ID: 1156229153

View in Genome Browser
Species Human (GRCh38)
Location 18:35137232-35137254
Sequence CTGTGATGTCATGCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 2, 3: 164, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156229153_1156229158 6 Left 1156229153 18:35137232-35137254 CCTGCAGATGCATGACATCACAG 0: 1
1: 0
2: 2
3: 164
4: 418
Right 1156229158 18:35137261-35137283 CCTGTGACTGAGATTTAAGCTGG 0: 1
1: 0
2: 2
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156229153 Original CRISPR CTGTGATGTCATGCATCTGC AGG (reversed) Intronic
900350759 1:2233446-2233468 CTGGGAATTCAGGCATCTGCAGG - Intronic
901483764 1:9543601-9543623 TAGTGATGTCCTTCATCTGCTGG + Intronic
901701222 1:11045607-11045629 CTCTGAGGTCATGGATCTCCTGG - Intronic
902255634 1:15187070-15187092 CTCTGATGTCCTGCAGCTGCTGG - Intronic
902969549 1:20037395-20037417 CTGTGATGTGATCCATCTTCAGG + Intronic
903781478 1:25822909-25822931 CTGTGAAGTCATGGCTCTGCAGG + Intronic
906594526 1:47063038-47063060 CTATGATGTGATCCATCTTCAGG - Intergenic
906914720 1:49995844-49995866 CTGTGATGTGATCCATTTTCAGG - Intronic
908136636 1:61139968-61139990 CTACCAGGTCATGCATCTGCAGG - Intronic
908205603 1:61845077-61845099 CTGTGGTTTCAGGTATCTGCTGG + Intronic
908420865 1:63957261-63957283 TTGTAATTTCATGCAACTGCAGG + Intronic
908883470 1:68759573-68759595 CTGTGATGTGATCTATCTTCAGG - Intergenic
909288704 1:73854696-73854718 CTGTCTTGTCCTGTATCTGCAGG - Intergenic
909405788 1:75287787-75287809 CTGTGATGTGATCCATCTTTAGG + Intronic
909479346 1:76114783-76114805 CTGTGATCACAGGCATGTGCTGG - Intronic
910323541 1:85977022-85977044 CTGTGATGTAATCCATTTTCAGG - Intronic
910415884 1:86997676-86997698 CTGTGGTTTCAGGCATCTACTGG - Intronic
910667768 1:89742783-89742805 CTATGTTGGCATGAATCTGCTGG + Intronic
910708455 1:90154671-90154693 CTGTGATGTGATTCATCTTCAGG + Intergenic
911265816 1:95742452-95742474 CTGTGATGTGATCCATCTTCAGG + Intergenic
911317932 1:96376943-96376965 CTGTGATGTGTACCATCTGCAGG - Intergenic
911562102 1:99418389-99418411 CCGTGATGTGATCCATCTTCAGG - Intergenic
911743344 1:101411410-101411432 CTGTGATGTGATCCTTCTTCAGG - Intergenic
911905633 1:103565110-103565132 CTGTGGTTTCAGGCACCTGCTGG - Intronic
912022030 1:105117484-105117506 CTGTGATGTGATCCATCTTCAGG - Intergenic
912181030 1:107219734-107219756 CTGTGATGTGATCTATCTTCAGG + Intronic
912612383 1:111061718-111061740 CTGTGATGTGATCCATCTTCAGG + Intergenic
913036465 1:114970750-114970772 CTATGATGTGATTCATCTTCAGG + Intronic
913236258 1:116785716-116785738 CTGTGATGTGATCCATCTTCAGG - Intergenic
913383476 1:118233986-118234008 CTGTGATGTGATCCATCTTTGGG - Intergenic
916620132 1:166488131-166488153 GTGTGATCTGATGCATCTCCTGG - Intergenic
916968561 1:169981628-169981650 CTGTAGTTTCAGGCATCTGCTGG + Intronic
917492795 1:175512683-175512705 CTGTGTTTTCATGCATGTGATGG - Intronic
917913581 1:179677692-179677714 TTGTGATGTGATCCATCTTCAGG + Intronic
918171834 1:182004694-182004716 CTGTGATGTGATCCATCTTCAGG - Intergenic
918860485 1:189819877-189819899 CTGAGATGTCATGGATATCCAGG - Intergenic
920989870 1:210926366-210926388 CTGTGATGTGATCCATCTTCAGG - Intronic
921788505 1:219262674-219262696 CTGTGATGTGATTCATCTTCAGG + Intergenic
921842967 1:219847654-219847676 CTGTGATGTTATCCATCTTCAGG - Intronic
923071843 1:230572856-230572878 CTGTGATGTTATGCAAGAGCTGG + Intergenic
923174112 1:231446495-231446517 CTGTGATGTGATCCGTCTTCAGG - Intergenic
923290587 1:232541215-232541237 ATGTGATGTGATACATGTGCAGG - Intronic
923961050 1:239084515-239084537 CTGTGATGTGAACCATCTCCAGG + Intergenic
1063445353 10:6110745-6110767 CTGTGCTGTGTTGCATCTGCTGG + Intronic
1063536884 10:6892075-6892097 CTGTGATGTGAACCGTCTGCAGG - Intergenic
1064557151 10:16559065-16559087 CTGTGATGTGATCTATCTTCAGG + Intergenic
1064686253 10:17865440-17865462 CTGTGGTGTCATCCAGCAGCAGG + Intronic
1065462412 10:25982594-25982616 CTGTAATGTGATCCATCTTCAGG - Intronic
1067092150 10:43273023-43273045 TTGCAATTTCATGCATCTGCTGG + Intergenic
1068173106 10:53421890-53421912 CTGTGTTGTGATCCATCTTCAGG + Intergenic
1068556476 10:58464666-58464688 CTGTGATGTGATCCATCTTCAGG + Intergenic
1068682473 10:59834948-59834970 CTGTGCTGTCTTCTATCTGCAGG + Intronic
1068808592 10:61228543-61228565 CTGTGATGTGATCCATCTTCAGG - Intergenic
1069146293 10:64896068-64896090 CTGTGATGTGATCCATCTTCAGG + Intergenic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1071015812 10:80996463-80996485 CTGTGATGTGATCCATCTTCAGG + Intergenic
1071097375 10:81993483-81993505 TTGTGGTGGCATGCATCTGTAGG - Intronic
1071235996 10:83649306-83649328 CTGTGATTTCAGGCATCAACTGG + Intergenic
1071761347 10:88611065-88611087 CTGTGATGTGATCCATCTTCAGG - Intergenic
1072871713 10:99126797-99126819 CTATGATGTGATCCATCTTCAGG - Intronic
1073253548 10:102136706-102136728 CTGTGGTTTCAGGCATCTACTGG + Intronic
1074037318 10:109753512-109753534 CTCTGATGTGATCCATCTTCAGG + Intergenic
1075269630 10:121037360-121037382 CTGTGATTTCAGGCATCCACCGG - Intergenic
1076604385 10:131679940-131679962 CTGGCATGTGCTGCATCTGCAGG + Intergenic
1076997892 11:307873-307895 CAGTGAGGTCCTGCAGCTGCTGG + Intronic
1077827949 11:5831143-5831165 CTGTGATGTGATCCATCTTCAGG + Intronic
1078195438 11:9133268-9133290 CTCTGATTTAATGCATGTGCTGG - Intronic
1078350226 11:10586796-10586818 CTGTGATGACAGTCATATGCAGG - Intronic
1079273652 11:19013228-19013250 CTGTGATGTGAACCATCTGTGGG + Intergenic
1079415830 11:20235607-20235629 CTGTGAAGTGATCCATCTTCAGG - Intergenic
1079464106 11:20712816-20712838 CTGTGATATGATCCATCTTCAGG + Intronic
1079806021 11:24932095-24932117 CTGTGATGTGATCCATCTTCAGG + Intronic
1079935372 11:26609361-26609383 ATGTGATATCCTGCACCTGCAGG - Intronic
1079935381 11:26609431-26609453 ATGTGATATCCTGCACCTGCAGG - Intronic
1079935387 11:26609501-26609523 ATGTGATATCCTGCACCTGCAGG - Intronic
1079952105 11:26818856-26818878 CTGTGATGTGAACCATCTGTGGG + Intergenic
1080567662 11:33526474-33526496 CTGTGATGTGATCCGTCTTCAGG - Intergenic
1080585826 11:33682166-33682188 CTGTGATGTGAACCATCTTCAGG + Intergenic
1081311467 11:41579145-41579167 CTGTCATTTCAGGCATCTACTGG + Intergenic
1082113071 11:48298470-48298492 CTGTGATGTGATCCATCTTCAGG + Intergenic
1082903956 11:58285733-58285755 CTGTGATGTGAACCACCTGCGGG - Intergenic
1084094596 11:66902719-66902741 CTGTGATGTGATACAGCTGGAGG - Intronic
1084976570 11:72803052-72803074 GTGTGATGGCATGCCCCTGCAGG + Intergenic
1085063978 11:73474972-73474994 CTCACATGTCATGCAACTGCTGG - Intronic
1085917210 11:80903790-80903812 CTGTGATGTGAACCATCTGTGGG - Intergenic
1086458554 11:86983219-86983241 CTGTGATGTGATACTTCTGAAGG - Intergenic
1086864257 11:91960408-91960430 CTGTGATGTTATCCATCTTCAGG - Intergenic
1086869295 11:92017783-92017805 CTGTGATGTGATCCATCTTCAGG + Intergenic
1087304209 11:96470036-96470058 TTCTGCTGTCATGCATCTTCTGG + Intronic
1087602129 11:100329626-100329648 CTGTGATGTGAGTCATCTTCAGG - Intronic
1087630869 11:100648603-100648625 CTGTGATGTGATCCAACTTCAGG - Intergenic
1087804384 11:102539659-102539681 CTGTGATGTGATCCATCTTCAGG - Intergenic
1088413676 11:109566380-109566402 CTGTGATGTTATCCATCTTCAGG + Intergenic
1090154110 11:124419525-124419547 CTGTGATTTCAGGTATCTACTGG - Intergenic
1090856865 11:130617462-130617484 CTGTGGTTTCAGGCATCTGCTGG + Intergenic
1091380863 12:57724-57746 CTGTGATGTGATTCATCTTCAGG - Intergenic
1092602611 12:10083015-10083037 CTGTGATATGATCCATCTTCTGG - Intronic
1092677794 12:10942060-10942082 CTGTGATGTAAACCATCTGTTGG + Intronic
1093291028 12:17322335-17322357 CTGTGATGTTATTCGTCTTCAGG + Intergenic
1093469121 12:19482247-19482269 CTGTGATGTGATTCATCTTCAGG + Intronic
1093604441 12:21073389-21073411 CTGTGATGTGATCCATCTTCAGG + Intronic
1093609731 12:21138837-21138859 CTGTGGTTTCATGTGTCTGCAGG + Intronic
1093948440 12:25136212-25136234 GTGTGATGTAATTCATCTTCAGG - Intronic
1093963814 12:25303827-25303849 ATGTGATGTGATTCATCTTCAGG - Intergenic
1095178648 12:39122388-39122410 CTGTGATGTGATCCATCTTTAGG + Intergenic
1096488938 12:52003195-52003217 AGGTGATGTCATGCAACTGGGGG + Intergenic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097302464 12:58033725-58033747 CTGTGATGTGATCCATCTTCAGG + Intergenic
1097537306 12:60888862-60888884 CTGTGATGTAATTCATCTTCAGG + Intergenic
1099392374 12:82097474-82097496 CTGTGATGTGACCCATCTTCAGG + Intergenic
1100203537 12:92325090-92325112 CTGTGATGTGAACCATCTGTGGG + Intergenic
1100706379 12:97204157-97204179 CTGTGATGTGAATCATCTGTGGG - Intergenic
1101446512 12:104740703-104740725 CTCTGATGTCATGCAATTGAGGG + Intronic
1101544371 12:105697788-105697810 CTGTGATGTGATCCATCTTCAGG + Intergenic
1102808939 12:115807140-115807162 GTGTGGTGGCATGCATCTGTGGG - Intergenic
1103613525 12:122138196-122138218 CTGAGATGTGCTTCATCTGCCGG - Exonic
1104082881 12:125446198-125446220 CTGTGAGGCCAAGCATCAGCTGG - Intronic
1104504451 12:129318483-129318505 CTGTGATGTGATCCATCTATGGG + Intronic
1104881549 12:132074903-132074925 CTGAAATGTGCTGCATCTGCGGG + Intronic
1106314662 13:28582782-28582804 CTATGATGTCATACATCCCCTGG - Intergenic
1108634822 13:52322933-52322955 GTGTGATAACATGCATCTACTGG - Intergenic
1108652982 13:52500255-52500277 GTGTGATAACATGCATCTACTGG + Intergenic
1109788696 13:67218242-67218264 CTGTGATGGCATTCATCTGGAGG + Intronic
1110348894 13:74483194-74483216 CTGTGATTTCAAGCATCTACTGG + Intergenic
1110375914 13:74793939-74793961 CTGTGGTGTGATCCATCTTCAGG + Intergenic
1110504793 13:76272573-76272595 TTGTGATGTGATCCATCTTCAGG - Intergenic
1111350426 13:87021519-87021541 CTTTGTTTTCATGCATCTTCAGG - Intergenic
1112672067 13:101652278-101652300 GTGTGGTGGCATGCACCTGCAGG - Intronic
1113534904 13:111058419-111058441 CTGTGATGTGCTCCATCTTCAGG + Intergenic
1113576054 13:111396101-111396123 TTCTGAGGCCATGCATCTGCTGG + Intergenic
1113597759 13:111546657-111546679 ATGTGATTTCAGGCATCTGCTGG - Intergenic
1114756764 14:25268824-25268846 CTGTGATGTGATCAATCTTCAGG + Intergenic
1115350584 14:32390689-32390711 CTGTGATGTGAACCATCTGTGGG + Intronic
1115393154 14:32877011-32877033 TTGTGATGTGATCCATCTTCAGG + Intergenic
1116063961 14:39958771-39958793 CTGTGATGTGATCCGTCTTCAGG - Intergenic
1117112819 14:52475979-52476001 CTGTGGTGTCAACCATCTGTGGG - Intronic
1117182288 14:53202980-53203002 CTGTGATGTGATCCATCTTCAGG - Intergenic
1118140141 14:63071946-63071968 CTGTGATGTGAACCATCTTCAGG + Intronic
1118165655 14:63332924-63332946 CTGTGATGTGAACCATCTGTGGG - Intergenic
1119582626 14:75800808-75800830 CTGTGATGTGATCCATCTTCAGG + Intronic
1120450866 14:84665574-84665596 CTGTGATGTGATCTATCTTCAGG + Intergenic
1120571020 14:86116595-86116617 CTCTGATGCCATGCTTCTGCAGG - Intergenic
1120605378 14:86570046-86570068 CTGTGATGTGATCCTTCTTCAGG + Intergenic
1120736287 14:88057098-88057120 CTGTGATGTGAACCATCTTCAGG + Intergenic
1120777346 14:88452260-88452282 CTGAGATGTGATTCATCTTCAGG + Intronic
1121503412 14:94458350-94458372 CTGTGGTGTGAACCATCTGCAGG + Intergenic
1124667965 15:31609872-31609894 CTGTGATGTGAAGCATCTATGGG - Intronic
1126127653 15:45310393-45310415 GTGTGGTGGCATGCATCTGTGGG + Intergenic
1126418598 15:48446471-48446493 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1127014539 15:54668870-54668892 CTGTGATGTGATCCATCTTCAGG - Intergenic
1127122120 15:55780696-55780718 GAGTGATGTCTTTCATCTGCTGG - Intergenic
1128193124 15:65723606-65723628 CTGTGATTTCAGGCATCCACTGG - Intronic
1129492806 15:75945835-75945857 CTGTGATTTCAGGCATCCACTGG - Intronic
1130779639 15:87021948-87021970 CTGTGATGTGAAACATCTGTAGG - Intronic
1131326783 15:91455857-91455879 CTGTGATGTGAACCATCTGTGGG + Intergenic
1132412804 15:101597367-101597389 CTGTGATGTGATCCATCTTCAGG + Intergenic
1132876840 16:2143723-2143745 CTGTGATGTCACCCACGTGCTGG + Intronic
1132951135 16:2563070-2563092 CTGGCATTTCATGCATCCGCTGG + Intronic
1132963215 16:2637100-2637122 CTGGCATTTCATGCATCCGCTGG - Intergenic
1133387058 16:5378302-5378324 CAGAGATGTCCTGCCTCTGCTGG + Intergenic
1134875854 16:17697953-17697975 CCTTGATGTCATCCATGTGCAGG + Intergenic
1135332867 16:21575589-21575611 GTGTGGTGGCATGCATCTGTAGG + Intergenic
1135883171 16:26279264-26279286 CTGTGATGTGATCCATCTTCAGG + Intergenic
1137725008 16:50651056-50651078 CTGTGATCTGAGGCCTCTGCAGG - Intergenic
1139286588 16:65820509-65820531 CTGTGGTTTCAAGCATCTACTGG - Intergenic
1139975408 16:70806260-70806282 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1140530246 16:75659597-75659619 CTGTGGAGTCAAGCTTCTGCAGG + Intronic
1141951003 16:87339348-87339370 CTGTGGATTCATGCATCAGCTGG - Intronic
1143456694 17:7072431-7072453 CTGTGATCTCACGCTCCTGCTGG + Intergenic
1143573136 17:7773503-7773525 CTGAGGTGTCAGGCATCTACTGG - Intronic
1145167400 17:20625009-20625031 CTGTGATGTGATCCGTCTCCTGG - Intergenic
1146799446 17:35806893-35806915 CTGTGATTTCAATCAACTGCTGG - Intronic
1146816101 17:35943739-35943761 CTGTGACGTCATCCATCTCCTGG + Intergenic
1148400556 17:47356561-47356583 CTGTGATGTATTCCATCTTCAGG + Intronic
1149577228 17:57722921-57722943 CTGTGATGTCAGGGCTCAGCTGG + Intergenic
1150870022 17:68897033-68897055 CTGTGGTTTCAGGCATCTGCTGG + Intronic
1151896163 17:76982285-76982307 CTGGGAGATCCTGCATCTGCAGG + Intergenic
1155442219 18:25874311-25874333 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1156607056 18:38679424-38679446 CTGTGATGTGAGCCATCTTCAGG + Intergenic
1157294571 18:46433389-46433411 CTGTGACGTCCTGGAACTGCAGG - Exonic
1157507578 18:48239520-48239542 CTGTGGTGTGATTCATCTCCAGG - Intronic
1158097708 18:53793135-53793157 CTGTGATGTGATCCATCTTCAGG - Intergenic
1158252626 18:55506678-55506700 CTGAGGTTTCAGGCATCTGCTGG - Intronic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1159568949 18:70090246-70090268 CTGTGGTTTCAGGCATCTACTGG - Intronic
1159781736 18:72668024-72668046 CTGTGCTCTCATGGCTCTGCTGG - Intergenic
1159838506 18:73369775-73369797 CTGTGATGTGAGCCATCTTCAGG - Intergenic
1160308908 18:77769846-77769868 CTGTGATGTCATGGTCCTGGTGG + Intergenic
1161797654 19:6396502-6396524 GCGTGATGTCACGGATCTGCCGG - Intergenic
1163019144 19:14473391-14473413 TGGTGGTGTCGTGCATCTGCTGG - Exonic
1163191972 19:15683625-15683647 CTGTGAAGTCATGCACCAGGCGG - Exonic
1163654823 19:18539544-18539566 CTGTGACGTCATCCAGGTGCGGG - Exonic
1163808110 19:19412491-19412513 GTGTGGTGGCATGCATCTGTAGG + Intronic
1164018280 19:21272922-21272944 CTGTGATGTGAATCATCTTCAGG + Intronic
1164108058 19:22126085-22126107 CTTTGATGTGAACCATCTGCAGG - Intergenic
1164598108 19:29543491-29543513 CTGTTAGGTCCTGCATGTGCTGG + Intronic
1165778432 19:38418276-38418298 CGGTGACGTCACGCATCTCCCGG - Intronic
1165838709 19:38774195-38774217 CAGTGATTTCCTGCATCTCCTGG - Intergenic
1165949881 19:39468309-39468331 CTGTGAGGTCATGAGTGTGCAGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167669741 19:50843847-50843869 CTGTGATGTGATTCATCTTCAGG + Intergenic
925343379 2:3151809-3151831 CTGTGATGTGAACCATCTGTGGG - Intergenic
925652261 2:6103961-6103983 CTGTGATGTGATCCATCTTCAGG + Intergenic
925705601 2:6681864-6681886 CTGTGATGTGATCCACCTTCAGG - Intergenic
926686066 2:15698681-15698703 CTGTGATGTGATGCTTCAACAGG - Intronic
928472999 2:31592502-31592524 CTGTGATGTGATCCAGCTTCAGG - Intergenic
929010220 2:37434737-37434759 CTGTGATGTGAACCATCTGTGGG + Intergenic
930087959 2:47511544-47511566 CTGTGATGTCACACCTGTGCGGG - Intronic
930421948 2:51165305-51165327 CTGTGATGTGATCCATCTTCAGG + Intergenic
930486446 2:52017474-52017496 CTGTGATGTGAACCATCTGTGGG + Intergenic
930574238 2:53126913-53126935 CTGTGATGTGATCCATCTTCAGG + Intergenic
931547939 2:63409199-63409221 CTGTGATGTGAACCATCTGTGGG - Intronic
932925545 2:75969359-75969381 CTGTGATGTGATCCATCTTCAGG - Intergenic
