ID: 1156248958

View in Genome Browser
Species Human (GRCh38)
Location 18:35332424-35332446
Sequence CTTTAGGCACAGCTGGATCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 10, 2: 45, 3: 172, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156248955_1156248958 -7 Left 1156248955 18:35332408-35332430 CCGGAGGTAGGGCAGGCTTTAGG 0: 1
1: 1
2: 3
3: 29
4: 158
Right 1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG 0: 1
1: 10
2: 45
3: 172
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156248958 Original CRISPR CTTTAGGCACAGCTGGATCT AGG Exonic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900932097 1:5743969-5743991 CTTCACTCAGAGCTGGATCTGGG - Intergenic
900952808 1:5867470-5867492 CTCCAGGCACACCTGGACCTGGG + Intronic
901203767 1:7482404-7482426 CGTGGGGCACAGCTGGACCTAGG - Intronic
901364864 1:8738182-8738204 GTAAAGGCTCAGCTGGATCTTGG - Intronic
901474111 1:9477304-9477326 CTTCAGGCAGAGGTGGATCCAGG - Intergenic
901508683 1:9702988-9703010 CTTCAGGCATGGCTGGATCCAGG + Intronic
901715256 1:11148550-11148572 CTTTAGGCATAGCTGGATGCAGG + Intronic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
901840113 1:11949013-11949035 CTTCAGGCATGGCTGGATCCAGG + Intronic
901866260 1:12109025-12109047 CTTCAGGCATGGCTGGATCCAGG + Intronic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902257099 1:15196976-15196998 CTTCAGACACAGCGGGATCCAGG + Intronic
902669888 1:17965881-17965903 CTTCAGGCACAGCCTGATCCAGG - Intergenic
903060967 1:20668360-20668382 TTTCAGGCACGGCTGGATCTAGG - Intronic
903168272 1:21536491-21536513 CTTCAGGCATGGCTGCATCTAGG + Intronic
903300814 1:22377424-22377446 CTTCAGTCAGGGCTGGATCTAGG - Intergenic
903409000 1:23124308-23124330 CTTGAAGCAAAGCTGGACCTAGG + Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
904416783 1:30366922-30366944 CTTCAGGCATGGCTGGATCCGGG + Intergenic
904568760 1:31445042-31445064 TTCTAGGCTCAGCTGCATCTGGG + Intergenic
904907774 1:33910825-33910847 CTTCAGGCAGTGCTGGATCAAGG - Intronic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
906188850 1:43882524-43882546 CTTTAGGCCCACCTGAATCTAGG + Intronic
906638807 1:47428690-47428712 TTTCAGGCAGAGCTGGATCCAGG + Intergenic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
908038062 1:60077250-60077272 TTTCAGGCATAGCTGGATCCAGG - Intergenic
908339359 1:63160813-63160835 CTGCTGGCACAGCTTGATCTGGG + Intergenic
908790144 1:67773014-67773036 CTTCAGGCACAGCTGTATTCAGG - Intronic
909568371 1:77080667-77080689 CTTCAGGCTCAGCTTGATCCAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
911035983 1:93548590-93548612 CTTCAGGGAGAGCTTGATCTAGG + Intronic
911185780 1:94903423-94903445 CTTTAAGCCCAGCTGGAAGTTGG + Exonic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
915255329 1:154624120-154624142 CTTCAGGCATGGCTGGATCCTGG - Intronic
916884276 1:169051991-169052013 TTTTTGGCACAGCTATATCTAGG + Intergenic
917675274 1:177312761-177312783 CTTTAGACAAAGCTGCTTCTAGG - Intergenic
918057338 1:181033366-181033388 GTGTAGCCACAGCTTGATCTTGG + Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
919965115 1:202515447-202515469 CTTTAGGCATAGCTAAATCTAGG + Intronic
920106722 1:203558573-203558595 CTCCAGGCACAGCTAGATCCAGG + Intergenic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924205356 1:241706180-241706202 CCTTAGGCACAGCTGGCACAAGG - Intronic
1062801321 10:382850-382872 ATTCAGGCACAAGTGGATCTAGG + Intronic
1065244206 10:23741301-23741323 CTTGAGGCATGGCTGGATCCAGG - Intronic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067732113 10:48820067-48820089 CTTTATGAGCAGCTGGATCCTGG + Intronic
1068795718 10:61077573-61077595 CTTTAGGTATGGCTGGATCATGG + Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1069842625 10:71349272-71349294 CTTTAGGCATCTTTGGATCTAGG + Intronic
1070466270 10:76726777-76726799 CTTTAGGCATTGCTTGATCCAGG - Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071228567 10:83560260-83560282 CTCTAGGGTCAGCTGAATCTGGG + Intergenic
1071727471 10:88213987-88214009 CATTGGGCACAGCTGGATTCAGG + Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1071977529 10:90969861-90969883 CTTCAGCCATGGCTGGATCTGGG - Intergenic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1073474696 10:103745258-103745280 TTTCAGGCATAGCTGGATCTAGG - Intronic
1074043940 10:109819731-109819753 CTATAGGCAGAGCTGGAACTAGG + Intergenic
1074259436 10:111836970-111836992 CTTTAGAGATAGCTGGATGTAGG - Intergenic
1074368393 10:112878610-112878632 CTTCAGGTACAGCTGAATCCAGG - Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1074539777 10:114354807-114354829 CTTCAGGCATGGCTGGACCTAGG - Intronic
1074565918 10:114577833-114577855 CTTTAGGAACACCTGCCTCTGGG - Intronic
1074971471 10:118542817-118542839 CGTCAGGCATAGCTGGATATAGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1077877537 11:6320555-6320577 CCTGAGTCACAGCTGGAGCTGGG - Exonic
1079050576 11:17154473-17154495 CTTTAAGCATAGCAGGATTTGGG - Intronic
1079148251 11:17873974-17873996 CTGAAAGCAGAGCTGGATCTGGG + Intronic
1079399954 11:20098831-20098853 CCTCAAGCACAGCTGGATCCAGG + Intronic
1079490319 11:20981882-20981904 CTTCAGGCAAAGCTGGATTCAGG + Intronic
1079904688 11:26230927-26230949 CTGTTGCCCCAGCTGGATCTCGG + Intergenic
1080585317 11:33676395-33676417 CTTTGAGAACAGCTGGATTTGGG + Intergenic
1080770709 11:35338693-35338715 CTTTAGGTGTATCTGGATCTAGG - Intronic
1081429131 11:42956682-42956704 CTTTAGGCATGTCTGGATCCAGG + Intergenic
1081687050 11:45050123-45050145 CTTCAGGTGCAGCTGGATCCAGG - Intergenic
1081703448 11:45166161-45166183 CTTCAGGTACAGTTGGATCCAGG + Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1084366707 11:68706205-68706227 CTTTATGCACGTCTGTATCTCGG + Intergenic
1084409484 11:68998150-68998172 CTTCAAGAACAGCTGGATCCAGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084494515 11:69496251-69496273 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1084558401 11:69889061-69889083 CTCTAGACACACATGGATCTGGG - Intergenic
1084607893 11:70183187-70183209 CTTCAGGCATGGCTGGATCCAGG + Intronic
1085174763 11:74476097-74476119 CTTCAGGCACAGATTGATCCAGG - Intergenic
1085971213 11:81593123-81593145 CTTTAGGCATGGATGGATCCAGG + Intergenic
1086090703 11:83002075-83002097 CTTTGGGGTCAGATGGATCTAGG - Intronic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1086827159 11:91513137-91513159 CATTAGGTAGAGCTGGGTCTGGG + Intergenic
1088408610 11:109508538-109508560 CTTCAGCCATGGCTGGATCTAGG - Intergenic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1091194889 11:133722086-133722108 CTTCAAACACAGCTGGTTCTAGG - Intergenic
1092929643 12:13303764-13303786 TTTCAGGCACAGCTGGATCTAGG + Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1096107192 12:49003239-49003261 CTTTAGTCACAGATACATCTAGG + Exonic
1096592862 12:52673508-52673530 CTTGAAGCAAAGCTGGGTCTCGG - Intergenic
1097069421 12:56343995-56344017 CTGAAGGCAGGGCTGGATCTGGG - Exonic
1097735028 12:63173100-63173122 GTTTAGGCAAGGCTGGATCCTGG + Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100413002 12:94340931-94340953 TTTCAGGGACACCTGGATCTAGG - Intronic
1100451496 12:94711187-94711209 CTTCAGGTGTAGCTGGATCTAGG - Intergenic
1101376904 12:104179007-104179029 CTTCAGGCACAGCTTGATCTAGG - Intergenic
1101377654 12:104184675-104184697 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1101403716 12:104410309-104410331 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101524001 12:105510974-105510996 CTTTAGTCATGGCTGGATCCAGG + Intergenic
1101579192 12:106026647-106026669 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1101738497 12:107481714-107481736 CCTTTGACACAGCTGGATCCAGG + Intronic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1101856380 12:108446799-108446821 TTTTGGGAACAGCTGGATCCAGG + Intergenic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102402791 12:112644963-112644985 CTTCAGGTACAGCTGCATCCAGG - Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102651772 12:114447516-114447538 CTCTAGGCGCAGCTGGACCGGGG + Intergenic
1102888321 12:116538315-116538337 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1102891550 12:116562263-116562285 TTTCAGGCACAGGTGGATCCAGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103043741 12:117718002-117718024 CTTTAGGTACGGTTGGATCTAGG - Intronic
1103208087 12:119145850-119145872 CTTCAGGTACAGCTGGATTCAGG + Intronic
1103405796 12:120674428-120674450 CTACAGGCACAGCAGGATCAGGG - Intergenic
1103548469 12:121718839-121718861 CTTCAGGCAAGGCTGGATCCAGG + Intronic
1103794704 12:123495295-123495317 CTTCAGGTACAGCTGGCTCCAGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103874895 12:124119550-124119572 CTTTGGGTGCAGCTGGATGTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103945589 12:124524584-124524606 GTTCAGGCACGGCTGGATCTAGG - Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103981609 12:124740408-124740430 CTTCAGGTACAGCTTGATCCGGG - Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1104044228 12:125150438-125150460 CTTCAGGCACAGCAGGATATAGG + Intergenic
1104055866 12:125229668-125229690 CTTCAGGCATAGCTGAATCCAGG + Intronic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104286036 12:127425875-127425897 CCTTGGGCATAGCTGGATCTAGG - Intergenic
1104303519 12:127588353-127588375 ACTTAGGTCCAGCTGGATCTTGG + Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1104391945 12:128398192-128398214 CTTCAGGCACTGCTGGATTCAGG + Intronic
1104398993 12:128460239-128460261 CTTCAGGCATGGCTGGATCAAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104549319 12:129741931-129741953 TTTTAGGGAAAGCTGAATCTAGG + Intronic
1104584106 12:130034080-130034102 CTTCAGGCATCGCTGGATCAAGG + Intergenic
1104647459 12:130507317-130507339 CTTCAGGCTCAGCTTGATTTGGG - Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104743707 12:131196790-131196812 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1104743726 12:131196998-131197020 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1104790613 12:131479715-131479737 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1104918853 12:132280154-132280176 CTTCAGGCATGGCTTGATCTAGG - Intronic
1104919334 12:132282505-132282527 TTTTGGGAACAGCTGGATCTAGG + Intronic
1104931922 12:132344295-132344317 CCTCGGGCACAGCTGGATCCAGG + Intergenic
1105760100 13:23506251-23506273 CTTTAGGCACATCTGTTTCATGG + Intergenic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1106525030 13:30533069-30533091 TTTTGGGCTCAGCTGGACCTGGG - Intronic
1107884027 13:44859229-44859251 CTTCAGGCAGGGCTGGATCTAGG + Intergenic
1107903355 13:45040121-45040143 CTTTAGGCACAACTGGATCTGGG + Intergenic
1110363816 13:74659275-74659297 CTTTGGGGACTGCTGAATCTGGG - Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113532531 13:111039020-111039042 CTGTAAGCACTGCTGCATCTAGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117215382 14:53546320-53546342 CTTCGGGCACAGCTAGATCCAGG + Intergenic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1118548372 14:66920110-66920132 CTTAAGACACTGCTGTATCTTGG - Intronic
