ID: 1156241383

View in Genome Browser
Species Human (GRCh38)
Location 18:35257894-35257916
Sequence AGAGAGAAGCAGGATTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 713}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156241383 Original CRISPR AGAGAGAAGCAGGATTAGGA AGG (reversed) Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901777570 1:11570822-11570844 AGAGAGAGGGAGGAGCAGGAAGG + Intergenic
902768867 1:18634252-18634274 AGAGAGGTGCAGGGTGAGGATGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904476505 1:30768593-30768615 AGAGACAGGGAGGAGTAGGAAGG - Intergenic
905461949 1:38127860-38127882 AGAGTGAAGAAGGAAAAGGAGGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906612792 1:47214827-47214849 TGAGAGGAGCAGTATGAGGAAGG - Intergenic
907058187 1:51391844-51391866 CAAGAAAAGCAGGTTTAGGAAGG + Intronic
907843816 1:58185235-58185257 AGAGGGAAGCAGGAGAAGGATGG + Intronic
907845470 1:58201950-58201972 TGATAGAAGCAGAATTAGGTAGG - Intronic
908220685 1:62002738-62002760 AGAGAGAAACTGGAGTTGGAAGG + Intronic
908418652 1:63937987-63938009 AGAGGGAGCCAGGATTTGGAAGG - Intronic
908500091 1:64734391-64734413 GGAGAGGAGCAGGAGTAGGTGGG + Intergenic
909594795 1:77394417-77394439 AGAGGGAAGGAGGATTAAGAAGG - Intronic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
909699104 1:78500595-78500617 AGAAGGAAGCAGGATTGGGTAGG - Intronic
910007648 1:82418317-82418339 AGAGAAAGACAAGATTAGGAGGG + Intergenic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910165036 1:84318258-84318280 AAACAGAAGCAGTATTAAGAGGG - Intronic
910213498 1:84817916-84817938 AGAGTGAAGGAGGAGTAGGAGGG - Intronic
910646488 1:89520723-89520745 AAACAGAAGCAGGATTTAGAAGG - Intergenic
910651538 1:89573672-89573694 ATAGAGAAGCAGGATCAGTGAGG - Intronic
910671083 1:89773432-89773454 AGAGACAAGCAGGGTTTGCATGG + Intronic
911119671 1:94282958-94282980 AGAGAGTAGGAGGGATAGGAGGG - Intergenic
911207170 1:95103503-95103525 AGAGAGATGAAGGAATAAGAAGG + Intergenic
911244306 1:95499958-95499980 AAAGGGAAGCAGGTTTAAGAGGG - Intergenic
911392073 1:97258100-97258122 AGAGTAAAGATGGATTAGGAGGG + Intronic
911967548 1:104386807-104386829 AGAGTGAAGGAGGATTGAGAAGG - Intergenic
912280917 1:108312472-108312494 AGAGAAAAGTAGGAAGAGGATGG + Intergenic
912336886 1:108871522-108871544 AGAGTGAAACAGGATAGGGAAGG - Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913105313 1:115609016-115609038 GGAGAGAAGCAGGACTGGGTAGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914440569 1:147702197-147702219 AAAGAGAAGCTGGATGATGATGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914748042 1:150513667-150513689 AAATACAAGCAGGCTTAGGAGGG - Intronic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
916175879 1:162037968-162037990 AGAGAGAAGTAGAACTAAGATGG + Intergenic
916270840 1:162939817-162939839 AGACAGAAGGAGGAGTAGAAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916805308 1:168254062-168254084 AGAGAGAATAGGGATTGGGAGGG + Intergenic
916881586 1:169024321-169024343 AGAGAGGAGGAGGAGAAGGAAGG + Intergenic
917186526 1:172362745-172362767 GGCCAGAAGCTGGATTAGGAGGG - Intronic
918188509 1:182148918-182148940 AGAGTGAAGCAGGAATAGGGAGG - Intergenic
918473669 1:184900673-184900695 AGAGAGAAGGAGGAATAGAGGGG + Intronic
919513140 1:198491159-198491181 AGAGAGCAGCAGGAAGAAGATGG + Intergenic
919609152 1:199723792-199723814 AGAGGAAAGCAGGATTAGCAGGG - Intergenic
919725571 1:200880622-200880644 ACAGAGTGGCAGGATAAGGAAGG + Intergenic
919744464 1:200999978-201000000 ACAGGGAAGCTGGATTAGGAAGG + Intronic
919780190 1:201216419-201216441 AGAGAGGAGCGGGAAGAGGAGGG - Intronic
919988839 1:202694787-202694809 GGAGAGAAGGAGGAGGAGGAGGG - Intronic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922356966 1:224785685-224785707 ACAAAGAACCAGGAGTAGGATGG - Intergenic
922786759 1:228286739-228286761 AGAGAGAAGCAGGAGCATGTGGG - Intronic
923081267 1:230658048-230658070 TGACAGAAGCAGGCTTTGGAAGG - Intronic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923470984 1:234290902-234290924 AGAGAGTAGCAGAATTGAGAGGG - Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
923763026 1:236864451-236864473 ACAGAGAAGCAGTGTCAGGAAGG + Intronic
924260480 1:242225076-242225098 AGTGAGAGGCAGGATTCAGAGGG - Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063143246 10:3274391-3274413 AAAGAGTGGCGGGATTAGGAGGG + Intergenic
1063595181 10:7428586-7428608 AGAGAGAATAAGCATTAGGTTGG + Intergenic
1063602405 10:7494159-7494181 GGAGAGAAGCTGGCTCAGGAAGG + Intergenic
1065383375 10:25111687-25111709 AGAGAGAAGCAGGATGAGATGGG - Intergenic
1065691397 10:28337443-28337465 AGAGAGGAGAAGGAAAAGGAAGG + Intergenic
1065714721 10:28555039-28555061 TGAGAAAAGCAGGTTTGGGAGGG - Intronic
1066350204 10:34630420-34630442 AGAGAGAGGGAGGATAAGGGTGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1068756526 10:60660758-60660780 ACAGAGAAGTAGGGATAGGATGG + Intronic
1069267072 10:66473353-66473375 AGAGAGAAGCATGAGGAGCAAGG - Intronic
1070521815 10:77260316-77260338 AGAGAGAGGAAGGATTTGGTCGG + Intronic
1070747924 10:78946040-78946062 TGAGAGAAGCAGGATAGGGGAGG - Intergenic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1071935671 10:90527336-90527358 AGAGAGAAGGAGGAGTAAAATGG - Intergenic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1072740754 10:97907722-97907744 AGACACAAGCAGGACTTGGAGGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073262770 10:102203078-102203100 AGAAAGAGGAATGATTAGGAGGG - Intergenic
1073443764 10:103568734-103568756 GGAGAGAGGCAGGATTACCAAGG - Intronic
1073623895 10:105076444-105076466 AGAGAGAAACAGGTTTATAAAGG - Intronic
1074160262 10:110831021-110831043 ATAGACACGCAGGGTTAGGATGG - Intronic
1074616982 10:115079359-115079381 TGGGAGAAGCAGGTTTGGGAGGG - Intergenic
1074674502 10:115832795-115832817 ACAGAGATGCAGGATCAAGAAGG - Intronic
1075387180 10:122063356-122063378 AGTCAGAAGCAGGACAAGGAGGG - Intronic
