ID: 1156242811

View in Genome Browser
Species Human (GRCh38)
Location 18:35270001-35270023
Sequence CCCACAGTGTTAGCAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156242811 Original CRISPR CCCACAGTGTTAGCAGATAC TGG (reversed) Intronic
900610264 1:3541744-3541766 CCCACAGTGGCAGCAGAGAGTGG + Intronic
902480126 1:16707404-16707426 CCCACAGTGCTGCCAGATCCTGG - Intergenic
903508544 1:23855888-23855910 CTCACACTGTGGGCAGATACTGG + Intronic
906705935 1:47895317-47895339 CACACAGAGTGATCAGATACAGG - Intronic
911754958 1:101543501-101543523 ACCACAGAGATAGTAGATACAGG + Intergenic
917336970 1:173934323-173934345 ACCACAGTGATAGCAGAAGCTGG + Exonic
918590988 1:186240921-186240943 CCCACAGTGTGAGCAGCTACAGG + Intergenic
1064828158 10:19429616-19429638 CCCACAGGCTTAGCAGCAACTGG - Intronic
1065304053 10:24351980-24352002 CCCATTGTGTTAACAGACACCGG - Intronic
1065541414 10:26772811-26772833 CCCAAAGTGTTGGGAGTTACAGG - Intronic
1066428619 10:35332065-35332087 TCCACAGTGTAACCAGCTACAGG - Intronic
1068763557 10:60738009-60738031 CCCACAGGGTTAGGAATTACAGG + Intergenic
1069401143 10:68048176-68048198 CCCAAAGTGTTAGGATTTACAGG + Intronic
1071870937 10:89793807-89793829 CTCACAATGTTAGCAGTTAGCGG - Intergenic
1075868691 10:125751196-125751218 CCCAAAGTGCTGGAAGATACTGG + Intronic
1079668155 11:23134223-23134245 AGCAGAGTGCTAGCAGATACAGG + Intergenic
1080222243 11:29919735-29919757 CCCAAAGTGTTGGGAGTTACAGG - Intergenic
1083736272 11:64683136-64683158 GCCACAGTGTTCTCAGATCCTGG + Intronic
1083935649 11:65868528-65868550 CCCACAGGGTTACCAGCTGCTGG - Exonic
1088112568 11:106278627-106278649 CCAAAAGTGTTAGCTAATACAGG + Intergenic
1088657693 11:112016066-112016088 CCCAAAGTGTTGGGAAATACAGG + Intronic
1092565709 12:9663014-9663036 CCCAGAGGTTTAGCAGATGCTGG + Intergenic
1093238296 12:16639258-16639280 CCCAAAGTGTTAGTATTTACAGG + Intergenic
1095689981 12:45076830-45076852 TCCACAGAGTTAGCAGTTATTGG - Intergenic
1099734505 12:86550645-86550667 ACCACAGTCATAGCGGATACTGG - Intronic
1102774384 12:115506044-115506066 CCCACAGAGGTGGCAGATGCTGG - Intergenic
1102882475 12:116496527-116496549 CCCAAAGTGCTAGTAGTTACAGG - Intergenic
1108098876 13:46934410-46934432 CCCACAGTGGCAGCACTTACTGG - Intergenic
1108708523 13:53011350-53011372 CCCAGAGTATTTGCAGTTACTGG + Intergenic
1111166754 13:84467909-84467931 CCCAAAGTGTTAGGATTTACAGG - Intergenic
1117740485 14:58814038-58814060 CCTGCAGTGTAAGCAGATAATGG + Intergenic
1120436429 14:84488374-84488396 CCCACAGTGTTTACTGACACTGG - Intergenic
1121203819 14:92143878-92143900 CCCAGAGGGTAAGCATATACAGG + Intronic
1122119434 14:99544129-99544151 GACACAGTGGTAGCAGTTACAGG - Intronic
1125391785 15:39200255-39200277 TCCACAGTGTTAGCAGAGTGAGG - Intergenic
1128269745 15:66298847-66298869 CCCTCAGTGCTAGCAGTTTCTGG - Intronic
1128575624 15:68772554-68772576 CCCAGAATGTCAGGAGATACAGG - Intergenic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1131553378 15:93376768-93376790 CAGGCAGTGTTTGCAGATACAGG + Intergenic
