ID: 1156232356

View in Genome Browser
Species Human (GRCh38)
Location 18:35165908-35165930
Sequence GCTAGGAGATCAGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156232356_1156232363 20 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232363 18:35165951-35165973 GCCAATAATGGAAAAGAAAAAGG No data
1156232356_1156232366 27 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232356_1156232365 23 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232365 18:35165954-35165976 AATAATGGAAAAGAAAAAGGAGG No data
1156232356_1156232367 28 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232367 18:35165959-35165981 TGGAAAAGAAAAAGGAGGATGGG No data
1156232356_1156232359 -8 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232359 18:35165923-35165945 CTCCTAGCAACCAGTGAACAAGG No data
1156232356_1156232362 8 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232362 18:35165939-35165961 AACAAGGTGCAAGCCAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156232356 Original CRISPR GCTAGGAGATCAGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr