ID: 1156235256

View in Genome Browser
Species Human (GRCh38)
Location 18:35197065-35197087
Sequence TTAGATTGCCAGTTGATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156235256_1156235257 -4 Left 1156235256 18:35197065-35197087 CCGAGCATCAACTGGCAATCTAA No data
Right 1156235257 18:35197084-35197106 CTAACATGAACTAATAATTCAGG No data
1156235256_1156235258 8 Left 1156235256 18:35197065-35197087 CCGAGCATCAACTGGCAATCTAA No data
Right 1156235258 18:35197096-35197118 AATAATTCAGGCACTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156235256 Original CRISPR TTAGATTGCCAGTTGATGCT CGG (reversed) Intergenic
No off target data available for this crispr