1132534602 16:471830-471852 CCCACAGTGACAGGAGACACAGG - Intronic
1135588032 16:23685805-23685827 CCCAAAGTGTTAGGATTTACAGG + Intronic
1142378136 16:89717245-89717267 CCCACAGCCTTAGCAGACTCAGG - Intronic
1145252158 17:21302479-21302501 CCCACAGATTTGGCAGATCCAGG + Intronic
1146780219 17:35664016-35664038 CCCAAAGTGTTAGGATTTACAGG + Intronic
1150134436 17:62688282-62688304 CCCACAGTGTTTTCAGGTCCAGG + Exonic
1155111793 18:22722904-22722926 CCCACAGAGTTGGCATCTACTGG + Intergenic
1155302739 18:24446323-24446345 CCCAAAGTGTTAGGATTTACAGG + Intronic
1156242811 18:35270001-35270023 CCCACAGTGTTAGCAGATACTGG - Intronic
1156612485 18:38741543-38741565 TCCACCGTGTTAGCCGAGACAGG - Intergenic
1161121940 19:2532197-2532219 CCCACAGGGTTTCCATATACTGG + Intronic
1163960285 19:20683488-20683510 CCAACAGTTTTAGTAGAGACGGG + Intronic
1202714163 1_KI270714v1_random:33310-33332 CCCACAGTGCTGCCAGATCCTGG - Intergenic
928457212 2:31433155-31433177 CACACAGAGGCAGCAGATACTGG + Intergenic
929235109 2:39596802-39596824 CCCAAAGTGTTGGGAGTTACAGG + Intergenic
930812398 2:55556805-55556827 CCCACAGTGTTAGGATTAACAGG - Intronic
935888447 2:107649272-107649294 CCCAGAGTGCTAGCAGATGCAGG - Intergenic
935934337 2:108165693-108165715 CCCACAGTGTAATCAGACAGTGG - Intergenic
937569239 2:123335142-123335164 GCAAGAGTGCTAGCAGATACAGG - Intergenic
939271004 2:139939368-139939390 CCCAGAACTTTAGCAGATACTGG - Intergenic
939397687 2:141652079-141652101 CCCTCAATTTTACCAGATACAGG + Intronic
940094320 2:149956916-149956938 CCCACAGTGGTAGGAGACAAGGG - Intergenic
940497928 2:154457539-154457561 CCCACAGTGGAAGCAGAGATTGG - Intergenic
944723544 2:202447430-202447452 CCCACAGTGTTGGGATTTACAGG - Intronic
1169399177 20:5265318-5265340 GCCACAGGGTTAGCATATACTGG - Intergenic
1178121655 21:29475643-29475665 CCCACAGTCTGAGCAAATACAGG + Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1182337621 22:29594992-29595014 CCCAAAGTGTTAAGAGTTACAGG + Intergenic
1183274649 22:36885984-36886006 CCCAAAGTGTGAGCTGCTACGGG + Intergenic
1183617600 22:38954878-38954900 CCCACAGTGATGGCAGAGCCAGG + Intronic
1183640328 22:39088837-39088859 CCCACAGTGGTGGCAGAGCCGGG + Intergenic
952653864 3:35760274-35760296 CCACCAGTGTGAGCAGAGACAGG - Intronic
955499288 3:59568273-59568295 CCCACAATGGTAGCAGAGAGAGG - Intergenic
955587244 3:60493413-60493435 CTCACAGTGTAAGCATATATTGG - Intronic
955734103 3:62018426-62018448 CCCACAATGTCAGCAGGAACTGG + Intronic
956122999 3:65984805-65984827 CCCAAAGTGTTAGGATTTACAGG + Intronic
964638758 3:158885947-158885969 CCCACAGTGTTAGCTGCCACTGG - Intergenic
965268310 3:166577826-166577848 CCCAAAGTGTTCCCAGATTCAGG - Intergenic
965462570 3:168985709-168985731 CCTACTGTGTTATCAAATACTGG - Intergenic
969140016 4:5061434-5061456 CCCACAGGGTTACCAAATAATGG - Intronic
970075880 4:12219124-12219146 CCTACAGTGTTAGAAGCTGCTGG + Intergenic
971865389 4:32164033-32164055 CCCACATTGTGAGAATATACTGG - Intergenic