933086352 2:78058956-78058978 TTGTGATGTGATCCATCTTCAGG + Intergenic
933110808 2:78397594-78397616 CTGTGATGTCATCCATCTTCAGG - Intergenic
933474437 2:82771290-82771312 CTGTGATGTGATCCATCTTCAGG - Intergenic
934157277 2:89215084-89215106 CTGTGATGTCCTGCATAAGTGGG - Intergenic
934210041 2:89967660-89967682 CTGTGATGTCCTGCATAAGTGGG + Intergenic
935484882 2:103640861-103640883 CTGTGATTTCAAGCATCCACTGG - Intergenic
935942684 2:108257780-108257802 CTGTGGTTTCAGGCATCCGCTGG + Intronic
936519584 2:113203042-113203064 CTGTGTGTTCATGCATATGCAGG + Exonic
936701125 2:115012485-115012507 CTGTGATGTGATCCACCTTCAGG - Intronic
936911261 2:117596564-117596586 CTGTGATGTGCAGCATCTGTGGG + Intergenic
937410507 2:121670627-121670649 TTGTGATGTAATCCATCTTCAGG - Intergenic
937588684 2:123587922-123587944 TTGTGGTTTCAGGCATCTGCTGG - Intergenic
937828888 2:126399041-126399063 CTGTGATGTGAACCATCTGTGGG + Intergenic
938175513 2:129123688-129123710 CTGTGATGTGATCCATCTTCAGG + Intergenic
938558105 2:132444623-132444645 TTCTGAACTCATGCATCTGCTGG + Intronic
938712275 2:133985468-133985490 CTGTGGTTTCAGGCATCTGCTGG - Intergenic
939458487 2:142468295-142468317 CTGTGATTTCAGGCATCCACTGG + Intergenic
941357943 2:164515363-164515385 CTGTGATGTGAACCATCTTCAGG - Intronic
941593789 2:167451534-167451556 CTGTGCTGTGAACCATCTGCAGG + Intergenic
943348781 2:186772647-186772669 ATGTGATGTGATCCATCTTCAGG - Intergenic
943909378 2:193543039-193543061 ATGTGATGTGAACCATCTGCAGG - Intergenic
944485446 2:200200259-200200281 CTGTGGTGTGATCCATCTTCAGG - Intergenic
944526055 2:200620742-200620764 CTGTGATGACATGCCTCTGGTGG + Exonic
944602174 2:201313863-201313885 CTGTGATGTGAACCATCTGTGGG - Intronic
945338203 2:208617925-208617947 CTGTGATGTGATCCGTCTTCAGG + Intronic
946461146 2:219869997-219870019 CAGGGATGTCAGGCTTCTGCTGG + Intergenic
947553765 2:231069004-231069026 TTGTGGTTTCAGGCATCTGCTGG + Intronic
947770506 2:232666617-232666639 CTCTGATGTCTACCATCTGCTGG - Intronic
948226247 2:236311343-236311365 CTGTGAGCTCAGGAATCTGCTGG + Intergenic
948513654 2:238489414-238489436 CTCTAATGCCATGCTTCTGCAGG + Intergenic
948576789 2:238956943-238956965 CTGTGATGTGATCCATCTTCAGG - Intergenic
1169100419 20:2943168-2943190 CTGTGGTTTCAGGCATCTACTGG + Intronic
1170086315 20:12535949-12535971 CTGTGATGTGATGCGTCTTCAGG - Intergenic
1170741107 20:19057245-19057267 CTGTGATGTGATACATCTTCAGG - Intergenic
1171198472 20:23222445-23222467 CTGTGATGTGATCCATCTTCAGG + Intergenic
1171962389 20:31504108-31504130 CTCTGTTGTCTTGCATCTTCAGG - Intergenic
1172851378 20:37968767-37968789 CTGTAATGTGATCCATCTTCAGG + Intergenic
1175069127 20:56316848-56316870 CTGTGATGTGAACCATCTGTGGG - Intergenic
1175179274 20:57133900-57133922 CTGTGCTGACATGGCTCTGCAGG - Intergenic
1176089218 20:63311603-63311625 CTGGGACGTCATGTCTCTGCAGG + Exonic
1177127801 21:17217452-17217474 CTGTGATGTGATCCATCTTCAGG - Intergenic
1177364471 21:20116746-20116768 CTGTGATGTAATCCATCTTCAGG + Intergenic
1177578956 21:22994538-22994560 CTGTGATGTGATCCATCTTCAGG - Intergenic
1178038261 21:28609201-28609223 CTGTGATGTGACCCATCTTCAGG - Intergenic
1178209696 21:30515569-30515591 CTGTGATTTCAGGCATCCACTGG - Intergenic
1179444367 21:41420852-41420874 CTGTGGTGTCAGGCACCTGAAGG + Intronic
1179467775 21:41589222-41589244 CTGTGATGTGATCCATCCTCAGG + Intergenic
1180582881 22:16858177-16858199 CTTTGATGCCATGCATCAGCTGG + Intergenic
1181454396 22:23048140-23048162 CTGTGATGTGAACCATCTGTGGG - Intergenic
1181490698 22:23259145-23259167 CTTTGGTGTCATGCCTTTGCTGG + Intronic
1184451237 22:44584032-44584054 CTGTGATGGGATGGATGTGCTGG - Intergenic
1184922608 22:47616166-47616188 CTGAGATTTCAGGCATCTGCTGG + Intergenic
1185013079 22:48327047-48327069 CTGTGGTCTCAGGCATCTACTGG - Intergenic
949145974 3:700701-700723 CTGTGATGTGATTCATCTTCAGG + Intergenic
949377421 3:3405708-3405730 CTCTGATGTGATCCATCTTCAGG - Intergenic
949557392 3:5167469-5167491 CTGTGATGTCAGGCATCCACTGG + Intronic
950581620 3:13866040-13866062 CTGTCATATCCTGCATATGCAGG - Intronic
950599149 3:14016783-14016805 CTGTGATGTGAAACATCTTCAGG + Intronic
950744344 3:15074735-15074757 ATGTGATGTTGTGGATCTGCTGG + Exonic
951183854 3:19689106-19689128 CTGTGATGTGAACCATCTGTGGG - Intergenic
951262165 3:20523291-20523313 CTGTGATGTGATCCATCTTCAGG + Intergenic
951302606 3:21017228-21017250 CTGTGATGTGATCCATCGTCAGG + Intergenic
952024146 3:29058079-29058101 CTGTGATGTGATCCATCTTCAGG - Intergenic
952077144 3:29711037-29711059 CTGTGATTTCAGGCATCCACTGG - Intronic
952122777 3:30264410-30264432 CTGTGATGTGATCCATCTTCAGG - Intergenic
952435473 3:33268973-33268995 CTGTGATGTCATCCATTTTCAGG + Intergenic
952689796 3:36191796-36191818 CTGTGATGTGACCCATCTGTGGG + Intergenic
953185350 3:40632124-40632146 CTGTGATGTGAACCATCTTCAGG - Intergenic
953654885 3:44842414-44842436 CTGTGAGGTCATTGCTCTGCAGG + Intronic
954862186 3:53700408-53700430 TTGGCATGTCATGTATCTGCAGG - Intronic
955233698 3:57121757-57121779 CTGTGGTGTCTGCCATCTGCAGG - Intronic
955308308 3:57857307-57857329 CTGTGATTTCAGGCATCTACTGG - Intronic
955860042 3:63319097-63319119 CTGTGATGTGAACCATCTGTGGG + Intronic
