ID: 1156232357

View in Genome Browser
Species Human (GRCh38)
Location 18:35165912-35165934
Sequence GGTTGCTAGGAGATCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156232357_1156232362 4 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232362 18:35165939-35165961 AACAAGGTGCAAGCCAATAATGG No data
1156232357_1156232366 23 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232357_1156232365 19 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232365 18:35165954-35165976 AATAATGGAAAAGAAAAAGGAGG No data
1156232357_1156232367 24 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232367 18:35165959-35165981 TGGAAAAGAAAAAGGAGGATGGG No data
1156232357_1156232363 16 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232363 18:35165951-35165973 GCCAATAATGGAAAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156232357 Original CRISPR GGTTGCTAGGAGATCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr