ID: 1156233997

View in Genome Browser
Species Human (GRCh38)
Location 18:35183401-35183423
Sequence GAGGGCTGCATTGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156233992_1156233997 -7 Left 1156233992 18:35183385-35183407 CCCCGTGTGAAGCCCTGAGGGCT No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233993_1156233997 -8 Left 1156233993 18:35183386-35183408 CCCGTGTGAAGCCCTGAGGGCTG No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233983_1156233997 27 Left 1156233983 18:35183351-35183373 CCTGCCCAGCCAGTGCTGTTTCC No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233988_1156233997 18 Left 1156233988 18:35183360-35183382 CCAGTGCTGTTTCCTGCATGGGA No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233985_1156233997 22 Left 1156233985 18:35183356-35183378 CCAGCCAGTGCTGTTTCCTGCAT No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233994_1156233997 -9 Left 1156233994 18:35183387-35183409 CCGTGTGAAGCCCTGAGGGCTGC No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233989_1156233997 6 Left 1156233989 18:35183372-35183394 CCTGCATGGGACACCCCGTGTGA No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233982_1156233997 30 Left 1156233982 18:35183348-35183370 CCACCTGCCCAGCCAGTGCTGTT No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data
1156233984_1156233997 23 Left 1156233984 18:35183355-35183377 CCCAGCCAGTGCTGTTTCCTGCA No data
Right 1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156233997 Original CRISPR GAGGGCTGCATTGCTGCTGC AGG Intergenic
No off target data available for this crispr