1118702422 14:68446799-68446821 CCTGAGGCACAGTTGGATCCAGG - Intronic
1119507694 14:75187104-75187126 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1119723949 14:76910551-76910573 CTTCAGGCACAGTTTGATCTAGG - Intergenic
1119865194 14:77967305-77967327 CTTCAGGCATAGCAGGATCCAGG - Intergenic
1119867187 14:77983633-77983655 CTTTAGGCATGGCTGCATCCAGG - Intergenic
1120073191 14:80126032-80126054 CTTCAGGCATATCTGGATCTGGG + Intergenic
1120923010 14:89772200-89772222 TTTCAGGCATAACTGGATCTAGG - Intergenic
1122048091 14:99037615-99037637 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1122061922 14:99141621-99141643 CTTCAGGTACGGCTGGATCCAGG - Intergenic
1122416855 14:101554128-101554150 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1122825118 14:104367044-104367066 CTCTGGGCACAGCTGGCTCAGGG + Intergenic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1123758432 15:23414917-23414939 CTTCAGGAACGGCTGGATCAAGG + Intergenic
1124439992 15:29678686-29678708 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1124782856 15:32652235-32652257 CTTTGGGCAGAGCCGGCTCTGGG + Intronic
1125507602 15:40276054-40276076 CTTTCGGTAGAGCTGGATCAGGG - Exonic
1127214617 15:56811188-56811210 CTTAAGGCTTAGCTAGATCTGGG - Intronic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1128994030 15:72283563-72283585 CTTGAAGCATGGCTGGATCTAGG - Intronic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129234187 15:74214023-74214045 CTCTAGGCAGAGCTGAATCCTGG - Intergenic
1130606071 15:85318187-85318209 ATTCAGGTACAGCTGGATCCAGG - Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131376202 15:91925833-91925855 CTTCAAGCACGGCTGGATCTAGG - Intronic
1131537871 15:93252656-93252678 GTTCAGGCACAGCTGGATCTAGG - Intergenic
1132104850 15:99055938-99055960 CTTCAGGCATAGCTTGATCCAGG - Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1132657491 16:1047353-1047375 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133470829 16:6073906-6073928 CTTAAGGCACAGCATGATCCAGG + Intronic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1133822922 16:9252867-9252889 ATTCAGGCAAGGCTGGATCTAGG - Intergenic
1133896079 16:9930174-9930196 CTAGAGGCACAGCTTGATCTAGG - Intronic
1133936132 16:10271015-10271037 CTTCAGGCAAGGCTGGATCTCGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134040096 16:11061811-11061833 CTTCAGGCATGGCTGGATCCGGG + Intronic
1134124076 16:11604473-11604495 CTTCAGGCATGGCTGGATCCAGG + Intronic
1134276455 16:12780661-12780683 TTGCAGGTACAGCTGGATCTAGG - Intronic
1134396803 16:13872631-13872653 ATTCAGGAACAGCTGGATCCAGG - Intergenic
1134399449 16:13895696-13895718 CTTCAGGCATGGCTTGATCTAGG - Intergenic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1135040157 16:19112199-19112221 TTTCAGGTACAGCTGAATCTAGG - Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135099458 16:19593576-19593598 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1135114553 16:19713902-19713924 CTTCAGGTATGGCTGGATCTAGG - Intronic
1135350292 16:21723698-21723720 CTTCAGGCATGGCTCGATCTAGG + Intronic
1135479228 16:22807824-22807846 CTTTAGGCAAAACTGGATCCAGG + Intergenic
1135542817 16:23345442-23345464 CTTCAGGCATGGCTGGATCCAGG + Intronic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1135900658 16:26456578-26456600 CTTCAGGCAGAGCGGCATCTGGG - Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1136014228 16:27384803-27384825 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136046202 16:27617229-27617251 CTTTAGGCATAGGTGAATCCAGG + Intronic
1136050406 16:27646184-27646206 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136086256 16:27887418-27887440 CCTCAGGCATGGCTGGATCTAGG - Intronic
1136089363 16:27907298-27907320 AGTCAGGCACAGCTGGATCCAGG - Intronic
1136092366 16:27929605-27929627 CTTCAGGCATGGCTGGATCCAGG - Intronic
1136105932 16:28030550-28030572 CTTCAGTCTCAGCTGGATCCAGG - Intronic
1136106593 16:28034461-28034483 CTTCAGTCTCAGCTGGATCCAGG + Intronic
1136140180 16:28283349-28283371 TTTCAGGCATAGCTGGATCAAGG + Intergenic
1136720182 16:32313842-32313864 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136725235 16:32352236-32352258 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136838558 16:33520118-33520140 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136843562 16:33558292-33558314 CTTCAGGCATAGCTGGATACAGG + Intergenic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1138071659 16:53998586-53998608 CTTCAGGCATAGCTTGATCCAGG + Intronic
1138165195 16:54794816-54794838 CTTCAGGCATGGCTGTATCTAGG - Intergenic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138381450 16:56605659-56605681 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1138445481 16:57060687-57060709 CTTCAGGCAGGGCTTGATCTAGG - Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1139466647 16:67157575-67157597 CTTCAGGGACGGCTGGATCCAGG - Intronic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1140863955 16:79043515-79043537 GTTCAGGCATAGCTGGATCCAGG + Intronic
1141157609 16:81608302-81608324 CTTCAGGCATTGCTGGATCCGGG + Intronic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141358877 16:83376016-83376038 CTTTAGGGATAGCAGTATCTAGG + Intronic
1141461921 16:84182861-84182883 GTTCAGGCACAGCTGCATCCAGG - Intronic
1141536501 16:84684775-84684797 CTTCAGGCATAGCTGTATCCAGG + Intergenic
1141976564 16:87520148-87520170 CTTCAGGCGCAACTGGATCCAGG + Intergenic