1075655676 10:124159533-124159555 AGTGAGAATCAGGATTCTGATGG + Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076667798 10:132102858-132102880 AGACAGATGCAGGAGTAGGGGGG + Intergenic
1076749406 10:132535072-132535094 AGAGAGAAGCAGAGTAAGGCAGG + Intergenic
1077280415 11:1742409-1742431 AGAGACAAGGTGGATGAGGAAGG + Intronic
1077522805 11:3046318-3046340 AGAGGGGGGCAGGATTAGGGAGG - Intronic
1077911680 11:6577376-6577398 AGAGAGGAGCAGCATTAGAATGG + Intronic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1078893517 11:15578499-15578521 GGAGTGAAGCAGGTTTAGAAGGG + Intergenic
1079241430 11:18724885-18724907 AGATAGACGCAGGAGTGGGAGGG - Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080277357 11:30517616-30517638 AGAAACATGCAGGATGAGGAAGG - Intronic
1082706728 11:56501532-56501554 AGACAGAAGCTGAATTAGAAGGG - Intergenic
1082875341 11:57982193-57982215 AGAGAGGAGCAGGAGTGGGCAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083567800 11:63734828-63734850 AGAAGGAATCAGGATTAGAAAGG + Intronic
1083874824 11:65516696-65516718 AGAGAGAAGCTGGGGTAGGTTGG + Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084394448 11:68899531-68899553 AGAGACAAGGAGGACAAGGAAGG + Intronic
1085526711 11:77168147-77168169 AGAGAGAAGAACGGGTAGGAGGG - Intronic
1085699459 11:78733347-78733369 AGACAGAACTAGGACTAGGAGGG - Intronic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085916666 11:80897498-80897520 AGAGAGAATCCAGATTAGAATGG - Intergenic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086398881 11:86444503-86444525 AGAGAGAAGCAAGATTTCCATGG + Intronic
1086912662 11:92491102-92491124 AGAGAAAAATGGGATTAGGAAGG + Intronic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087394641 11:97582059-97582081 TGAAAGAAGCATGACTAGGATGG + Intergenic
1087900118 11:103631017-103631039 AGAAAACAGCAGAATTAGGAAGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1089096388 11:115923283-115923305 AGACAGCAGCAGGAGTAGGAGGG + Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089527212 11:119105340-119105362 AGAAAGAAGGAGGACTAGGCTGG + Intronic
1089858021 11:121564224-121564246 AGAGAGAAGCTGGAAGAAGATGG - Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1089948682 11:122505452-122505474 AGAGCCCAGCAGGACTAGGAAGG + Intergenic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090207061 11:124891289-124891311 AAAAAGAAGCAGGGTAAGGAGGG - Exonic
1090547711 11:127783380-127783402 AGAGAGAGTCAGCATTTGGAAGG - Intergenic
1090778202 11:129983688-129983710 GGAGAGGAGAAGGCTTAGGATGG + Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091316698 11:134618895-134618917 AGGAAGCAGCAGGATTAGGGAGG + Intergenic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1093073726 12:14735375-14735397 GGGGAGGAGCAGGATTAAGAAGG - Intergenic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093772882 12:23037890-23037912 AGAGAGGAGCAAACTTAGGAAGG - Intergenic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094216484 12:27948129-27948151 AGAGATAAGCAGGATAAAGAGGG - Intergenic
1094450707 12:30580417-30580439 AGAGAACAGCAGGAGAAGGAAGG + Intergenic
1095108878 12:38268867-38268889 AGAGAGAGGGAGGATGAGAATGG + Intergenic
1095133385 12:38569035-38569057 AGAAGGAAGGAGGATTAGGCAGG - Intergenic
1095236653 12:39804834-39804856 AAAGAGAAGCAGGGTAAGTAGGG + Intronic
1095897966 12:47299781-47299803 AGAAAGAAGGAGGAAAAGGAGGG + Intergenic
1096464254 12:51839482-51839504 ACACAGAAGAAGGATTAGGAAGG - Intergenic
1096519336 12:52175440-52175462 AGAGAGACAGAGGATCAGGAGGG - Intronic
1096571985 12:52528804-52528826 GGAGAGAAGCAGGGAGAGGAGGG - Intergenic
1096789915 12:54038220-54038242 AGAGAGAATAAGGAGTGGGAAGG - Intronic
1096814527 12:54193519-54193541 AGAGAGGAGCAGGAATAGGCTGG + Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097158907 12:57031866-57031888 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1097159377 12:57035580-57035602 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098168738 12:67723961-67723983 TGAGAGATACAGGATTAGGACGG + Intergenic
1098469378 12:70826129-70826151 AGAAAGAAGGAGGATAGGGAGGG + Intronic
1099541983 12:83922789-83922811 AGGGAGAAACAGGAATAGTAAGG - Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099717365 12:86312516-86312538 AGAGCGAAGCTGGCTAAGGAAGG - Intronic
1099938399 12:89155684-89155706 AGAGAGAAGAAGAAATAGAAAGG + Intergenic
1100245101 12:92749813-92749835 AGTGGGATGCAGCATTAGGATGG - Intronic
1101711974 12:107275968-107275990 AGACAGAATCAGAATTAGGCTGG + Intergenic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1103204763 12:119119983-119120005 AGAGAGGAGGAGGATTAGCTAGG + Intronic
1103374548 12:120445746-120445768 AGAGAGAAACAGGCTAACGAAGG + Intronic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1104758123 12:131281475-131281497 AGAGAGATGCAGGCTTTGGGAGG + Intergenic
1104900842 12:132188854-132188876 GGAGAGGAGCAGGAGCAGGAGGG + Intergenic
1105032055 12:132890874-132890896 GGAGAGAAGGAGGATTTGGGAGG - Intronic
1105644806 13:22305286-22305308 AAAGAGAAGAATGCTTAGGATGG + Intergenic
1105657872 13:22459782-22459804 AGAGAGCAACAGGATTGGAAGGG - Intergenic
1105675529 13:22667873-22667895 AGATGGAAGCAGGGGTAGGAAGG - Intergenic
1106097356 13:26659845-26659867 GGAGAGAAGCAGGCTTATGAGGG + Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106579187 13:31003129-31003151 TGAGTGAAGCAGGATTTGGGTGG - Intergenic
1106622700 13:31386308-31386330 AGAGAGAGGCAGGAGAAGGGAGG - Intergenic
1106671932 13:31915292-31915314 TGAGAAAAGCAGTATTTGGAAGG + Intergenic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1106871812 13:34029806-34029828 AGAGGGTAGCAGGAGTAGTAGGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107401090 13:40069965-40069987 AGAAAGAAGCATGATGAGGTGGG + Intergenic
1107408966 13:40141027-40141049 AGAGAGAAGCAAGGATAGAATGG - Intergenic
1108136736 13:47371772-47371794 AGAGAAAAGGAAGATTAGGGAGG + Intergenic
