ID: 1156232185

View in Genome Browser
Species Human (GRCh38)
Location 18:35164376-35164398
Sequence CAAGCCACTTCCTTGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156232182_1156232185 -2 Left 1156232182 18:35164355-35164377 CCAGGAATCTGTTTGGAACTTCA No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232181_1156232185 4 Left 1156232181 18:35164349-35164371 CCAGCTCCAGGAATCTGTTTGGA No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232176_1156232185 19 Left 1156232176 18:35164334-35164356 CCCCTAAATGCATCTCCAGCTCC No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232175_1156232185 28 Left 1156232175 18:35164325-35164347 CCTGCTCTTCCCCTAAATGCATC No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232174_1156232185 29 Left 1156232174 18:35164324-35164346 CCCTGCTCTTCCCCTAAATGCAT No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232178_1156232185 17 Left 1156232178 18:35164336-35164358 CCTAAATGCATCTCCAGCTCCAG No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data
1156232177_1156232185 18 Left 1156232177 18:35164335-35164357 CCCTAAATGCATCTCCAGCTCCA No data
Right 1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156232185 Original CRISPR CAAGCCACTTCCTTGTTGGG TGG Intergenic
No off target data available for this crispr