1141988234 16:87593918-87593940 CTTCAGGTACTGCTGGATCCAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142353508 16:89590609-89590631 CCTCAGGCACTGCTGGATCCAGG + Intronic
1203001195 16_KI270728v1_random:165518-165540 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203006249 16_KI270728v1_random:203927-203949 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203132798 16_KI270728v1_random:1701922-1701944 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203148722 16_KI270728v1_random:1820404-1820426 CTTCAGGCATAGCTGGATACAGG + Intergenic
1203153727 16_KI270728v1_random:1858590-1858612 CTTCAGGCATAGCTGGATACAGG + Intergenic
1142732834 17:1873356-1873378 CTTTAGGAACCTCTTGATCTGGG + Intronic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1144754817 17:17672973-17672995 CTTCAGGCGCAGCTGAATCCAGG + Intergenic
1144836731 17:18160348-18160370 CCTCAGGCATAGCTGGATCCAGG + Intronic
1145957350 17:28863747-28863769 CATTAGGCTCAGCTTGATGTAGG - Intergenic
1146168056 17:30607213-30607235 TTTTAGGCACAGCTAGATCCCGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146579624 17:34025134-34025156 CTTGAGGCAGAGCAGGGTCTAGG - Intronic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1146949667 17:36897121-36897143 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1149117829 17:53119383-53119405 CTTCAGGCATAGCAGGATCAAGG + Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1149999041 17:61420936-61420958 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1150160572 17:62894436-62894458 CTTCAGGTATGGCTGGATCTAGG + Intergenic
1150316746 17:64175331-64175353 CCTCTGGCACTGCTGGATCTAGG + Intronic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1152884165 17:82839228-82839250 CATTAGACACAGCTGAATTTAGG - Intronic
1152905029 17:82965316-82965338 CTTTTGGCAGAGCTGTCTCTGGG - Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153782151 18:8504395-8504417 TTTCAGGCATAGCTTGATCTAGG + Intergenic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1154251880 18:12751594-12751616 CTTCAGACACAACTGGATCGGGG + Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1157221652 18:45832547-45832569 GCTTTGGCACAGCTGGACCTAGG - Intronic
1157312144 18:46560464-46560486 CTTTGGGCCCAGCTGGTTCGTGG - Intronic
1157646511 18:49278797-49278819 CTTCAGTCATAGCTGGTTCTAGG - Intronic
1158310941 18:56157600-56157622 CTTCAGGTACAGCAGGATCTAGG + Intergenic
1158425314 18:57334729-57334751 ATTTAGGGACAGCTGGTTTTCGG - Intergenic
1158554504 18:58464295-58464317 ATTCAGGCATGGCTGGATCTAGG + Intergenic
1159029497 18:63216591-63216613 CTTTAAGTACAGCTACATCTTGG + Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160005156 18:75063834-75063856 CTGTGGGAACATCTGGATCTCGG - Exonic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160758281 19:769755-769777 CTTCAGGCTCAGCTGGTTCCAGG + Intergenic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1160943209 19:1629628-1629650 CTTCAGGCAAGGCTGGATCCAGG - Intronic
1161140080 19:2642064-2642086 CTTTGGGCACTGGTGGATGTAGG - Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161504057 19:4634559-4634581 CTTCAGGCACAGTTTGATCAAGG + Intergenic
1161616379 19:5273080-5273102 CTTCAGGTTCAGCTGGATCCAGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1161762755 19:6186625-6186647 CTTCAGGCATGGCTGGATCTGGG + Intronic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162522818 19:11192094-11192116 CTTCAGGCATGGCTGGATCCAGG - Intronic
1162556740 19:11391466-11391488 CTTCAGGCACAGTTGCATCCAGG - Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163177125 19:15572172-15572194 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163186872 19:15644994-15645016 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163201845 19:15775412-15775434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1163217919 19:15894546-15894568 CTTCAGGCATGGCTGGATCCAGG - Intronic
1163482927 19:17568834-17568856 CTTCAGGTGCAGCTGTATCTAGG + Intronic
1163535682 19:17874915-17874937 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163736249 19:18982861-18982883 CTTCAGGATCAGCTGGATCAAGG - Intergenic
1163746563 19:19052279-19052301 CTTTAGGCACGGCAGGCTCAAGG + Intronic
1164464355 19:28474993-28475015 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164629761 19:29754430-29754452 CTGCAGGCAAAGCTTGATCTGGG - Intergenic
1164669784 19:30065885-30065907 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165334213 19:35157626-35157648 CTTCAGGCATGGCTTGATCTAGG + Intronic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1165341546 19:35215809-35215831 CTTCAGGCACAGTTAGATCCAGG - Intergenic
1166104763 19:40591850-40591872 CTTCAGGCATGGCTGGATCCGGG + Intergenic
1166378543 19:42342692-42342714 CTTCAGGCTGGGCTGGATCTAGG + Intronic
1166655852 19:44611223-44611245 CATCAGGCACAGCTGAATCTAGG + Intergenic
1166683899 19:44783723-44783745 TTTCAGGCACAGCTAGATCCAGG + Intronic
1166770593 19:45279735-45279757 CTTCAGGCACAGTTGTATCCAGG + Intronic
1166966279 19:46531011-46531033 CTTCAGGCATGGCTGGTTCTAGG - Intronic
1167010714 19:46805600-46805622 CTTCAGGCATAGCTGGCTCCAGG - Intergenic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167540475 19:50083917-50083939 CTTCAGGCATAACTGGATCCAGG + Intergenic
1167567960 19:50268677-50268699 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567967 19:50268720-50268742 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567974 19:50268763-50268785 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567982 19:50268806-50268828 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167629232 19:50613880-50613902 CTTCAGGCATAACTGGATCCAGG - Intergenic