1108475019 13:50807402-50807424 TGAGAGAAGCAGGAGGAGGGAGG - Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108868151 13:54947337-54947359 TGAGAGAAGCAGTGGTAGGAAGG - Intergenic
1110172455 13:72518203-72518225 AGTTAGTAGCAGGATCAGGATGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110509475 13:76332606-76332628 GGAGAGAAGAAGGGATAGGAGGG - Intergenic
1110666160 13:78119496-78119518 AGAGAGGAGGAGGACAAGGAGGG - Intergenic
1112636390 13:101222382-101222404 AAAGAGAGGCGGGATTAGGTGGG - Intronic
1112729166 13:102340354-102340376 AAAGAGAAGCAAGATTATTATGG - Intronic
1113020225 13:105876867-105876889 AGTGAGAAGCAAGAGTAGCAAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113405779 13:110038304-110038326 AGAGAGAACAAGAATTAGCAGGG - Intergenic
1113562238 13:111291123-111291145 TGATAGAAGCAGGAGTAGGGAGG + Intronic
1115486463 14:33915586-33915608 AGATGGAAGCAACATTAGGATGG + Intergenic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1115786914 14:36836924-36836946 ATAGAGGAGTAGGATTAGGAGGG + Intronic
1116930925 14:50689721-50689743 AGAGAGAAAAAGGATAATGAGGG - Intergenic
1117326983 14:54678374-54678396 AGAAAACAGCAGAATTAGGAAGG - Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1118765943 14:68909407-68909429 AGAGAGAAGAAGGAGCAGGCTGG + Intronic
1118959224 14:70513576-70513598 AGAGAGGAACAGGGTAAGGAAGG + Intergenic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119906522 14:78308449-78308471 AGAGAAAAGCAGGCTTTGCAGGG - Intronic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120758860 14:88268484-88268506 AGAGAGAAGCCAGATTAAAAAGG + Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1120972254 14:90217480-90217502 AGAGACTAATAGGATTAGGAAGG + Intergenic
1121005011 14:90484518-90484540 AGAGAGAGGTAGGAATGGGAAGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121281147 14:92699439-92699461 AGAGAGAAGCAGGGTCATTATGG + Intergenic
1121554298 14:94824595-94824617 TGAGGGGAGCAGGGTTAGGAGGG + Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1125355126 15:38809465-38809487 ACAGAGAAGAAGGATCAGAAAGG - Intergenic
1125542022 15:40475085-40475107 AGAGAGAAGAAGGAATAGGAAGG + Intergenic
1125802502 15:42462681-42462703 AGAGAGAAATAGGATTTAGAGGG + Intronic
1125911677 15:43445389-43445411 AGAGAGAAGGAGAACTAGGAGGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1126753091 15:51897395-51897417 AGAGAAAAGCAGGCACAGGATGG - Intronic
1126903799 15:53342956-53342978 CCAGGGAAGCAGAATTAGGAAGG + Intergenic
1127136689 15:55931316-55931338 AGTGGGTAGCAGGAATAGGAGGG + Intronic
1127452440 15:59130516-59130538 TGACAGAAGCAGGTTTAAGAAGG - Intergenic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128340156 15:66816943-66816965 AGAGAGAATCAGGACTGGAAAGG + Intergenic
1128349417 15:66879078-66879100 AGAGAAAAGCAGGACTCAGAAGG - Intergenic
1129415551 15:75375816-75375838 CGAGAGCAGCAGGAAAAGGAAGG - Exonic
1129459586 15:75693821-75693843 AGAGAGAAGCGGGGATAGGTGGG - Intronic
1129484720 15:75858965-75858987 AGAAAGAAGCAGGTTTACAAAGG - Intronic
1129600232 15:76994499-76994521 AGAGAGAAACAGGATTATCAAGG - Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1130264826 15:82390956-82390978 AGAAAGAAGCAGGTTTACAAAGG - Intergenic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130417410 15:83706611-83706633 AAAGAGAATCAGGATTTGGTTGG - Intronic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130647308 15:85740615-85740637 AAACAGAAGCTGTATTAGGAAGG - Intronic
1131163679 15:90126961-90126983 AGAGAGCAGCAGCCTTAGGAAGG + Intergenic
1131347444 15:91663574-91663596 AGACAGAAGCAGCATTAACAGGG - Intergenic
1131746698 15:95456359-95456381 AGAGTGAATAGGGATTAGGAAGG - Intergenic
1132032022 15:98446165-98446187 AGAGTGAACCAGGATGAGGTGGG - Intronic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1132427695 15:101733133-101733155 AGAAAGAAGCAGGTTTACAAAGG + Intergenic
1132545068 16:529138-529160 AGACAGAAGCAGGAAAAAGAGGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133429722 16:5726028-5726050 AGAGAGAAGCAGGATTCTTTGGG - Intergenic
1135256874 16:20948216-20948238 AGAGAGAACGATGATTAAGATGG - Intronic
1135711742 16:24723107-24723129 AGAGAGAAACAGGATGAGTGTGG - Intergenic
1135968189 16:27052747-27052769 GGACAGAAGCAGGATTTGGAGGG - Intergenic
1136507010 16:30710967-30710989 AGACAGAAGCAAGATTAATAGGG - Intronic
1136620160 16:31423288-31423310 GGAGGGAAGTAGGATTTGGAAGG + Intronic
1136620471 16:31425051-31425073 AGAGAGAAACAGGCTTAGAGAGG - Intronic
1137378996 16:47980586-47980608 AGAGAGGAGCAGAGTTAGGAAGG - Intergenic
1137968377 16:52959207-52959229 AGAAAGAAGGAGGAATAAGAAGG - Intergenic
1138006557 16:53342915-53342937 AGACAGGACCAGGATCAGGAAGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1138954917 16:61959509-61959531 AGAGAGAGGGAGGATAAGGCAGG - Intronic
1138956470 16:61976672-61976694 AGAAAGAAACAGTATTAAGAAGG + Intronic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139070298 16:63372195-63372217 AGAGAGAGAGAGTATTAGGATGG - Intergenic
1139191691 16:64871220-64871242 AGAGAGGAGGAAGAATAGGAAGG + Intergenic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1140828443 16:78728930-78728952 GGAGAGATAGAGGATTAGGATGG + Intronic
1140916730 16:79500513-79500535 AGAGAGAAGAAGGAGTAGGATGG - Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141294137 16:82751047-82751069 AGAGAAAAGAAAGATCAGGAAGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1143197988 17:5091110-5091132 AGAGAGAAGTAGGAAATGGATGG - Intronic
1143255905 17:5557963-5557985 AGAGAGGAGCAGGGGTAGGGGGG + Intronic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143457622 17:7078124-7078146 AGAGAGTGTCAGGATGAGGAGGG + Intronic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143987749 17:10929793-10929815 GGAGAGAGGCAGGTTTGGGAGGG + Intergenic
1144006606 17:11106082-11106104 TGAGTGAAACAGGATGAGGAGGG - Intergenic
1144811177 17:17999895-17999917 ACAGAGATACAGGAGTAGGAGGG - Intronic
1144898794 17:18564187-18564209 GGGGAGAAGTAGGATTGGGAAGG - Intergenic
1145133581 17:20381536-20381558 GGGGAGAAGTAGGATTGGGAAGG + Intergenic
1146054654 17:29575043-29575065 AGAGAGGACCAGGAGTGGGAGGG - Intronic
1146832438 17:36081647-36081669 GGAGAGAAGCAGGACTTGGAGGG - Intergenic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147384648 17:40074158-40074180 AGAGAGAGGCAGGGGTAAGAAGG - Intronic
1149001329 17:51760560-51760582 AGAGAAATGCAGGAAAAGGAGGG + Intronic
1149306662 17:55354173-55354195 AGATAGAAACTGGATGAGGAGGG + Intergenic
1150057631 17:62033368-62033390 AGAGGGAAGCATGCTTAGGATGG - Intronic
1150072124 17:62160050-62160072 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151823330 17:76509100-76509122 TGGGAGAGGGAGGATTAGGAAGG + Intergenic
1151825058 17:76519402-76519424 CGGGAGAGGGAGGATTAGGAAGG - Intergenic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152499937 17:80701103-80701125 AGAGGGGAGCAAGCTTAGGAGGG + Intronic
1153055277 18:939688-939710 AGAGAAAAGCAGGCCCAGGAAGG + Intergenic
1153576546 18:6527513-6527535 GAAGGGAAGCAGGAATAGGAGGG + Intronic
1154031379 18:10756769-10756791 GGAGAGATGAAAGATTAGGAGGG + Intronic
1155000274 18:21679257-21679279 AGAAAGAAGCAGGATTATCAAGG + Intronic
1155157722 18:23171418-23171440 AGAGTGATGGAGGATAAGGAGGG + Intronic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156488477 18:37481766-37481788 AGAGAGAACCAGGATGACCATGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156698009 18:39791269-39791291 AGAGAGAAGCAGCATCTAGAAGG - Intergenic
1156789976 18:40959795-40959817 AGAGTGAAGCAGGAATTGGCCGG - Intergenic
1157046002 18:44102698-44102720 AGAGAGTAGCAGCATATGGAAGG + Intergenic
1157431153 18:47627582-47627604 AGGGAGAAGTCGGATCAGGAGGG - Intergenic
1158639542 18:59191871-59191893 TAAGAGAAGCAGGATAAGAAAGG - Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159482224 18:69004293-69004315 AGGGAGAAGTAGGACTGGGAGGG + Intronic
1160116801 18:76086043-76086065 AGAGGTAAGCAGAATTAGAAGGG - Intergenic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161939665 19:7394777-7394799 GGAGAGCAGCAGGGTTAGGTGGG - Intronic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162600819 19:11667203-11667225 AGAGAGAAGAAGCACTAGGGTGG - Intergenic
1162826084 19:13253107-13253129 GGAAAGAAGCAGGAGTAGCAGGG + Intronic
1163758192 19:19119491-19119513 AGAGAGGAGCAGGACTGAGAGGG - Intronic
1164234901 19:23323370-23323392 AGAGAGTAGGAGGAAGAGGAAGG - Intronic
1164500518 19:28815566-28815588 AGAGATGAGCAGGAATAGAAGGG - Intergenic
1164769107 19:30794741-30794763 AGAGAGGAGAAGAGTTAGGAGGG - Intergenic
1165323248 19:35099183-35099205 GGTGAGAGGTAGGATTAGGAAGG - Intergenic
1165948159 19:39457848-39457870 AGAAAGAAGCAAGGTGAGGACGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166151907 19:40880982-40881004 AGAGAGATGGAGGAAGAGGATGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1166694921 19:44846855-44846877 ACAGACAAGCAGGCGTAGGATGG - Intronic
1166750077 19:45160358-45160380 AGTGAGGGGCAGGATAAGGAGGG + Intronic
1167689910 19:50978930-50978952 AGAGAGAAGCAAGAGAAAGAGGG + Intronic
1167769986 19:51509013-51509035 GGGGACAAGCAGGATTAGGACGG - Intergenic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168565121 19:57416117-57416139 AGAAAGAAACAGGATTGGGTTGG + Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925704826 2:6674381-6674403 AGGGAGATGCAGCATTGGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
926975736 2:18515104-18515126 AGACAGAAGCAGGCCTGGGAAGG - Intergenic
927069193 2:19507960-19507982 TCAGAGAAGAAGGAATAGGATGG + Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928098059 2:28417576-28417598 AGAAGGAAACAGGATCAGGAGGG - Intergenic
928232063 2:29506765-29506787 AAAGTTAAGCAGGATTTGGATGG + Intronic
929058747 2:37901952-37901974 AGAGAGAAGGAGGTTTGGAATGG - Intergenic
929351835 2:40965644-40965666 AAAGAGAATCAGGATTAGGGAGG - Intergenic
929352289 2:40971862-40971884 AGAGAGAATCAGGGTTACCATGG + Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
929998653 2:46846417-46846439 AGGGAGAAGCAGGCATAAGAGGG + Intronic
931078849 2:58746244-58746266 AGAGACAATCACTATTAGGAAGG - Intergenic
931916980 2:66967113-66967135 TGACAGAAGTAGGAGTAGGAGGG - Intergenic
932193361 2:69760356-69760378 AGAGAGAGGGAGGAGAAGGATGG + Intronic
932871575 2:75405230-75405252 AGAGAGAAGGAGATTTATGATGG - Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934754067 2:96813177-96813199 AGAGAGAAGCAGGAATTAGCCGG + Intergenic
935306572 2:101742450-101742472 AGAGAGAAGCAAGCTAAGGGCGG - Intronic
935499087 2:103816356-103816378 GGAGAGAAGTAGGATCAGGGAGG + Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936619730 2:114082916-114082938 AGAGTGAGGCAGGATTTGGCTGG - Intergenic
936850677 2:116894654-116894676 AGACAGAAGCAGGACTAGCTAGG + Intergenic
936937235 2:117850179-117850201 GGATAGAAGCAGGATCAGGTGGG - Intergenic
937025019 2:118690594-118690616 AGAAAGAAGGAAGAGTAGGAGGG + Intergenic
937259508 2:120576642-120576664 ACAGAGACACAGGATTAGGAAGG + Intergenic
937498280 2:122449383-122449405 AAAGAGAAGAAGGATCAAGATGG + Intergenic
937689725 2:124741814-124741836 AGAGAGAATAAGGAGGAGGAGGG - Intronic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938377430 2:130817840-130817862 GGAGAGAAATAAGATTAGGAAGG + Intergenic
938579774 2:132635545-132635567 AGAGAGAAGGAGGAAAAGCAGGG + Intronic
939023462 2:136985197-136985219 AGAGATTAGCAGGATTGGAAGGG + Intronic
939031881 2:137086440-137086462 AGACAGAAGCAGGAGTTGGAGGG - Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
941812271 2:169767045-169767067 AGAGTGGAGCAGGGTCAGGATGG + Intronic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
942895763 2:181052337-181052359 AGAGAAAAAGAGGATGAGGAAGG - Intronic
943072934 2:183163463-183163485 AGAGATAAAAAGGATTAGTAGGG + Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943617919 2:190115210-190115232 AGAGAGAAGGAGAAGTAGAAAGG + Intronic
943749563 2:191497134-191497156 AGTGAGGAGCAGGATTATGTGGG + Intergenic
944656475 2:201881008-201881030 AGAGAAAAGAAAGCTTAGGAGGG + Intronic
945486758 2:210406212-210406234 TGACAGAAGCAGGTTTTGGAAGG - Intergenic
945906446 2:215599037-215599059 AGAGAGAAGAATGTTTAAGAAGG - Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946112862 2:217435565-217435587 AGAAAGAAGCAAGACTAGGATGG + Intronic
946168486 2:217879630-217879652 AGAGAGAAGTGGGATGAGGGAGG - Intronic
946217682 2:218198276-218198298 GGAGAGAAGCGGGAGGAGGAAGG + Intergenic
946774639 2:223124869-223124891 TGAGGGAAGCAGGATTGGGCTGG + Intronic
947165216 2:227254940-227254962 AGAGAGAAGCAGAAGTGAGATGG - Intronic
947229709 2:227872561-227872583 AGGAAGCAGCAGGATTGGGATGG - Intronic
947324095 2:228955824-228955846 AGAGAAAAGGAGGCTGAGGATGG + Intronic
948452332 2:238083824-238083846 AGAGAGAAACAGGAACAGCATGG + Intronic
948898985 2:240946609-240946631 AGAGAGAAGCAGGATTCTGAGGG - Intronic
948970596 2:241422635-241422657 TGACAGAAGCAGGCTTTGGAAGG + Intronic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170336743 20:15278463-15278485 AGTGAAAAGCAGGACTGGGAGGG - Intronic
1170667112 20:18395722-18395744 TGAGAGAAGCAGGTCAAGGAAGG - Intronic
1170789345 20:19494948-19494970 TGAGAGAAACAGGATCAGGCAGG + Intronic
1170889696 20:20367473-20367495 AGAGAGCAGCAGGGTCCGGACGG - Intergenic
1170917377 20:20640466-20640488 TGATGGAAGCAGGAATAGGAGGG - Intronic
1171142301 20:22753825-22753847 AGAGGGAAGGAGGATAAGCAGGG + Intergenic
1172808301 20:37629215-37629237 AGAGGGAAGCAGGAGAGGGAAGG + Intergenic
1172819801 20:37721656-37721678 AGAGAGAAACTGGATTAGAGAGG - Intronic
1172882119 20:38208876-38208898 AGAGGGAAGCAGGACTGGAAGGG + Intergenic
1172940289 20:38649380-38649402 AGAGTGAAGGAGGATAGGGAAGG + Intronic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173845976 20:46189067-46189089 AGAGAGAAACAGAGATAGGAAGG + Intronic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175523511 20:59618197-59618219 AGAGAGAAGCAGGAGTATGGCGG + Intronic
1175613439 20:60371756-60371778 AGAAAGAACCAGGATTTGGGGGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1177702601 21:24657852-24657874 GGAGAGAATCAGTTTTAGGAAGG - Intergenic
1178166875 21:29988568-29988590 TCAGAGCAGCAGGAATAGGAGGG + Intergenic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178446553 21:32648859-32648881 AGAGAGAAGTAGGTGTGGGATGG - Intronic
1178755728 21:35347598-35347620 AGAGAAGATCAGGATAAGGAGGG - Intronic
1180699003 22:17771720-17771742 AGAGAAAAGGAGGAAGAGGAAGG + Intronic
1180868786 22:19134494-19134516 TGAGAGAGGCAGGGTTAGGTGGG + Intronic
1180965466 22:19785970-19785992 AGAGAGGAACAGGACCAGGAGGG + Exonic
1181100509 22:20535847-20535869 AGAAAGAAGCAGGCTGAGCACGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182108616 22:27706825-27706847 AGACAGAAGCCGGAATATGAAGG + Intergenic
1183324061 22:37182006-37182028 AGAGAGGAGCAGAAATAGGCTGG + Exonic
1184266437 22:43349399-43349421 TGAGAGAAGCAGGCTTGGGCAGG - Intergenic
1184899014 22:47432663-47432685 AAAGAGAAGAAGGAAAAGGAAGG + Intergenic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
1185192932 22:49450212-49450234 AGAGAAATGCAGGATCAGGGCGG + Intronic
949916036 3:8965402-8965424 AGCGAGAAGCCAGAATAGGATGG + Intergenic
950623184 3:14224366-14224388 TGAAAGAAGCAGTATCAGGAGGG + Intergenic
950837769 3:15936866-15936888 AGAGGGGAGTAGGAATAGGAAGG + Intergenic
950881356 3:16325351-16325373 AGGGAGGTGGAGGATTAGGAAGG + Intronic
951024043 3:17811666-17811688 AGAAAGAAACAAGATCAGGAAGG + Intronic
951298921 3:20971678-20971700 AGAAAGAAGGAGGATTTGGGAGG + Intergenic
952135972 3:30420092-30420114 AGAGAGAAGTAGGGTGATGATGG + Intergenic
953010003 3:39016075-39016097 TGAGAGAAGCAGGGTAGGGAAGG + Intergenic
953358538 3:42275143-42275165 AGGGAGAAGAGGGAATAGGAAGG + Intergenic
953411470 3:42692746-42692768 AAAGAGAAGCCGGAGTAGGAGGG - Exonic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953701251 3:45197758-45197780 AAAGAGAAGCTGGGTTGGGATGG - Intergenic
953801122 3:46023273-46023295 AGACAGCAGCAGCCTTAGGAAGG - Intronic
953823997 3:46234174-46234196 TGAGAAATGCTGGATTAGGAAGG + Intronic
954518021 3:51197624-51197646 AGAGTGAAGCTGGACTAGGTAGG + Intronic
955452731 3:59087342-59087364 AGAGAGAAGTTGGATTTGGGTGG + Intergenic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955584457 3:60461769-60461791 AGTCAGAGGCAGGATAAGGATGG + Intronic
955946912 3:64204220-64204242 AGAAAGAAGCAGGATATGGGAGG + Intronic
956324172 3:68032648-68032670 AGAGAGAAGGAGGAGTGGGAAGG - Intronic
956702653 3:71972307-71972329 TGAGGGAAGCAGGATCAGGCAGG - Intergenic
956778717 3:72587721-72587743 AGAGGGAAGCAGGACTGGGAGGG + Intergenic
957006896 3:74959208-74959230 AGAGAGAGGAAGGAATAGCAGGG + Intergenic
957515184 3:81240811-81240833 AGAGAGAAGCAAGGAAAGGAGGG + Intergenic
957729634 3:84117097-84117119 AGAGAGAATAAGGATGAAGAAGG - Intergenic
958270900 3:91497972-91497994 ATAGAGAAGCGTGATTAAGAGGG + Intergenic
958600519 3:96290252-96290274 TGAGAGAAGCAGGATACAGAAGG - Intergenic
959246409 3:103875304-103875326 AGAGAGATGCAGAATTACGTGGG + Intergenic
960447200 3:117763128-117763150 AGAGAGAAGGAGGAGAAAGAGGG + Intergenic
960951299 3:123000275-123000297 AGAGAGGAGCTGGACTGGGAAGG + Intronic
961137369 3:124524287-124524309 AGAGAAAAGTGGGATGAGGAAGG + Intronic
961239440 3:125397622-125397644 GGAGAGCAGCAGGAAGAGGAAGG + Intergenic
963015696 3:140821910-140821932 AGAGAGAAGGAAGGCTAGGAGGG + Intergenic
963091159 3:141485394-141485416 AAACAGAAACAGGTTTAGGAAGG + Intergenic
963652943 3:148006989-148007011 AGAAAGAAGGAGGAAGAGGAAGG - Intergenic
964309005 3:155372331-155372353 ATAGACAAGCAAGAATAGGAAGG + Intergenic
964544697 3:157821036-157821058 AGAGAGAAGCAGCTTTGAGAAGG - Intergenic
965046237 3:163581661-163581683 AGAGAGAAAGAGAATTAAGAGGG + Intergenic
965619988 3:170633697-170633719 AGAGAGCAGCAGGTTGAGGGTGG - Intronic
965788397 3:172361183-172361205 AGAGATTAGCAGGATTAAAAGGG - Intronic
965852873 3:173051754-173051776 AGAGAGAAACAAGGATAGGAAGG - Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966350688 3:179030841-179030863 AGGGTGAAGCAGCATTAGGGTGG - Intronic
966552675 3:181222582-181222604 AGAGAGTGACAGGATTAGGTTGG + Intergenic
967217002 3:187219372-187219394 TGAGAGAAGCAGGGACAGGAGGG - Intronic
967374707 3:188787983-188788005 AGAGAGGAGCAGGTTTAAAAGGG - Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970307001 4:14743522-14743544 AGAGATAAGGAGTGTTAGGATGG - Intergenic
970441792 4:16086312-16086334 AGAGAGGAGCATTTTTAGGAGGG - Intergenic
970471491 4:16383965-16383987 AGAGAGAAGTAGCTCTAGGAGGG + Intergenic
970839164 4:20446428-20446450 AGAGAGAAGCAGCAATAGTAGGG + Intronic
970894535 4:21086954-21086976 AGAGAGAGGAAGGAAAAGGAAGG - Intronic
971172799 4:24250608-24250630 AGAGAAAAGAAGGAAGAGGAAGG + Intergenic
971394419 4:26215153-26215175 GGAGAGAAGGAGGATAGGGAAGG + Intronic
971422801 4:26489489-26489511 AGAGAGAAACAGGAGCAAGACGG + Intronic
972427610 4:38948911-38948933 AGAGAGAAAAAGGATAAAGATGG - Intergenic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973573004 4:52259212-52259234 AGAAAGAGGCAAGATAAGGATGG - Intergenic
973667368 4:53176651-53176673 AGACAGAAACAGGTTTTGGATGG + Intronic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
975671573 4:76786180-76786202 AGAGAGACGCATGTGTAGGAAGG + Intergenic
975937970 4:79604739-79604761 AGAGAAAAGAAGAGTTAGGAAGG - Intergenic
976293812 4:83449379-83449401 AGAGAGAAGCAGGGGAAGGAGGG + Intronic
976727099 4:88225435-88225457 AGAGTGAAGCATGATGAGGTTGG + Intronic
977141874 4:93383606-93383628 GGAGAGAAACAAGATTAGAAAGG - Intronic
977320823 4:95513674-95513696 AGAGAGAAACAGGTGAAGGAGGG + Intronic
977389598 4:96390968-96390990 AGAGACAAACTGGATTAGCATGG + Intergenic
977397008 4:96483996-96484018 AGAGGGAAGGAGGAGTAGGAAGG - Intergenic
977776898 4:100931443-100931465 ATAGGGAAGCAGGATTAATAAGG + Intergenic
978018116 4:103773823-103773845 AGATAGATGAAGGAGTAGGAGGG - Intergenic
978198185 4:105994726-105994748 AGAGAGAAGCAGTATAATCATGG - Intronic
978361343 4:107933420-107933442 AGGTAGAAGCAGTATTACGAAGG + Intronic
978836432 4:113155361-113155383 TGATAGAACCAGGATTAGAAAGG + Intronic
979213544 4:118135246-118135268 GAAGAGAAGCAGGCTTAGGAAGG + Intronic
979431806 4:120641624-120641646 TGAGAGAAACAGGATAAGGCAGG + Intergenic
979584842 4:122403800-122403822 AGATAGAAGCAGGGTTAGGTGGG + Intronic
979602782 4:122604504-122604526 TGAGAAAAGCAGGATAGGGAAGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
981594113 4:146399761-146399783 AGAAAGAAGCAGTTTAAGGATGG + Intronic
981798422 4:148627112-148627134 ACATAGAAGCAGGAGTAGAATGG + Intergenic
983575777 4:169260305-169260327 CCAGAGAAGCAGTTTTAGGAAGG + Intronic
983577544 4:169274682-169274704 ACAGAGAGGCTGGTTTAGGACGG - Intergenic
984249640 4:177316577-177316599 AGAGTCAAGCAGGATGGGGATGG + Intronic
985670110 5:1202599-1202621 AGAAAGCAGCAGGTTTATGAGGG - Intronic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986124095 5:4869397-4869419 AGAGAAAAGCAGGAAGAGCAAGG + Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986418488 5:7552343-7552365 AGTGAGAAGCAGTATTTTGATGG + Intronic
986653663 5:9989602-9989624 AGAGAGGATCAGTTTTAGGAAGG + Intergenic
987067458 5:14303579-14303601 AGATTGAACCAGGATTGGGATGG + Intronic
987389927 5:17366356-17366378 AGAGGAAAGCAAGATTAGTAAGG + Intergenic
987518601 5:18948261-18948283 AAAGAGAAGAAGGAGAAGGAAGG + Intergenic
987813888 5:22875536-22875558 AGAGGGAAGGGGGATAAGGAAGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988852623 5:35194435-35194457 AGATAGAAGCAAGAGCAGGAAGG - Intronic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
989188462 5:38646854-38646876 TGAGGGAAGCAGGATTGGAAAGG + Intergenic
989763417 5:45048929-45048951 AGAGAGAAAGACGATTAGCAGGG - Intergenic
990355194 5:54960102-54960124 GGAAAGAAGCAGGATTGGGCGGG + Intergenic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991433562 5:66573280-66573302 AGAGAGAAAGAGGAAGAGGACGG + Intergenic
991631181 5:68657649-68657671 ACAGTGAAGCAGGATTTGGATGG - Intergenic
992095562 5:73359416-73359438 AGAGAGTATGAGGAATAGGAAGG - Intergenic
993010862 5:82480705-82480727 AGAGAGGGGCAGGATTAGGTGGG + Intergenic
994011451 5:94907798-94907820 AGAGAGAAGAAGGGATATGAAGG + Intronic
994314501 5:98316608-98316630 GGAGAGAAGCAGAATTAGGCAGG + Intergenic
994367684 5:98934059-98934081 GGAGAGAAGTAGAATTGGGAAGG + Intergenic
994530748 5:100967246-100967268 AGAAAGAACCTGAATTAGGATGG - Intergenic
994926804 5:106126507-106126529 AAACAGAAGCTGGGTTAGGAAGG - Intergenic
994930466 5:106176480-106176502 AAAGAGAAGCAAGATTGGCACGG - Intergenic
995008665 5:107232591-107232613 AGACAGAAACCAGATTAGGAGGG + Intergenic
995295784 5:110520057-110520079 AGAGAGAGAGAGGATTAGGTAGG + Intronic
996409915 5:123146786-123146808 AGAGAAAAGCCAGAATAGGAGGG + Intronic
996539448 5:124613712-124613734 AGATAGAAAAAGGAATAGGAAGG + Intergenic
997632265 5:135377837-135377859 TGGGAGAAGCAGGATTAAGCAGG - Intronic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998049096 5:139016491-139016513 AGAGAGAAGGAGGACAAGGCTGG + Intronic
1000892901 5:166820043-166820065 AGAGAGAAGAATGATAGGGAAGG - Intergenic
1001409251 5:171498534-171498556 AGAGAGAAGCAAGACAAGAAGGG - Intergenic
1001511093 5:172322455-172322477 AGAAAGAAGAAGGAAGAGGAGGG - Intergenic
1001514347 5:172345004-172345026 AGAGAGAAGGAGGGAAAGGAGGG + Intronic
1002056271 5:176599533-176599555 GGAGAGAAGCAGGTTGGGGAGGG + Exonic
1002255198 5:177953350-177953372 GGAGAGAAGCAGGTAGAGGAGGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002482938 5:179515384-179515406 GGAGAGAAGCAGGTAGAGGAGGG + Intergenic
1002548248 5:179967155-179967177 TGAGAGAAGAAGGAGTAGGTAGG - Intronic
1003083493 6:3041793-3041815 ACAGAGTAACAGGATTAGGTAGG + Intergenic