957681424 3:83440559-83440581 CTGTGATGTGATCCATCTTCAGG - Intergenic
959009676 3:101060898-101060920 CTGTGATGTGATCCATGTTCAGG + Intergenic
959125847 3:102290012-102290034 CTGTGATGTGATTCATCTTCAGG + Intronic
960153006 3:114270484-114270506 CTGTGATGTTATTCATCTTCAGG + Intergenic
962034505 3:131636840-131636862 CTGTGATGTGATTCATCTTCAGG - Intronic
962147353 3:132854887-132854909 CTGTTATGTGATCCATCTTCAGG + Intergenic
962191929 3:133319679-133319701 CTGTGATGCAATCCATCTTCAGG - Intronic
962709489 3:138073373-138073395 CTGTGATGTGATCCATCTTCAGG - Intronic
963623040 3:147635672-147635694 CTGTGATGTGATCCATCTTTAGG - Intergenic
963842442 3:150121388-150121410 CTGTGATGTCATGCAAACCCTGG + Intergenic
964017545 3:151965384-151965406 CTGTGATATGATCCATCTTCAGG - Intergenic
964075725 3:152689077-152689099 CTGTGATGTGATACATCTTCAGG - Intergenic
964189047 3:153980711-153980733 CTGTGATGTGAACCATCTGTGGG - Intergenic
964299418 3:155271401-155271423 CTGTGATGAGATCCATCTTCAGG - Intergenic
964457615 3:156885605-156885627 CTGTGATGTGATCCATCTTCAGG + Intronic
964643888 3:158937286-158937308 CTGTGATGTGAACCATCTGTGGG - Intergenic
964772659 3:160240163-160240185 TTGTGATGTGATCCATCTTCAGG - Intronic
964867425 3:161276614-161276636 CTGTGATGTCATCTGTCTTCAGG - Intergenic
964985360 3:162731973-162731995 CTGTGATGTGATCCTTCTTCAGG + Intergenic
965132765 3:164723162-164723184 CTGTGATGTGGTCCATCTTCAGG + Intergenic
965296591 3:166955269-166955291 CTGTGATGTAATCCATCTTCAGG + Intergenic
965528031 3:169741921-169741943 ATTTGATATCATGCATCTGTAGG - Intergenic
966122470 3:176537363-176537385 CTGTGATGTGAACCATCTTCAGG - Intergenic
966270397 3:178097807-178097829 CTGTGATTTCAGGCAGCTGGTGG + Intergenic
966847621 3:184142864-184142886 CTTTGATGTCATCCATCTGAGGG - Exonic
967958628 3:194900520-194900542 CTGTGATGTGATCCATCTTCAGG + Intergenic
968625908 4:1626599-1626621 CAGTGATGTTTTGCATCTGGGGG + Intronic
969130591 4:4988174-4988196 CTGAGGTTTCAGGCATCTGCAGG - Intergenic
969165580 4:5307965-5307987 CTATGATGTGATCCATCTTCAGG + Intronic
969274969 4:6128746-6128768 CTGTGAGGTCAGCCAGCTGCAGG - Intronic
969475606 4:7420982-7421004 CAGTGATGGCAAACATCTGCTGG - Intronic
970549256 4:17163261-17163283 CTGTGATGTGAACCATCTGTGGG + Intergenic
970813574 4:20126258-20126280 CTCTGATTTCTAGCATCTGCTGG + Intergenic
971050345 4:22855134-22855156 CTGTGATGTGATCCATCTTCAGG + Intergenic
972495423 4:39629760-39629782 GTGTGATGGCATGCACCTGTGGG - Intronic
972806524 4:42533823-42533845 CTGTGATATGATCCATCTTCAGG - Intronic
972826849 4:42768444-42768466 CTGTGATTTGATCCATCTTCAGG - Intergenic
973069096 4:45835327-45835349 CTGTGATGTGAACCATCTGTGGG + Intergenic
973920166 4:55675974-55675996 CTGTGATGTGATCCATCTTTAGG - Intergenic
974583379 4:63836661-63836683 CTGTAATGTGATCCATCTTCAGG + Intergenic
975614083 4:76229675-76229697 CTGTGATGTGATCCATCTTCAGG + Intronic
976556255 4:86453915-86453937 CTGTGATGTGAACCATCTGTGGG - Intronic
976904541 4:90220244-90220266 CTGTGGCTTCAGGCATCTGCTGG + Intronic
976963050 4:91003087-91003109 CTGTGATGTGAACCATCTGCAGG + Intronic
977635601 4:99294117-99294139 CTGTGATGTGATCCATCTTCAGG - Intergenic
978199755 4:106012132-106012154 CTGGGATGTAATCCATCTTCAGG + Intergenic
978201906 4:106032478-106032500 CTGTGATGTGATCCGTCTTCAGG + Intergenic
978761900 4:112361889-112361911 CTGTGATGTGATCCATCTTCAGG - Intronic
978924980 4:114231956-114231978 CTGTGATGTGATCCATCTTCAGG - Intergenic
979159990 4:117447976-117447998 CTGTGATTTGATCCATCTTCAGG + Intergenic
979357057 4:119716489-119716511 CTGTGATATGATCCATCTTCAGG - Intergenic
979584772 4:122403330-122403352 CTGTGATGTGATCCATCTTCAGG + Intronic
980153158 4:129073142-129073164 CTGTGATGTGAACCATCTGTGGG + Intronic
980186990 4:129474944-129474966 CTGTGATGTTATCCGTCTTCAGG + Intergenic
980237883 4:130131974-130131996 CTGTGATGTGAACCATCTGTGGG - Intergenic
980409895 4:132403619-132403641 CTGTGATGTGATCCATCTTTAGG + Intergenic
980519244 4:133909768-133909790 CTGTGATGTGATCCATCTTCAGG + Intergenic
980645008 4:135632807-135632829 TTGTGATGTGATCCATCTTCAGG + Intergenic
980761371 4:137238540-137238562 CTGTGATGTGATCCATCTTCAGG + Intergenic
981167685 4:141581214-141581236 CTGTGATGTGACCCATCTTCAGG - Intergenic
981654075 4:147091942-147091964 CTGTGAGCGCATGCATGTGCAGG - Intergenic
981796477 4:148600843-148600865 CTGTGATGTGATTCATCTTCAGG + Intergenic
982169337 4:152645887-152645909 CTGAGGAGTCAGGCATCTGCAGG - Intronic
982189878 4:152843258-152843280 CTGTGATGTGAACCATCTGTGGG + Intronic
982639051 4:157933703-157933725 CTGTGTTGTGTTGGATCTGCTGG - Intergenic
983057061 4:163110493-163110515 TTGTGATTTCAGGCATCCGCTGG + Intronic
983546963 4:168975244-168975266 CTGTGATGTGATCCACCTTCAGG + Intronic
985288619 4:188363019-188363041 CTGTGATGTGAAACATCTGTGGG - Intergenic
986096453 5:4559119-4559141 CTGTGAGGACCTGCATCTGCTGG + Intergenic
986644526 5:9903678-9903700 CTGTGATGTGATCCATCTTCAGG + Intergenic
987030346 5:13971614-13971636 CTGTGATGTGATCCATCTTCAGG + Intergenic
987440552 5:17951365-17951387 CTGTGATGTGAACCATCTTCAGG + Intergenic
987552739 5:19405114-19405136 CTGTGGTTTCAGGCATCTACTGG + Intergenic
987901966 5:24023767-24023789 CTGTGATGTAATTCACCTTCAGG - Intronic