1167634747 19:50648048-50648070 CTTCAGGCATTGCTGGATCCAGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168244824 19:55107053-55107075 CTCTAGGCATAGCTTGATCCAGG - Intronic
1168473168 19:56657610-56657632 CTTTATTTACAGCTGGTTCTGGG + Intergenic
925904283 2:8530007-8530029 ATCCAGGCACAGTTGGATCTAGG - Intergenic
926307577 2:11649762-11649784 CCTTAAGAACAGTTGGATCTAGG + Intergenic
926465777 2:13185079-13185101 TGTTGGGCACAGCTGTATCTAGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
927149020 2:20185266-20185288 CTTCAGGCACAGCTGGAAGTGGG - Intergenic
929236903 2:39615238-39615260 CTTCAAGCACAGCTGGATTAAGG - Intergenic
929237174 2:39617758-39617780 GTTTAGGTACAGCTGGATCCAGG - Intergenic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
932224895 2:70031757-70031779 CTTAAGGCACAGTTAGATCCAGG + Intergenic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
932783496 2:74579006-74579028 GTTTAGGCACAGCTGGAATGAGG - Intronic
933663045 2:84943205-84943227 CTTTAGGCATGACTGGATCTAGG - Intergenic
934320643 2:91968324-91968346 CTTCAGGCATAGCTGGATACAGG - Intergenic
934852292 2:97708996-97709018 CTTCAGGAACAGCTTGCTCTGGG - Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
936497483 2:113034991-113035013 CTTTAGGCTCTGCTGGTGCTGGG - Intronic
937124586 2:119465372-119465394 CTGTAGGCATGGCTGGATCTAGG - Intronic
937133925 2:119536057-119536079 CGTCAGTCACAGCTGTATCTAGG - Intergenic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
938870930 2:135475561-135475583 CTTTAGCCAAAGCTGGCTTTAGG - Intronic
938900749 2:135796870-135796892 CTTTAGGCACAGCCTGCTCTGGG + Intronic
939185622 2:138857175-138857197 CTTCAGGCACAACTGGATTCAGG - Intergenic
939542580 2:143512089-143512111 CTTCAGGCATGACTGGATCTAGG + Intronic
939833986 2:147105682-147105704 ATTTAGACATAGCTAGATCTAGG - Intergenic
940308407 2:152250903-152250925 CTTCAGGCATGGCTGGATCAAGG - Intergenic
944907133 2:204273400-204273422 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
945158894 2:206868109-206868131 CTTCAGGCATGGCTGGATCTTGG - Intergenic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
945948879 2:216020288-216020310 CTTTAGACATAACTGGATCCAGG + Intronic
947343185 2:229161342-229161364 AGTTAGACACAGCTGGATCCAGG - Intronic
947531466 2:230911375-230911397 CTTCAGGAGCAGCTGGATCAGGG + Intronic
947769989 2:232662873-232662895 CTTCAGGCCCAGGTGGGTCTGGG - Exonic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948558771 2:238836392-238836414 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
948647750 2:239418596-239418618 CTTTTGGCTCAGCTAGACCTGGG - Intergenic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
948991159 2:241554770-241554792 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1168842756 20:920295-920317 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1168845029 20:938630-938652 CTTCAGGCATGGCTGGATCTAGG + Intergenic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169190732 20:3657774-3657796 CTTCAGGCACAGCTGTCTCCAGG - Intergenic
1169268490 20:4181954-4181976 CTTCAGGTACTGCTGGATCATGG - Exonic
1169861571 20:10158469-10158491 CTTTAGGTAAAGCTTGATCTAGG - Intergenic
1172043876 20:32065444-32065466 CCTCAGGCATAGCTGGATCCAGG + Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172627478 20:36356196-36356218 CTTCAGGCACAGTTGAATCAGGG - Intronic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1172906217 20:38371657-38371679 TTTCAGGCATAGCTGGATCCAGG + Intronic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1173665339 20:44758919-44758941 CTTCAGGCAGAGCTTGATCCAGG - Intronic
1173916804 20:46714119-46714141 CTTCAGGTGCAGTTGGATCTAGG + Intronic
1173931766 20:46826790-46826812 CTTCAGGCCTGGCTGGATCTAGG - Intergenic
1173934486 20:46849442-46849464 CTTCAGGAATGGCTGGATCTAGG + Intergenic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174048628 20:47751650-47751672 CTTCAGGTGCGGCTGGATCTAGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174096860 20:48096612-48096634 CTTTGGGCACAGCTGCATTCAGG + Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174129397 20:48331664-48331686 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174187499 20:48716957-48716979 CTTCAGGCATAGCTGCATCCAGG - Intronic
1174190613 20:48737885-48737907 CTTCAGGCATAGCTAGATCCAGG - Intronic
1174200573 20:48803843-48803865 CCTCAGGCACAGTTGGATCCAGG - Intronic
1174327251 20:49789256-49789278 CTTCAGGTACAGCTGGATTCAGG - Intergenic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1174413987 20:50355101-50355123 CTTCAGGCATAGCTAGATCCAGG + Intergenic
1174419604 20:50391037-50391059 CTGAAGGCAGAGCTGGAACTGGG + Intergenic
1174451221 20:50621732-50621754 CTTTAGACATAGCTAGATCCAGG - Intronic
1174492406 20:50909930-50909952 CTTCGGGCACAGCTGGATTGAGG - Intronic
1174502361 20:50995019-50995041 CTTCAGGAACTGCTGGATCTAGG + Intergenic
1174540269 20:51283867-51283889 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174582373 20:51580958-51580980 CTTCAGGCACAGCTGTATGCAGG - Intergenic
1174582508 20:51582041-51582063 CTTCAGACATGGCTGGATCTAGG - Intergenic
1174731139 20:52918781-52918803 AATTAGGCATAGCTGGATCCAGG - Intergenic
1174734065 20:52947584-52947606 CTTTGGGCATAGCTGGATCCAGG - Intergenic
1174847227 20:53954367-53954389 CTCCAGGAACAGCTAGATCTAGG - Intronic
