ID: 1156245438

View in Genome Browser
Species Human (GRCh38)
Location 18:35293476-35293498
Sequence CTGTAGGTCTTCAGGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156245431_1156245438 12 Left 1156245431 18:35293441-35293463 CCATGGATCAGACAACACTGGGG No data
Right 1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156245438 Original CRISPR CTGTAGGTCTTCAGGGACCA GGG Intergenic
No off target data available for this crispr