ID: 1156232366

View in Genome Browser
Species Human (GRCh38)
Location 18:35165958-35165980
Sequence ATGGAAAAGAAAAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156232356_1156232366 27 Left 1156232356 18:35165908-35165930 CCTTCCACCTCTGATCTCCTAGC No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232361_1156232366 2 Left 1156232361 18:35165933-35165955 CCAGTGAACAAGGTGCAAGCCAA No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232358_1156232366 20 Left 1156232358 18:35165915-35165937 CCTCTGATCTCCTAGCAACCAGT No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232360_1156232366 10 Left 1156232360 18:35165925-35165947 CCTAGCAACCAGTGAACAAGGTG No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232354_1156232366 29 Left 1156232354 18:35165906-35165928 CCCCTTCCACCTCTGATCTCCTA No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232357_1156232366 23 Left 1156232357 18:35165912-35165934 CCACCTCTGATCTCCTAGCAACC No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data
1156232355_1156232366 28 Left 1156232355 18:35165907-35165929 CCCTTCCACCTCTGATCTCCTAG No data
Right 1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156232366 Original CRISPR ATGGAAAAGAAAAAGGAGGA TGG Intergenic
No off target data available for this crispr