1175062709 20:56258198-56258220 CTTCAGGCGTAGCTGGATCATGG - Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175119354 20:56706442-56706464 CTTTAGGGAAAGCTGGATGCAGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175134426 20:56812289-56812311 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175502345 20:59459601-59459623 CTTGAGGCATGGCTGGATCTAGG - Intergenic
1175677823 20:60961914-60961936 CTTTAGGCTCGGCTGGATCCAGG + Intergenic
1175721610 20:61290886-61290908 CTTCAGGCATGGCTGGATCCAGG + Intronic
1175801740 20:61804909-61804931 CTTCAGGCCCGGCAGGATCTAGG + Intronic
1175820376 20:61905928-61905950 CTTCAGGCATGGCTGGATCTAGG + Intronic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1175831342 20:61966708-61966730 CCTCAGGCACGGCTGGATCCAGG + Intronic
1175875108 20:62225819-62225841 TTTCAGGCACAGCTGCATCTGGG + Intergenic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176147519 20:63572107-63572129 CTTTGGGCAGAGCTCGAACTTGG + Exonic
1177105258 21:16946692-16946714 CTTTAGACCCACCTGGAACTGGG + Intergenic
1180037141 21:45255843-45255865 CCTCAGGCACGGCTGGATCCAGG - Intergenic
1180308892 22:11152383-11152405 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180547369 22:16514194-16514216 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181961961 22:26628649-26628671 CTTCAAGCATAGCTGGATCCAGG + Intronic
1182109470 22:27712706-27712728 CTTCAGGCATGGCTGGATCTAGG - Intergenic
1182211795 22:28683140-28683162 CTTCAGGCATAGCTGGATACAGG + Intergenic
1182215651 22:28715349-28715371 CTTCAGGCATGGCTGGATCTAGG - Intronic
1182533231 22:30978764-30978786 CTTCAGGCACGGTTGGATCCAGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182884174 22:33759151-33759173 CTTCAGGCAGAGTTGGATCCAGG - Intronic
1183077757 22:35437510-35437532 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1184019518 22:41811175-41811197 CTTTTGGCTAACCTGGATCTGGG + Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1185337223 22:50276074-50276096 CCTTGGGCACAGCTGGCACTTGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949651703 3:6167354-6167376 CTTCTGGTACAGCTGGTTCTAGG + Intergenic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
949932526 3:9089999-9090021 GTTTAGGCACCACTAGATCTAGG - Intronic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950532310 3:13559294-13559316 CTTCAGGCATGGCTGGATCCAGG + Intronic
950686833 3:14624549-14624571 CTTCAGGTATAGCTAGATCTAGG - Intergenic
950722179 3:14891264-14891286 CTTCTGCCACAGCTGGCTCTGGG - Intronic
951576298 3:24117702-24117724 CTTCAGGCATGGCTGGATCTGGG - Exonic
951797126 3:26551847-26551869 CTTTAGGCAAAGTTGGAATTAGG - Intergenic
952333797 3:32387733-32387755 CTTCAGGCATGGCTGGATCCAGG - Intergenic
952814369 3:37434471-37434493 CTTCAGGCACAGCTCAATCCAGG - Intronic
953152713 3:40339849-40339871 CTTCAGTCACACCTGAATCTAGG + Intergenic
953208245 3:40851192-40851214 CTTTATTCTCAGCTGGACCTAGG + Intergenic
953357167 3:42265391-42265413 CTCTGGCCACAGCTGGCTCTTGG + Exonic
953706918 3:45238110-45238132 CTTCAAGTCCAGCTGGATCTAGG - Intergenic
954424309 3:50435270-50435292 CTTTGTTCACAGCTGGGTCTTGG + Intronic
954902990 3:54035729-54035751 CAAGAGGAACAGCTGGATCTGGG + Intergenic
954969869 3:54642541-54642563 CTTGAGGCAGAGCTGCATGTTGG + Intronic
955003537 3:54948969-54948991 CTTCAGGTACAGTTGGATCTGGG + Intronic
955047881 3:55376943-55376965 CTTCAGGCATGGCTGGATCCAGG + Intergenic
955198281 3:56826203-56826225 CTTCAGGCATGGCTGGATCCAGG - Intronic
955212336 3:56953858-56953880 CTTCAGGCACAGCTGTTTCCAGG - Intronic
955215518 3:56982186-56982208 CTTCAGGCATAGCTCGATCCAGG - Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955509084 3:59661502-59661524 CTTTTGGCACAGGTGATTCTGGG - Intergenic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955624479 3:60902750-60902772 CTTTAGGCATGTCTGGATCCAGG - Intronic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956731762 3:72203289-72203311 CTTCAGGCATAGCTGTATCCAGG + Intergenic
956736309 3:72241172-72241194 CTTCAGGCATGGCTGGATCAAGG + Intergenic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
956900862 3:73714610-73714632 CTTTAGGCATAACTGGATCTAGG - Intergenic
957005654 3:74943675-74943697 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
957028560 3:75213988-75214010 CTTCAGGGATAGCTGGATCTAGG - Intergenic
957765164 3:84614886-84614908 TTCCAAGCACAGCTGGATCTGGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959111827 3:102132007-102132029 CCTTAGGCACTGATGGATCCTGG + Intronic
959365616 3:105454387-105454409 CCTTAGACATGGCTGGATCTGGG + Intronic
959477222 3:106825590-106825612 CTTTAGGCAATGCTGGATACAGG - Intergenic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961456329 3:127026342-127026364 CTTTGGGGTCAGCTGGATCTGGG + Intronic
961469062 3:127100180-127100202 CTTCAGGCATGGCTGGATCCAGG + Intergenic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961537342 3:127578060-127578082 CCTCAGGCACAGCAGGATTTGGG - Intronic
961541072 3:127599659-127599681 CTTTGAGCACAGCTTGATCCAGG + Intronic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961651060 3:128416860-128416882 CTCCAGGCATAGCTGGATCCAGG - Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962704980 3:138034306-138034328 CTTCAGACACAGCTGAATCAAGG + Intergenic
963196881 3:142542378-142542400 CTTTAGGCATAACTTGATTTTGG - Intronic
963233968 3:142937503-142937525 CTTCAAGAATAGCTGGATCTAGG - Intergenic
965553855 3:169999444-169999466 CTTTAGGCCAGGCTAGATCTGGG - Intergenic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
966289661 3:178341261-178341283 CTTTGGACACAGGTGGATATGGG + Intergenic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