975531916 4:75408222-75408244 CCCAAAGTGTTGGGAGTTACAGG - Intergenic
976643796 4:87366113-87366135 CCCAAAGTGTTGGGATATACAGG + Intronic
977719666 4:100224487-100224509 CCCACAGTCTTAGCTGCTGCTGG - Intergenic
978162569 4:105566629-105566651 CCTATTGTGTTAGCAAATACTGG + Intronic
984386958 4:179072956-179072978 CCCACAGGGCTGGCAGATACTGG + Intergenic
987009653 5:13749029-13749051 CCAGCAGTGTTAGCAGATTCAGG + Intronic
991008226 5:61853392-61853414 ACCAGAATGTGAGCAGATACTGG - Intergenic
999294686 5:150451517-150451539 CCCAGTATGTTAGCAGAGACTGG + Intergenic
1000301956 5:159964679-159964701 CCCACAATTTTAGCAGGTTCAGG + Intronic
1007473990 6:42107175-42107197 CCCACTGTGTGAGGAGATGCTGG + Exonic
1008370513 6:50725067-50725089 CCCACACTGTCTGCAGACACTGG + Intronic
1009290114 6:61870254-61870276 CTCACAGTGTTAACAGCCACTGG + Intronic
1014154268 6:118092971-118092993 CCCAAAGTCTTAGCACATTCAGG - Intronic
1014660096 6:124159249-124159271 CCATCAGTGTTTGCATATACTGG - Intronic
1017020659 6:150137409-150137431 CCCAAAGTGCTAGAAGATGCAGG - Intergenic
1024248228 7:47486555-47486577 CCCCCAGTGCTAACAGACACAGG + Intronic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1030809212 7:113955211-113955233 AGCAGAGTGCTAGCAGATACAGG + Intronic
1032481418 7:132250079-132250101 CACACAGTGGTGGCAGATCCAGG - Intronic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1038135001 8:24775876-24775898 CCTATACTGTTAGCAGATGCGGG - Intergenic
1042013050 8:64271243-64271265 CCCACAGTTTTTGCAAATATAGG + Intergenic
1044572821 8:93738720-93738742 CCCACAGTGCTAGGATTTACAGG + Intronic
1045349562 8:101325827-101325849 CCCAAAGTGCTAGGAAATACAGG + Intergenic
1045699473 8:104849865-104849887 CCCACCCTGTGAGGAGATACGGG + Intronic
1051986958 9:23101114-23101136 GCCACTGTGTTTGCAGAAACGGG + Intergenic
1052110193 9:24572796-24572818 CTCACAATGTTAGAAAATACTGG - Intergenic
1052849320 9:33367007-33367029 CCTACAGTCATAGCAGATGCTGG + Intronic
1055608921 9:78001136-78001158 CCCAGAGTGTTAGGATTTACAGG - Intronic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1058235429 9:102485033-102485055 CCCCCAGCTTTAGCAGATCCAGG + Intergenic
1058937468 9:109782138-109782160 ACCCCAGTGTTAGCAGCTACTGG - Intronic
1061958647 9:133976917-133976939 CACACAGTGTGAGCAGCTCCAGG + Intronic
1190424892 X:50325810-50325832 CCCACAGAGTTAGGAGAAAAGGG - Intronic
1190617996 X:52257953-52257975 CTTACAGTTTTAGGAGATACTGG + Intergenic
1190885944 X:54530956-54530978 CCCAAAGTGGTTGCAGTTACAGG + Intronic
1192926614 X:75760411-75760433 GCAAGAGTGTTAGCAAATACAGG - Intergenic
1193790503 X:85810203-85810225 CCCACAGTAGTAGCAGGTACAGG - Intergenic
1194801575 X:98280036-98280058 ACCACAGTGTTAGAAAATAAAGG + Intergenic
1197076767 X:122363140-122363162 AGCAGAGTGTTAGCAGATACAGG + Intergenic
1197730156 X:129803147-129803169 CCCAGAGGGGTACCAGATACAGG + Intergenic
1199485222 X:148339235-148339257 ACCACAGTGTTAGCAGACTTGGG + Intergenic