988278456 5:29113814-29113836 CTGGGATGTGATCCATCTTCAGG + Intergenic
988652320 5:33166420-33166442 CTGTGATGTGATCCATCTTCAGG + Intergenic
988799683 5:34684578-34684600 CTTTGATGACATGAATCTGGAGG - Exonic
989073091 5:37533101-37533123 CTGTGATATGATTCATCTTCAGG + Intronic
989073260 5:37534090-37534112 CTGTGATATGATTCATCTTCAGG - Intronic
989355410 5:40538961-40538983 CTGTGATGTGATTCACCTTCAGG + Intergenic
989431483 5:41360697-41360719 TTGTGATGTGATCCATCTTCAGG + Intronic
989779474 5:45247056-45247078 CTGTGATTGCATGCATGTGCTGG + Intergenic
990243563 5:53839217-53839239 CTGTGATGTAAAACATCTTCTGG - Intergenic
990533142 5:56693962-56693984 CTGTTTTGTTATGCAGCTGCAGG - Intergenic
990712777 5:58604148-58604170 CTGTGATGTGAACCATCTGTGGG + Intronic
991228427 5:64300557-64300579 CTGTGGTTTCAGGCATCTACTGG + Intronic
991387014 5:66101503-66101525 CTGTGATGTGAACCATCTGTGGG - Intergenic
991623051 5:68566000-68566022 CTGTGATGTTATCCGTCTTCAGG - Intergenic
992599787 5:78387797-78387819 CTGTGATGTGATCCATCTTCAGG + Intronic
993237628 5:85333811-85333833 CTGAGAAGTCCTGCATCTGAAGG - Intergenic
993606796 5:90000862-90000884 CTGTGATGGTATTCATCTTCAGG - Intergenic
993920446 5:93794752-93794774 CTGTGATGTGATCCATCTTCAGG + Intronic
994220762 5:97192632-97192654 CTGTGATGTTATTTATCTTCAGG + Intergenic
994347279 5:98701309-98701331 CTGTGATATGATTCATCTTCAGG - Intergenic
994496618 5:100520698-100520720 CTGTGATGTGATCCATCTTCAGG - Intergenic
995379250 5:111513299-111513321 CTGTGAAGTCACCCATCTGATGG + Intergenic
996080862 5:119256354-119256376 CTGTGATGTGAATCATCTTCAGG - Intergenic
996128580 5:119753686-119753708 CTGTGATGTGAATCATCTTCAGG - Intergenic
996141270 5:119912848-119912870 CTGTGATGTGATCCATCTTTAGG + Intergenic
996197876 5:120632036-120632058 CTGTGATGTGATCCGTCTTCAGG - Intronic
996326921 5:122285960-122285982 CTGTGATGTGATCCATCTTCAGG + Intergenic
996616011 5:125441732-125441754 CTGTGATGTGATCCATCTTCAGG - Intergenic
996631920 5:125643077-125643099 CTGTGGTGTTATCCATCTTCAGG - Intergenic
997005034 5:129806448-129806470 CTGTGATGTGATCCCTCTTCAGG + Intergenic
997231034 5:132243344-132243366 CTGTGATATGATCCATCTTCAGG + Intronic
998637267 5:143969906-143969928 CTGTGATGTCATATACATGCAGG - Intergenic
998758667 5:145407951-145407973 CTGTGATGTGATTCATCTTCAGG - Intergenic
999934597 5:156473236-156473258 CTGTGGTTTCAGGCATCTACTGG - Intronic
1000273816 5:159713992-159714014 CTGTGATGTGATGCAACAGGTGG - Intergenic
1000394709 5:160761349-160761371 CTGTGATGTGATCCATCTTCAGG - Intronic
1000525588 5:162353555-162353577 CTGTGATGTGATCCATCTTCAGG + Intergenic
1000816967 5:165935241-165935263 ATGTCAAGTCATGCATGTGCAGG + Intergenic
1003297419 6:4844167-4844189 CTGTGATGTGAACCATCTTCAGG + Intronic
1003522307 6:6868642-6868664 CTGTGTTTTCCCGCATCTGCTGG + Intergenic
1004525707 6:16405447-16405469 CTGTGATGTCATGCACCTTGTGG + Intronic
1005305689 6:24512170-24512192 CTGTGATGTGAACCATCTGTGGG + Intronic
1006212259 6:32406320-32406342 GTGTGATGTGATGAAGCTGCTGG - Intronic
1006366525 6:33619465-33619487 CTGTGATGTCAGGCCTCTGCTGG - Intergenic
1007349599 6:41259390-41259412 CTGTGATGTGACCCATCTTCAGG - Intergenic
1007878997 6:45140704-45140726 CTGTGATGTTATCCGTCTTCAGG - Intronic
1008290062 6:49704685-49704707 CTGTGATGTGATCCATCTTCAGG + Intronic
1008417926 6:51265125-51265147 GAGTGATGGAATGCATCTGCTGG + Intergenic
1008845445 6:55957580-55957602 CCGTGATGTCCTGCATATGTGGG + Intergenic
1009360219 6:62802517-62802539 CTGTGATGTGATCCTTCTTCAGG + Intergenic
1009589191 6:65643732-65643754 CTCTGATGTGATTCATCTTCAGG - Intronic
1010181830 6:73095760-73095782 CTGTGATGTGAACCATCTGTGGG + Intronic
1010358511 6:74965117-74965139 CTGTGATGTGATTCATCTTCAGG + Intergenic
1010479852 6:76338016-76338038 CTGTGATGAGATCCATCTTCAGG + Intergenic
1010862978 6:80937107-80937129 CTGTGATGTCAACCATCTTCAGG + Intergenic
1010975982 6:82313857-82313879 CTGTGATGTGATCCATCTTCAGG - Intergenic
1011156569 6:84340471-84340493 CTGTGATGTGATCCATCTTAAGG + Intergenic
1011344374 6:86352853-86352875 CTATAATGACATTCATCTGCTGG - Intergenic
1011375461 6:86681807-86681829 CTGTGATATGATCCATCTTCAGG + Intergenic
1011589024 6:88952766-88952788 CTGTGATGTAATCCATCTTCAGG - Intronic
1012225138 6:96694711-96694733 CTGTGATGTGAACCATCTGTGGG - Intergenic
1012273500 6:97243905-97243927 CTGTGATGTGATCTATCTTCAGG + Intronic
1013291792 6:108726275-108726297 CTGTGGTTTCAGGCATCCGCTGG - Intergenic
1014792708 6:125692971-125692993 CTGTGATGTGATCCATATTCGGG + Intergenic
1014878098 6:126685853-126685875 CTGTGATGTGATTCGTCTTCAGG - Intergenic
1016176000 6:141078146-141078168 CTGTGATGTGAACCATCTTCAGG - Intergenic
1016910069 6:149190128-149190150 CTGTGATGTGATCCATCTTCAGG + Intergenic
1017326355 6:153145621-153145643 CTGTGATGTGATCCATCTTCAGG + Intergenic
1018781712 6:167073851-167073873 CTGTGATGCAATCCATCTTCAGG + Intergenic
1018797751 6:167200413-167200435 CTGTGGTTTCAGGCATCTACTGG + Intergenic
1018902211 6:168057324-168057346 CTGTCATTTCCTGGATCTGCGGG + Exonic
1019123402 6:169823566-169823588 CTGTGATGTGATCCGTCTTCAGG + Intergenic
1019374376 7:681561-681583 CTGAGATGACAAGCATCTGGAGG + Intronic
1019436873 7:1026894-1026916 CTGTGCTGTCAGGAAACTGCAGG + Intronic