970151831 4:13098093-13098115 ACTTGGGCACAGCTGGATGTGGG + Intergenic
971287959 4:25308418-25308440 CTTCAGGCATGGCTGAATCTGGG + Intergenic
971370113 4:26012153-26012175 CTTCAGGCACAGCTCAATCCAGG - Intergenic
971938957 4:33189362-33189384 CCTGAGGCAAAGCTGGACCTGGG - Intergenic
975179297 4:71325451-71325473 CTTCAGGCATGGGTGGATCTAGG + Intronic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976832222 4:89328407-89328429 CTTCAGGCACAGGTTGATCCAGG + Intergenic
979374269 4:119926569-119926591 CTTCAAGCACAGCTTGATTTGGG - Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
982265251 4:153532940-153532962 CTTCAGGCACAGGTGGATTTAGG + Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983897092 4:173092750-173092772 CTTGAAGCTCAGCTGGATTTGGG + Intergenic
984814468 4:183823669-183823691 CTTTAGGCACTGGTGTCTCTCGG - Intergenic
985200999 4:187485488-187485510 CTGTTGGCACAGGTGGATATAGG + Intergenic
985948404 5:3204162-3204184 CTTCAGGCACAGCTGTACCCAGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987476238 5:18395118-18395140 CTTTAGGGACAGGGAGATCTTGG + Intergenic
989426497 5:41302007-41302029 CTTTGGGGATAACTGGATCTGGG - Intergenic
992358028 5:76005805-76005827 CTTCAGGTTCAGCTGGATCCAGG - Intergenic
992385895 5:76284528-76284550 TTTGAGGCACAGGTGGATCCAGG - Intronic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
994957019 5:106545441-106545463 CATTAAGCACCCCTGGATCTTGG - Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
995748963 5:115433984-115434006 CTTTAGGCAAGGCTGGATCCAGG + Intergenic
995826302 5:116303524-116303546 CTTCAGCCACAGCTTGTTCTCGG + Intronic
997516683 5:134495014-134495036 CTTCAGGCACAGTTTGATCCAGG - Intergenic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998397806 5:141830492-141830514 CTTCAGGCATAGCTGAATCAAGG + Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
998817214 5:146026723-146026745 CTTTGGGGTCAGCTAGATCTAGG + Intronic
999145914 5:149393754-149393776 CTTTAGGTATGGCTGGATCCAGG - Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999263287 5:150250687-150250709 CCTTAAGCACCCCTGGATCTCGG - Exonic
999500313 5:152140553-152140575 CTACAGGCATGGCTGGATCTAGG + Intergenic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
1000375335 5:160575858-160575880 CTTCAGGCAAAGCTGGATGCAGG + Intronic
1000663328 5:163963486-163963508 CTTCAGGCAAAGCTTGATATTGG + Intergenic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001442767 5:171757932-171757954 CTTCAGGAATAGCTTGATCTAGG + Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001486632 5:172124252-172124274 CTTCAGGCACAGCTTGTTCCAGG - Intronic
1001516108 5:172356297-172356319 CTTCAAGCAGAGCTGGATCTGGG - Intronic
1001554222 5:172625265-172625287 CTTTGGGCACAGAAAGATCTGGG + Intergenic
1001557701 5:172647677-172647699 CTCTAGGCACAGCTTCATTTTGG - Intronic
1001563568 5:172685616-172685638 GTTCAGGAATAGCTGGATCTAGG + Intronic
1001564981 5:172694210-172694232 CTTCAGGAACAGCTAGATCCGGG + Intergenic
1001669207 5:173460067-173460089 ATTCAGGCATAGCTGGATCCAGG + Intergenic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1001966877 5:175916102-175916124 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1002051108 5:176571958-176571980 CTTCAGGCATGGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002087027 5:176782412-176782434 CATGAGGCACAGCTGGATTCAGG + Intergenic
1002113158 5:176934934-176934956 GCTTAGGCTGAGCTGGATCTGGG - Intronic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002250069 5:177923104-177923126 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1002433767 5:179219274-179219296 CTTCAGCCATAGCTGGATTTGGG - Intronic
1002534982 5:179871137-179871159 CTTCAGGCATGGCTGGATCCAGG - Intronic
1002576693 5:180177931-180177953 CTTCAGGCATGGCTGGATGTGGG - Intronic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1005452254 6:25984820-25984842 CTTGAGGCACAGCATGATCTTGG - Exonic
1005944272 6:30584278-30584300 CTTCAGGGACAGCTGGAACAAGG + Exonic
1006830189 6:36963772-36963794 CATCAGGCACAGCTGTCTCTAGG + Intronic
1006871809 6:37258143-37258165 CTTTGGGGACGGCTGGATGTGGG + Intronic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1007741310 6:44011286-44011308 AGTTAAGGACAGCTGGATCTGGG - Intergenic
1008474932 6:51926329-51926351 CTTGAGGCACAGCTGAGTCCAGG - Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1009518043 6:64644224-64644246 TTTCAAGCACAGCTGGATCCAGG - Intronic
1009607412 6:65891116-65891138 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1012530935 6:100235599-100235621 CTTTAGGTACTACTTGATCTGGG - Intergenic
1012937655 6:105384896-105384918 CTTTAGGCACAGTCTGATCCAGG - Intronic
1013075919 6:106771721-106771743 CTCCAGGCATAGCTGGATTTAGG + Intergenic
1013870965 6:114759133-114759155 CTTCAGGCACACATGGCTCTTGG + Intergenic
1014037591 6:116785399-116785421 CTTTAGGCACAGCTAAATCAGGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1018132680 6:160747751-160747773 CTTTCTGCACTGCTGGGTCTGGG + Intronic
1018262463 6:161984211-161984233 CATCAGGCATAGCTGGATCCAGG - Intronic
1018928561 6:168223933-168223955 CTTCAGGCATGGTTGGATCTAGG + Intergenic
1019176404 6:170161415-170161437 CTTTAGGCATAGCTGCAGCGCGG - Intergenic
1019324874 7:433111-433133 CTTCAGGCACGGCTGGATTCAGG - Intergenic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1020283256 7:6662122-6662144 CTTCAGACACAGCCAGATCTAGG - Intergenic
1020479374 7:8638869-8638891 CTTTGGGGACAGCTAGACCTTGG + Intronic
1021866431 7:24962743-24962765 CTTCAGGCACGGCTGGACCTAGG - Intronic
