 CAAAATTATTAGAGGGATTGAGG - Intergenic
1045628175 8:104082230-104082252 GAGAATTAAAGGAAGGAGAGAGG + Intronic
1046184949 8:110700814-110700836 TAGAATTCTTGGAAGGACAGAGG + Intergenic
1046222858 8:111238035-111238057 AACAATTACTAGAAGGAGACAGG + Intergenic
1046350319 8:113001246-113001268 AAGAATTTTAAGCAGGAGAGAGG - Intronic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046881521 8:119314113-119314135 CTGAACTAATAGAAGCAGAGAGG + Intergenic
1047059870 8:121213350-121213372 CAGAATGATTTGAAGGAAAAGGG + Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1050093168 9:2036255-2036277 CAAGATTATTAATAGGAGAGAGG + Intronic
1051293950 9:15575112-15575134 CAGATAAATTAGAAAGAGAGAGG + Intronic
1052865362 9:33461769-33461791 CAGAATTACAGGAAGCAGAGAGG + Exonic
1053552243 9:39095595-39095617 CAAGATTAATAGAATGAGAGGGG - Intronic
1053816370 9:41915754-41915776 CAAGATTAATAGAATGAGAGGGG - Intronic
1054106631 9:61059436-61059458 CAAGATTAATAGAATGAGAGGGG - Intergenic
1054614226 9:67271689-67271711 CAAGATTAATAGAATGAGAGGGG + Intergenic
1054735175 9:68743816-68743838 GAGAATCAATAGAAGGACAGGGG - Intronic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1055666162 9:78555210-78555232 AAGAGATATAAGAAGGAGAGAGG + Intergenic
1056256886 9:84808634-84808656 CAAAACTTTTAGAAGGAGACTGG + Intronic
1056431166 9:86529258-86529280 GATAATTTTTTGAAGGAGAGAGG + Intergenic
1058919084 9:109596251-109596273 TAAAATTATTAGAATGATAGAGG + Intergenic
1059609706 9:115879244-115879266 GAGAATTATTAAAAGGAAAAAGG + Intergenic
1060509312 9:124220667-124220689 TAAAATTCTGAGAAGGAGAGCGG - Intergenic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1188934255 X:36153897-36153919 CAGAATAATTTTAAGGAGAAGGG - Intergenic
1189209651 X:39274128-39274150 CACAATTAAAAGAAGTAGAGAGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193443541 X:81571395-81571417 CAAAATTAGTAGAAGGAAAGGGG + Intergenic
1193899444 X:87159282-87159304 CAAAACTATTAAAAGCAGAGTGG - Intergenic
1197770795 X:130087946-130087968 CAGTTTGATTAGAGGGAGAGAGG + Intronic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1198998973 X:142609826-142609848 CAGATTTATTAGAGTGAGACTGG + Intergenic
1199570659 X:149264025-149264047 CAGAATGATTTGAAGAATAGGGG + Intergenic
1200014794 X:153151690-153151712 AAGACCTTTTAGAAGGAGAGAGG + Intergenic