1020332292 7:7032144-7032166 CTGTGATGTGATCCATCTTCAGG + Intergenic
1021340176 7:19455418-19455440 CTGTGATGTGATTCATCTTCAGG + Intergenic
1022040592 7:26577835-26577857 CTGAGATGTCATCCTTCAGCTGG - Intergenic
1022532739 7:31076974-31076996 CTGTGATGTTGTGCAGCTGTGGG + Intronic
1022673367 7:32476546-32476568 CTGAGAAGTAATGCACCTGCAGG + Intergenic
1022894806 7:34739745-34739767 CTGTGATGTGAACCATCTGTGGG + Intronic
1023537680 7:41231086-41231108 CTGTGATGTGATCCGTCTTCAGG + Intergenic
1023692568 7:42806208-42806230 CTGTGATGTAATCCATCTTCAGG - Intergenic
1024174814 7:46828064-46828086 CTGTGATGTGATCCATCTTTAGG - Intergenic
1024367242 7:48535348-48535370 CTGTGATGTGATCCATCTTCAGG + Intronic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1024818898 7:53303987-53304009 CTGTGGGGACTTGCATCTGCAGG - Intergenic
1027431921 7:78123331-78123353 CTGTGATTTCAGGCATCCGCTGG - Intronic
1027733243 7:81902586-81902608 CTGTGATGTGATCCATCTTCAGG + Intergenic
1028197812 7:87927263-87927285 CTGTGATGTGATCCAGCTTCAGG - Intergenic
1028261743 7:88674560-88674582 CTGTGATGTGATCCATCTTCAGG - Intergenic
1028347996 7:89807552-89807574 CTATGATGTGATCCATCTTCTGG + Intergenic
1028648032 7:93120005-93120027 CTGTGATGTAATACATCTTCAGG - Intergenic
1028782936 7:94757722-94757744 CTGTGATGTGATCCATCTTCAGG - Intergenic
1028819539 7:95190363-95190385 CTGTGATGTGATCCTTCTTCAGG + Intronic
1028822637 7:95229965-95229987 CTGTGATGTGATTCATCTTCAGG - Intronic
1028993513 7:97075632-97075654 CTGTGATGTGAACCATCTACGGG + Intergenic
1030254718 7:107496175-107496197 CTTTGATGTCAGGCAAATGCTGG - Intronic
1030390389 7:108920687-108920709 CTGTGATGTGAACCATCTGTGGG + Intergenic
1031138926 7:117919561-117919583 CTGTGATGTCAACCATCTGTGGG - Intergenic
1031576721 7:123423144-123423166 CTGTGATGTGAACCATCTTCAGG - Intergenic
1031612693 7:123845990-123846012 CTGTGATGTAAACCATCTGCAGG + Intronic
1031796835 7:126185875-126185897 TTGTGATGTGATTCATCTTCAGG + Intergenic
1031921773 7:127607492-127607514 CTGTGGTTTCAGGTATCTGCTGG - Intergenic
1032794377 7:135265997-135266019 CCTTGATTTCAGGCATCTGCTGG - Intergenic
1032935765 7:136729602-136729624 CTGTGATGTGATCCATCTTCAGG - Intergenic
1033026904 7:137782792-137782814 CTGTGATGTGATCCATCTTCAGG - Intronic
1033462691 7:141562001-141562023 CTGTGATGTAATCCATATTCAGG + Intronic
1033816652 7:145082264-145082286 CTGTGATGTGATCCATCTTCAGG + Intergenic
1033961520 7:146919525-146919547 CTGTGATGTGATCCATCTTCGGG + Intronic
1034019568 7:147626970-147626992 CTATGATGTGATCCATCTTCAGG - Intronic
1034056233 7:148037960-148037982 CTGTGGTTTCAGGCATCTACTGG + Intronic
1034223697 7:149465358-149465380 CTGTGACTGCAGGCATCTGCTGG - Intergenic
1034247811 7:149662276-149662298 CTGTGATGTGAGCCATCTTCAGG + Intergenic
1035151282 7:156874599-156874621 CTGTGATGTGAACCGTCTGCAGG - Intronic
1035533502 8:373920-373942 CTGTGGTTTCAGACATCTGCTGG - Intergenic
1036172719 8:6504855-6504877 GTGTGATTTCAGGCATTTGCTGG + Intronic
1038280864 8:26163199-26163221 CTGTGATTTCAGGCATCCACTGG + Intergenic
1038703315 8:29871558-29871580 CCCTGATGTCTTGCCTCTGCAGG - Intergenic
1039000934 8:32979570-32979592 CTGTGATGTGAACCATCTTCAGG + Intergenic
1039864022 8:41485379-41485401 CTTTGTTTTCATGCATTTGCTGG - Intergenic
1040399396 8:47033429-47033451 CTGTGATGTGATTCATCTTCAGG + Intergenic
1040482200 8:47836353-47836375 GTGTGAAGTCATGCTGCTGCTGG + Exonic
1040529296 8:48253436-48253458 CTGTGATGTGATCCATCTTCAGG + Intergenic
1040844271 8:51820692-51820714 CTGTGCTGTCAGGAATCTACAGG - Exonic
1041150394 8:54926262-54926284 CTGTGATGTGATCCATCTTCAGG - Intergenic
1041763590 8:61393745-61393767 CTGTGATGTGATCCATTTTCAGG + Intronic
1041832105 8:62165350-62165372 CTGTGATGTGATTCATCTTCAGG - Intergenic
1042481900 8:69313752-69313774 CTGTGGTTTCAGGCATCTCCTGG + Intergenic
1043556702 8:81438898-81438920 CTGTGATGTGATCTATCTTCAGG + Intergenic
1043987872 8:86715346-86715368 CTGTGATGTGATCCGTCTTCAGG - Intronic
1044947824 8:97407700-97407722 CTGTGATGTAATCCATCTTCAGG + Intergenic
1045671110 8:104553931-104553953 CTGAGATGTGATCCATCTTCAGG - Intronic
1045722100 8:105124596-105124618 CTGTGGTTTCAGGCATCTACTGG - Intronic
1046033828 8:108817073-108817095 CTATGATGTGATCCATCTTCAGG + Intergenic
1046394668 8:113625917-113625939 CTGTGATGTGAACCATCTTCAGG - Intergenic
1047227262 8:122967488-122967510 CTGTGATATGATCCATCTTCAGG + Intronic
1047833960 8:128667585-128667607 CTGTGATTTCATGCCACTGGAGG + Intergenic
1049866376 8:144940441-144940463 TTGTGTTTTCATTCATCTGCAGG + Intronic
1050133547 9:2438878-2438900 CTGTGATGTGAACCATCTTCAGG + Intergenic
1050400518 9:5248466-5248488 CTGTGATGTGATCCATTTTCAGG - Intergenic
1051881234 9:21841579-21841601 CTGCGATGTGATCCATCTTCAGG - Intronic
1051929522 9:22367768-22367790 CTGTGATGTGATCCATCTTCAGG - Intergenic
1052253680 9:26428119-26428141 CTGTGATGTGATCCATCTTCAGG - Intergenic
1052264896 9:26560840-26560862 ATATGATGTCATACATCTTCTGG + Intergenic
1055137974 9:72844684-72844706 CTGTGATGTGATTCATCTTCAGG - Intergenic
1055156377 9:73067394-73067416 CTGTGATGTGATGTGTCTTCAGG - Intronic
1055187067 9:73470333-73470355 CTGCGATGTGATGCTTCTTCAGG + Intergenic
1056685094 9:88752567-88752589 CTTTGATGTCATGCCTGAGCAGG - Intergenic