1003366086 6:5476197-5476219 GGAGAGAACCAGGATATGGATGG + Intronic
1004077782 6:12361048-12361070 AGAAAGAAGGAGGAGTAGGTAGG + Intergenic
1004563836 6:16777171-16777193 AGAGAGGATTAGGATTAGAATGG + Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004785589 6:18964118-18964140 AGAGAGAATCAGGATATGGTGGG - Intergenic
1005009375 6:21321560-21321582 AGAAAGTAGCAGAATCAGGAAGG + Intergenic
1005580086 6:27225570-27225592 AGAGAGAAGAAAGAGAAGGAAGG - Intergenic
1006073782 6:31516259-31516281 AGAGAGGGGCAGGATCTGGATGG - Intergenic
1006080872 6:31565671-31565693 GGAGAGAAGCAGGATTCTGATGG - Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007616335 6:43181899-43181921 TGGGAGAGGGAGGATTAGGAGGG + Intergenic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1008467471 6:51846861-51846883 AGAGAGAGGCTGAATTAAGACGG - Intronic
1008984244 6:57523360-57523382 ATAGAGAAGCGTGATTAAGAGGG - Intronic
1009051379 6:58280722-58280744 AGAAAGAAGGAGAATTGGGAAGG + Intergenic
1009172297 6:60416238-60416260 ATAGAGAAGCGTGATTAAGAGGG - Intergenic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1010072112 6:71755575-71755597 AGGAAGAAGCAGGATAAGCAGGG - Intergenic
1010275566 6:73965015-73965037 TCAGAGATGCAGTATTAGGAAGG + Intergenic
1010635577 6:78255818-78255840 TGAGGGAAGCAGGAAAAGGAAGG - Intergenic
1012277983 6:97296766-97296788 ATAGAAAAGCAGGTTTAGGCTGG + Intergenic
1012907558 6:105085767-105085789 AGAGAGAGAGAGGATTAGAAAGG - Intergenic
1013128264 6:107206799-107206821 ACAGAGGACCAGGATTTGGAAGG - Intronic
1013673652 6:112433248-112433270 AGAGAGAAGAAGCATGAGCAAGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1013899642 6:115139274-115139296 ACAGAGAAGAAGGATAAAGAGGG + Intergenic
1014038257 6:116793120-116793142 GGAGAGAATCAGGAGTAGGATGG + Exonic
1014081572 6:117292517-117292539 AGAGAGCAGCCGGTATAGGAGGG - Intronic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1015217646 6:130768275-130768297 AGAGGGAAGAAGGATTAAGGAGG - Intergenic
1015486362 6:133774581-133774603 AGATAGAAGCAAGATTCTGAGGG + Intergenic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1016052533 6:139544923-139544945 AGAAAGGAGCTGGATTAGCATGG - Intergenic
1016168501 6:140977742-140977764 AAAGCAATGCAGGATTAGGAGGG - Intergenic
1017215614 6:151902384-151902406 AGAGAGAAACAGATCTAGGATGG - Intronic
1017424996 6:154311260-154311282 AGAGAAAAAGAGTATTAGGATGG - Intronic
1017549048 6:155484523-155484545 AGACAGAAGCAGGAATCAGAGGG - Intergenic
1018302760 6:162420769-162420791 AGAGATAAGCAGGAAAAAGATGG + Intronic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019667369 7:2258609-2258631 AGAGAAACGCAGGCCTAGGAAGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1019841509 7:3450808-3450830 AGAGAGAAGAGGGATGAAGATGG + Intronic
1020972414 7:14961772-14961794 AGAAAGAAGCAGGATTGTGTAGG - Intronic
1021279106 7:18694906-18694928 AGAGAAAATGAGGAGTAGGAGGG - Intronic
1021861207 7:24907613-24907635 AGAGAGAAAGTGGGTTAGGAGGG - Intronic
1022052103 7:26686340-26686362 AGAGAGAAGGAGGAAGAGAAAGG + Intronic
1022517717 7:30986682-30986704 AGTGAGGAGCAGGATGAGAAGGG + Intronic
1022549074 7:31219915-31219937 AGAGAAAACCAGGTGTAGGAAGG - Intergenic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023119119 7:36891735-36891757 TGAGAAAAGCAGGCTTAGAACGG + Intronic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023509288 7:40933916-40933938 TGAGAGAAGTAGGCTTCGGAAGG - Intergenic
1023562802 7:41493226-41493248 AGAGAAAGGCAGGACTAGGCTGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024827882 7:53414220-53414242 AGAGAGAAGCTGGAATATGTGGG - Intergenic
1026040456 7:66864055-66864077 AGAAAGAAGCAGGCCTAGGCCGG - Intergenic
1026192713 7:68144156-68144178 AGAGAGAAGCATGTTTTAGAGGG - Intergenic
1026650266 7:72210261-72210283 ATAGAGAAGCTTGATTAGGGTGG - Intronic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1029795839 7:102893788-102893810 AGAAAGGAGAAGGATGAGGAGGG + Intronic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030440036 7:109577857-109577879 AGAAAGAAGGAGGAGAAGGAGGG - Intergenic
1030875620 7:114809883-114809905 AGAGAGAGGGAGGAAAAGGAGGG + Intergenic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031078672 7:117238153-117238175 AGAGACAAGCTGGAGAAGGAGGG - Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031670993 7:124545231-124545253 AGAAAGAAGAAGGATAAGTATGG - Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032847648 7:135765528-135765550 TGAGAGAAGCAGGCTTGGGCAGG - Intergenic
1033314432 7:140285776-140285798 AGAGAGAAGGAGTCTCAGGAAGG - Intergenic
1033347528 7:140537357-140537379 AGTGATAAGTAGGATTAGGTGGG - Intronic
1033490705 7:141840936-141840958 AGACAGAGGCAGGATTGCGAAGG - Intronic
1033656646 7:143380038-143380060 AGAGTGTAGCCGGATTTGGAGGG + Intergenic
1033776008 7:144612789-144612811 AGAGAAAAGCAACATTAGAAGGG - Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034121665 7:148633514-148633536 AGAGATAATGAGGATAAGGAAGG + Intergenic
1034863051 7:154616506-154616528 AGAGAGTTGCTGGTTTAGGAGGG + Intronic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035117835 7:156539753-156539775 AGAGAGAAGGAGGAGGAGGGAGG - Intergenic
1035339452 7:158151134-158151156 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339479 7:158151244-158151266 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339519 7:158151391-158151413 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339529 7:158151428-158151450 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1035339539 7:158151465-158151487 AGGGAGAGGCAGGAATAGAAAGG - Intronic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036730791 8:11262289-11262311 GGAGTGAAGCAGGATAAGGAAGG - Intergenic
1036743795 8:11389968-11389990 AGAGAGAAGCAGGGATGGGTGGG + Intergenic
1037691233 8:21183258-21183280 GGAGAGAAGGAGGAGGAGGAAGG - Intergenic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1037898398 8:22673551-22673573 AGAGAGAAGGAGGGGGAGGAGGG - Intergenic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1039135130 8:34313563-34313585 AGAGAGAAGCAGAAATAAGGAGG + Intergenic
1039300693 8:36205570-36205592 GGAGAGAAGCAGTTTTAGGGAGG + Intergenic
1039436179 8:37560894-37560916 AGAGAGGAGAAGGAGGAGGAGGG - Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041289479 8:56295501-56295523 AGAGAGCAGCAGACCTAGGAAGG - Intergenic
1041603669 8:59754254-59754276 AGAGGGAATCAGCATTTGGAAGG + Intergenic
1041871691 8:62641679-62641701 AGTGAGAGGCAAGATTAGGAAGG + Intronic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1043263578 8:78232529-78232551 AGAGAGGAGCCCGCTTAGGAAGG - Intergenic
1043919675 8:85966611-85966633 AGAGATAAGAAGGATTGGGATGG + Intergenic
1044350764 8:91163548-91163570 TGAGAGAAGTAGGATCAAGATGG - Intronic
1044783722 8:95772327-95772349 AGAGAAAACCATGATTATGAAGG + Intergenic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1046177625 8:110599026-110599048 AGAGAGAGGGAAGATAAGGAGGG - Intergenic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047665764 8:127089400-127089422 ACAGAGAAGCAGGAAAATGAGGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048268221 8:133005942-133005964 AGGGAGAAGATGGAGTAGGAGGG - Intronic
1048523324 8:135177702-135177724 TGAGAAAAGCAGGATTGGCAAGG - Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1049609049 8:143544385-143544407 GGAGAGGAGGAGGATGAGGAGGG - Intergenic
1050418119 9:5435459-5435481 AGAGTGAAGCTGGAGGAGGATGG - Intronic
1050690187 9:8218687-8218709 AGAGGGACGTAGGACTAGGAGGG + Intergenic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051714258 9:19964943-19964965 AGAGAAAATCAGGAGTAGGCTGG - Intergenic
1051794284 9:20847214-20847236 AGAGAGATGAAGGATTGGGAAGG - Intronic
1052066284 9:24024970-24024992 AGAAAGAAGCATAATTAAGACGG + Intergenic
1052109216 9:24559864-24559886 AAAGAGGACCAGGTTTAGGAAGG + Intergenic
1052444424 9:28542069-28542091 GGTAAGAAGCAGGATTAGGAAGG + Intronic
1052553651 9:29985469-29985491 AGTGAGGAGCTAGATTAGGAAGG - Intergenic
1052819086 9:33124784-33124806 TCAGAGAAGCAGGATTTGGGAGG - Intronic
1053008420 9:34619897-34619919 TGAAAGGACCAGGATTAGGAAGG - Intronic
1053450560 9:38190981-38191003 AGAGAGCAGGAGGATTTGAATGG - Intergenic
1054887875 9:70218705-70218727 AGACAAAGGCAGGATTAAGAGGG + Intronic
1055340796 9:75280742-75280764 AGAGGGAGGCAGGATGAGGCTGG - Intergenic
1055636758 9:78286783-78286805 AGAGAGAAGCAAAGTTAGAAAGG + Intergenic
1055713086 9:79086877-79086899 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057112435 9:92486080-92486102 GGAGAGAAGCAGGATAGGGGTGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057526989 9:95811581-95811603 AGAAAGAAGCAGGATTGAGCAGG - Intergenic
1057841088 9:98486055-98486077 GGAGGGAAGCAGGATGAGGCAGG - Intronic
1058619017 9:106863764-106863786 AGAGAGCTGGAGGCTTAGGACGG + Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059085683 9:111300171-111300193 AGAGAGAAGGAGGAAGAGAATGG + Intergenic
1059168828 9:112105068-112105090 AGAGAGAAGCAGAAATAAAAAGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059407270 9:114108926-114108948 AGAGAGATGGAGGCTGAGGAAGG - Intergenic
1059427199 9:114228484-114228506 GGAGAGAAGCCGGATTGGAAGGG - Intronic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1060015431 9:120082521-120082543 AGAGATAAACAGGATGAGTATGG - Intergenic
1060492447 9:124094863-124094885 ACAGAGGAGCATAATTAGGAAGG + Intergenic
1060739125 9:126086391-126086413 AGAGAGAAGCAAAATTAGCCTGG - Intergenic
1060954586 9:127629472-127629494 AGAGAGCAGCAGTGTTGGGAGGG + Intronic
1061309418 9:129752600-129752622 TGAGAGAAGCAGGTTCTGGAGGG - Intronic
1061578393 9:131522167-131522189 AGGGAGCAGAAGGATTTGGAAGG - Exonic
1062158177 9:135065654-135065676 AGAGAGAGGCAGGGTAAGGAAGG - Intergenic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1186600284 X:11029421-11029443 ACAAAGAAGCAGGATTTGGCAGG - Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187215043 X:17267953-17267975 AAAAAGTAGCAGGATTTGGAAGG + Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188981387 X:36730269-36730291 AGAGTGAAGCTGGAGTAGGAGGG - Intergenic
1189653694 X:43218257-43218279 AGAAAGTAGCAGGAGCAGGAAGG + Intergenic
1189762738 X:44339233-44339255 AGAGACACTCAGGATCAGGATGG + Intronic
1189848406 X:45157023-45157045 AGAGAGGAGCTGGAAAAGGAGGG - Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190072879 X:47293264-47293286 AGAGAGAAGAAGGAGGAAGAAGG + Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1191122387 X:56920114-56920136 TGAGAGAAGCAGGCTTCAGAAGG - Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192541342 X:71975731-71975753 AGAGAGAAGCAGGTCCCGGAGGG + Intergenic
1193118777 X:77801392-77801414 ACAGAGAAGTAGGAATAGAAGGG - Intergenic
1193419795 X:81270201-81270223 AGACAGAAACAGGATTCAGAAGG - Intronic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195369623 X:104159981-104160003 TGAGAGAAGCAGGATATGGCTGG - Intergenic
1195577542 X:106468105-106468127 GGAGAGGAGGAGGATTATGAAGG - Intergenic
1195589466 X:106607771-106607793 AAATAGAAGTAGGATTTGGATGG + Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197818740 X:130524729-130524751 AGAGAGAAAGAGGAAGAGGAGGG - Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1198034399 X:132786519-132786541 AGAGAGGAGAACTATTAGGATGG - Intronic
1198575120 X:138002118-138002140 AGAGATAAGTATGATTGGGATGG - Intergenic
1198786417 X:140293210-140293232 AGAGAAAAGCAGAAGTAGGTAGG + Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1200105698 X:153710848-153710870 AGAGGGAAGCAAGATCAAGAAGG - Intronic
1200889939 Y:8312754-8312776 AGAGAGAAGAAGCATTAGCTAGG - Intergenic
1201296449 Y:12467219-12467241 AGAGAGAAGCAGGGTTGGGGTGG - Intergenic
1202375631 Y:24233802-24233824 AGAAAGAAGCAGGCTTACAAAGG + Intergenic
1202495149 Y:25436316-25436338 AGAAAGAAGCAGGCTTACAAAGG - Intergenic