1022630105 7:32076758-32076780 CTTCAGGCATAGCAGGATCAGGG - Intronic
1022909589 7:34887758-34887780 CCTTAGGCCCAGCTGAATCCAGG + Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023639240 7:42241130-42241152 CTTTAGGCAAAACAGGATCTAGG + Intergenic
1025213229 7:57033276-57033298 CTTCAGGCACGGCTGCATCCAGG + Intergenic
1025658724 7:63543548-63543570 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1026945516 7:74313595-74313617 CTTCAGGCTCAGCTGGATCTAGG + Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1028481807 7:91314345-91314367 CCCTAGGGGCAGCTGGATCTGGG - Intergenic
1029148223 7:98461958-98461980 CTTTAGGCATAGCTGTATCCAGG - Intergenic
1030360420 7:108589764-108589786 TTTCAGGCACAGCTGGACCTAGG - Intergenic
1031163741 7:118201406-118201428 CTTTAGGCATCGCTGGATCCAGG - Intergenic
1031605885 7:123767392-123767414 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1033372962 7:140728324-140728346 GTTTAGGGACTGCTGGGTCTTGG - Intronic
1033972333 7:147057261-147057283 CTTTAGGCTCAGCTGTTTGTGGG - Intronic
1034260160 7:149750241-149750263 CTTGTGGCCCAACTGGATCTGGG - Intergenic
1035305829 7:157930678-157930700 CCTTGGGCAAAGCTGGGTCTGGG + Intronic
1036535996 8:9653275-9653297 CTTCAGGGTCTGCTGGATCTGGG + Intronic
1036560104 8:9894423-9894445 CTCCAGGCAAAGCTGGAACTTGG - Intergenic
1037191177 8:16127737-16127759 CTTCAGGCATAGCAGGATCCAGG - Intronic
1039416200 8:37396388-37396410 CTTTATCCTCAGCTGGATGTGGG + Intergenic
1042385474 8:68169054-68169076 CTTCAGGCACAGCTCTATCCAGG + Intronic
1043372394 8:79610526-79610548 CTTTTAGCACAGCTGGACTTAGG - Intergenic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1044706584 8:95014736-95014758 CTTTAGGCACAGCTAGGATTTGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046073822 8:109291995-109292017 CTTGAGCCAAAGCTGAATCTAGG + Intronic
1046480210 8:114807335-114807357 CTTTTGGGACAGCATGATCTTGG + Intergenic
1046643997 8:116765430-116765452 CTTTAGCCAAAACTAGATCTGGG + Intronic
1046646005 8:116786314-116786336 CTTCAGTCTCAGCTGGATCTAGG + Intronic
1046716514 8:117573757-117573779 CTTCAGGCACAGCTGTAACCAGG - Intergenic
1046833431 8:118773300-118773322 CTTTTGGCACAACTGGATTCAGG - Intergenic
1046974430 8:120258165-120258187 CTTCAGGCACATCTGGACCTAGG + Intronic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1047974825 8:130119647-130119669 ATTCAGGTACAGCTGGATCCAGG - Intronic
1048066848 8:130978967-130978989 CTTCAGGCACAGCTTGGTCCAGG - Intronic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1048503111 8:134996686-134996708 CTTTAGGCAAAGCTGGATTCCGG + Intergenic
1048988005 8:139745639-139745661 CTTCAGGCCCAGCAGGCTCTGGG + Intronic
1049397416 8:142407698-142407720 CCTTGGCCACAGCTGGGTCTCGG + Intergenic
1050365137 9:4867170-4867192 CTTCAGGTAAAGCTGGATCTAGG + Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1051009731 9:12396765-12396787 CTTTAAGCACAGCTGAGTCTAGG + Intergenic
1051437348 9:17047231-17047253 TTTCAGGCATAGCTGGATCCAGG + Intergenic
1051503718 9:17805485-17805507 CTTTGGGCAAGACTGGATCTAGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052273958 9:26657353-26657375 CTTCAGGCACCACTGGATCCAGG + Intergenic
1052969005 9:34364962-34364984 CTCTCTGCACATCTGGATCTGGG - Intergenic
1053184679 9:36005524-36005546 CTTTTGGCATAATTGGATCTTGG - Intergenic
1054883715 9:70173027-70173049 CTTCAGGCACAGCTTGATGCAGG + Intronic
1054949867 9:70837911-70837933 CATTAGAGACAGTTGGATCTTGG + Intronic
1055324903 9:75119021-75119043 CTTTGGGGACAGCAGGGTCTGGG - Intronic
1055450219 9:76424517-76424539 CTTCAGGTAAGGCTGGATCTTGG + Intronic
1055788083 9:79892601-79892623 CTTCAGGCAAGGCTGGATCGGGG - Intergenic
1057268286 9:93633140-93633162 CCTCAGGCACAGCTCGCTCTGGG - Intronic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057820971 9:98330429-98330451 CTTCAGGCACAGTTTGATCAGGG - Intronic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1058410258 9:104724096-104724118 CTTTAGACACAGCTGAATCGAGG - Intergenic
1058670732 9:107358702-107358724 CTTCAGGCACAGCTAGATTCAGG - Intergenic
1058727207 9:107815695-107815717 CTTTAGGTGCAGCTGGATTCAGG + Intergenic
1059367970 9:113801355-113801377 CTTTAGGTAGGGCTGGATCCAGG + Intergenic
1060740226 9:126092940-126092962 CTACAGGCACGGCTGTATCTAGG + Intergenic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1061417097 9:130453032-130453054 CTTCAGGCAGGGCTGGATCCAGG + Intronic
1061713113 9:132501164-132501186 CTTCAGGCATAGCAGGATCTAGG + Intronic
1185627425 X:1492583-1492605 CTTCAGGCATGGCTGGATCCAGG - Intronic
1186615601 X:11184089-11184111 ATTTAGGCACGGCTGGATCCAGG - Intronic
1187439161 X:19302355-19302377 TTTCAGGCAAGGCTGGATCTAGG + Intergenic
1187561471 X:20407412-20407434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1189261084 X:39679261-39679283 CTTCAGACATAGCTGGATTTAGG - Intergenic
1192129983 X:68540724-68540746 CTTCAGGCACAGCTGGACTCAGG - Intergenic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1194763856 X:97826401-97826423 CTTTAGGCCCTTCAGGATCTTGG + Intergenic
1194896999 X:99455179-99455201 CTTCAGGAACAGCTGTATTTGGG - Intergenic
1196177973 X:112661098-112661120 GTTTAGAAACAGCTGGATTTTGG - Intronic
1196323133 X:114368199-114368221 CCTCAGCCAGAGCTGGATCTTGG - Intergenic
1196323530 X:114372490-114372512 CCTCAGCCAGAGCTGGATCTTGG + Intergenic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic
1202300745 Y:23411264-23411286 CTTCAGGCATAGCTAAATCTAGG + Intergenic
1202570066 Y:26259334-26259356 CTTCAGGCATAGCTAAATCTAGG - Intergenic