1056755892 9:89381858-89381880 CTGTTATGTTAGGCCTCTGCTGG - Intronic
1056948128 9:91018114-91018136 CTGTGATGTGATCCATCTTCAGG - Intergenic
1057108153 9:92440802-92440824 CTGTGGTTTCAGGCATCTACAGG + Intronic
1059132128 9:111764395-111764417 CAGTGATTTCATGCATCCACTGG + Intronic
1059228947 9:112699636-112699658 CTGTGATTTCAGGCATCTACTGG + Intronic
1059579545 9:115529376-115529398 CTGTGTTTTCAGGCATCTACTGG - Intergenic
1060311122 9:122463764-122463786 CTGTGATGTGATCCCTCTTCAGG + Intergenic
1060965368 9:127709536-127709558 CTGTGATCTCATCCACCTGCTGG - Exonic
1062713667 9:137990753-137990775 CTGTGATGTGATCCATCTTCAGG - Intronic
1186043775 X:5510960-5510982 CTGTGGTCTCAGCCATCTGCTGG - Intergenic
1186596412 X:10986424-10986446 CTGTGCTGTTAAACATCTGCAGG - Intergenic
1188709023 X:33371350-33371372 CTGTAATGTGATGGATCTTCAGG + Intergenic
1189600082 X:42615160-42615182 CTGTGATGTGACCCATCTTCAGG + Intergenic
1189639257 X:43050381-43050403 TTGTGATGTGATGCATCTTCAGG + Intergenic
1189860463 X:45265892-45265914 CTGTGAGTAAATGCATCTGCGGG + Intergenic
1189946019 X:46179952-46179974 CTGTGATGTAATCCATCTTCAGG + Intergenic
1190897246 X:54633085-54633107 CTGTGATGTGATCCATCTTCGGG + Intergenic
1191018824 X:55839457-55839479 CTGTGATGTGAACCATCTTCAGG + Intergenic
1191026582 X:55920066-55920088 CTGTGATATGATTCATCTTCAGG - Intergenic
1191784465 X:64903044-64903066 CTGTGATGTTACCCATCTTCAGG + Intergenic
1191879389 X:65829157-65829179 CTGTGATGTGATCCATCTTCAGG - Intergenic
1192009025 X:67248209-67248231 CTGTGATTTGATCCATCTTCAGG - Intergenic
1192673946 X:73175328-73175350 CTGTGATGTGATTCATCTTCAGG + Intergenic
1192876069 X:75230752-75230774 CTGGGATGTGATTCATCTTCAGG - Intergenic
1192900110 X:75487331-75487353 CTGTGATATGATCCATCTTCAGG - Intronic
1192944967 X:75956799-75956821 CTGTGATGTGATCCATCTTCAGG + Intergenic
1192991780 X:76467208-76467230 CTGTGATGTGATTCATCTTCAGG + Intergenic
1193076625 X:77362620-77362642 CTGTGATGTGACCCATCTTCAGG + Intergenic
1193208666 X:78779490-78779512 CTGTGATGTGAACCATCTGTGGG + Intergenic
1193366337 X:80638165-80638187 CTGTGATGTGATCCATCTTCAGG - Intergenic
1193382714 X:80834434-80834456 CTGTGATGTGATCCATCTTTAGG - Intergenic
1193404313 X:81082964-81082986 CTGTGATGTGAGCCCTCTGCAGG - Intergenic
1193556575 X:82961127-82961149 TTGTGATGTGATCCATCTTCAGG - Intergenic
1193590692 X:83385110-83385132 CTGTGATGTGATCTATCTTCAGG - Intergenic
1193751169 X:85345931-85345953 CTGTGATGGCTTGGATTTGCTGG + Exonic
1193785949 X:85760172-85760194 CTGTGATGTGAACCATCTGTTGG + Intergenic
1193817481 X:86121769-86121791 CTGTGATGTGATCCATCTTCAGG + Intergenic
1193937177 X:87637146-87637168 CTGTGATGTGATCCATCTTCAGG - Intronic
1193954581 X:87844154-87844176 CTGTGATGTGATCTATCTTCAGG + Intergenic
1193994864 X:88352962-88352984 CTGTGATGTGATCCATCTTCAGG - Intergenic
1194076356 X:89399646-89399668 CTGTGATGTGATTCATCTTTAGG + Intergenic
1194081058 X:89465734-89465756 CTGTGATGGGATCCATCTTCAGG - Intergenic
1194095261 X:89631883-89631905 CTGTGATGTGATCCATCTTCAGG + Intergenic
1194104433 X:89751589-89751611 CTGTGATGTGAACCATCTTCAGG + Intergenic
1194231629 X:91331781-91331803 CTGTAATGTGATTCATCTTCAGG - Intergenic
1194332716 X:92602663-92602685 CTCTGATGTCATGCATCAGAGGG - Intronic
1194547581 X:95257057-95257079 CTTTGATGTGAACCATCTGCAGG + Intergenic
1195231911 X:102859087-102859109 CTGTGATGTGAACCATCTGCAGG + Intergenic
1195237155 X:102911656-102911678 CTGTGATGTGATCCATCTTCAGG - Intergenic
1195972760 X:110491602-110491624 CTGTGATGTGATCCATCTTCAGG + Intergenic
1196949063 X:120857682-120857704 CTGTGATGTTATCCATCTTCAGG - Intergenic
1197034592 X:121858972-121858994 CTGTGATATGATCCATCTTCAGG + Intergenic
1197055432 X:122113434-122113456 CTGTGATGTGAACCATCTTCGGG + Intergenic
1197081689 X:122426091-122426113 CTGTGATGTGATTCATCTTCGGG + Intergenic
1197083589 X:122446824-122446846 CTGCGATGTGATCCATCTTCAGG - Intergenic
1197120143 X:122881035-122881057 CTGTGATGTGATCCATCTTGAGG - Intergenic
1197184464 X:123570821-123570843 CTGTGATGTGATCCATCTTCAGG - Intergenic
1197472114 X:126877028-126877050 CTGTGATGTGATCCATCTTTAGG + Intergenic
1198559850 X:137837853-137837875 CTGTGATGTGATCCATCTTCAGG + Intergenic
1198582950 X:138087054-138087076 CTGTGATGTGAACCATCTGTGGG - Intergenic
1198718280 X:139586226-139586248 CTCTCATGTCTTGCATATGCAGG - Intronic
1198797220 X:140410275-140410297 CTGGGATGTGATCCATCTTCAGG + Intergenic
1199014895 X:142804071-142804093 CCGTGATGTGATCCATCTTCAGG + Intergenic
1199553625 X:149082003-149082025 CTGTGATATGATCCATCTTCAGG - Intergenic
1200428996 Y:3055166-3055188 CTGTGATGTGATTCATCTTTAGG + Intergenic
1200433732 Y:3121935-3121957 CTGTGATGGGATCCATCTTCAGG - Intergenic
1200447892 Y:3288061-3288083 CTGTGATGTGATCCATCTTCAGG + Intergenic
1200456391 Y:3399371-3399393 CTGTGATGTGAACCATCTTCAGG + Intergenic
1200641411 Y:5721707-5721729 CTCTGATGTCATGCATCAGAGGG - Intronic
1201501566 Y:14648859-14648881 GTGTGATGGCAAGCATGTGCTGG + Intronic
1201542738 Y:15125840-15125862 CTGTGGTCTCAGGCATCTGCTGG + Intergenic
1201927076 Y:19299007-19299029 ATGTTATGTTCTGCATCTGCTGG + Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic