ID: 1156248994

View in Genome Browser
Species Human (GRCh38)
Location 18:35332701-35332723
Sequence GCTTAGGTGAGCATGTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156248994_1156248997 -10 Left 1156248994 18:35332701-35332723 CCTGGTCACATGCTCACCTAAGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1156248997 18:35332714-35332736 TCACCTAAGCCACAGGGAATAGG 0: 1
1: 0
2: 5
3: 12
4: 151
1156248994_1156249004 30 Left 1156248994 18:35332701-35332723 CCTGGTCACATGCTCACCTAAGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1156249004 18:35332754-35332776 AAGGTTGTGTTACCAGAAGATGG 0: 1
1: 1
2: 1
3: 36
4: 316
1156248994_1156249000 11 Left 1156248994 18:35332701-35332723 CCTGGTCACATGCTCACCTAAGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1156249000 18:35332735-35332757 GGTTCCCCACAAATAAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156248994 Original CRISPR GCTTAGGTGAGCATGTGACC AGG (reversed) Exonic
900386739 1:2414073-2414095 GCTGAGGTGATCATGTGTTCTGG + Intergenic
902688606 1:18095495-18095517 GCTTTGGTGAGTATGTGCCTGGG - Intergenic
902697687 1:18151311-18151333 GCTCAGGGGAGCCTCTGACCAGG - Intronic
904423826 1:30410662-30410684 GCTGGGCTGAGCATGTTACCTGG - Intergenic
905246397 1:36617430-36617452 GCGTATGTGTGCATGTCACCAGG + Intergenic
905930372 1:41782863-41782885 TCTTAGGAGATGATGTGACCAGG + Intronic
906458664 1:46020485-46020507 GTTTAGGTAAGAATGTGACATGG + Intronic
906923894 1:50093519-50093541 GGTAATGTGACCATGTGACCTGG + Intronic
912113901 1:106380043-106380065 CTTTTGGTGAGCCTGTGACCTGG + Intergenic
913110997 1:115656908-115656930 GGTTAGGTGAGCATGTGACTTGG + Intronic
913589444 1:120309387-120309409 GCTAAGGTGAGCAGGTGAAAGGG + Intergenic
913618742 1:120588979-120589001 GCTAAGGTGAGCAGGTGAAAGGG - Intergenic
914699770 1:150121392-150121414 GCTTAGGACAGCATGTGTTCAGG - Intronic
914973490 1:152333864-152333886 GGATGGGTAAGCATGTGACCTGG + Intergenic
917667767 1:177241814-177241836 CCTGAGGTGTGCCTGTGACCTGG - Intronic
918463081 1:184795714-184795736 GCTCTGATGAGCATGTGCCCGGG + Exonic
919470778 1:197976501-197976523 GCTAAGATGAACATGTGACTTGG + Intergenic
919818884 1:201460196-201460218 GCTAAGGTGACCCTGTGCCCAGG + Intergenic
922800651 1:228363277-228363299 GCTTAGGTGATCATAACACCTGG - Intronic
1062900430 10:1141079-1141101 GCTGAGGACAGCATGTGGCCTGG - Intergenic
1064241619 10:13634942-13634964 GCATAGGTGAACATGTGTCATGG + Intronic
1064571336 10:16696784-16696806 GCTTAGCTGAGTATCTCACCTGG + Intronic
1065768871 10:29057977-29057999 GCTCAGGAGTTCATGTGACCAGG + Intergenic
1066645081 10:37598461-37598483 TGTTAGGGGGGCATGTGACCAGG + Intergenic
1068752399 10:60610275-60610297 GCTGAGGTGAGCAGATCACCTGG + Intronic
1072625252 10:97107210-97107232 GCTCAGGTGAGCATGTCTCCAGG - Intronic
1075191908 10:120316883-120316905 GGTTTGGTGTGCAGGTGACCAGG - Intergenic
1078466270 11:11552842-11552864 GCTGAGGTGAGGCTGGGACCTGG - Intronic
1080014643 11:27491615-27491637 GCTTAGGTGCTCATGAGTCCAGG + Intergenic
1082662978 11:55937057-55937079 GCTTAGTTTAGTATGTGAACAGG - Intergenic
1084209695 11:67615271-67615293 CCTTAGGTGAGGATCTGGCCTGG - Intergenic
1085012466 11:73150734-73150756 GCTGTGCTGAGCCTGTGACCGGG + Intergenic
1086543619 11:87942494-87942516 ACTAAGGTGAGCATGAGAGCAGG - Intergenic
1088613490 11:111601718-111601740 GCTTATGTGAGCATGTCTCTGGG - Intergenic
1089061787 11:115631719-115631741 GCCTTGGGGAGCAGGTGACCTGG + Intergenic
1095179444 12:39130459-39130481 GGGTAGGTGAGGATGTGACTTGG + Intergenic
1095399890 12:41801914-41801936 GGTGAGAAGAGCATGTGACCAGG + Intergenic
1095902179 12:47339306-47339328 GCATAGGTGGGAATGGGACCAGG + Intergenic
1096881132 12:54671895-54671917 GTCTGGGTAAGCATGTGACCTGG + Intergenic
1097672467 12:62556482-62556504 GCTTCGGTAAGTATTTGACCTGG + Intronic
1098796342 12:74893093-74893115 GTTTAGTTGACCTTGTGACCAGG - Intergenic
1099274718 12:80560134-80560156 GCATAGGTAAGCATGTGGCCAGG - Intronic
1100458047 12:94771895-94771917 GCTCAGGTGCGCATGTAAACTGG - Intergenic
1101154400 12:101914271-101914293 GGTTATGTGAGCTTGTGGCCAGG + Intronic
1116909895 14:50450179-50450201 GCTTAGGTGGGCAGATCACCTGG - Intronic
1118555432 14:67014026-67014048 ATTTAGGTGAGTATGTGAACAGG - Intronic
1118588600 14:67381714-67381736 GTTTAGGTGAGCATTTCAGCAGG - Intronic
1124904041 15:33851709-33851731 GCTTAGGAGAAAATGCGACCAGG + Intronic
1125324393 15:38521981-38522003 GCTCAGGTGAAGATGTAACCTGG - Intronic
1127648054 15:60976948-60976970 GTTTAGGTGACCATGTGTCCTGG + Intronic
1130788006 15:87121912-87121934 GCTTAGATGCTCATGTTACCAGG - Intergenic
1131061061 15:89405003-89405025 GATTAGGTAAGCATGTGATTGGG - Intergenic
1131179729 15:90231537-90231559 GCTTTAATGAGCGTGTGACCTGG - Intronic
1133379764 16:5320154-5320176 GCATAGGTGTGCGTGTAACCAGG + Intergenic
1133660240 16:7909485-7909507 GCTTAGGTGAGGAATGGACCAGG + Intergenic
1133945018 16:10340787-10340809 GCTGAGGTGAGTAGGTCACCTGG + Intronic
1134114687 16:11539109-11539131 GCTCAGGTGAGGATGGGGCCAGG - Intergenic
1139008713 16:62606225-62606247 GCTGAGGTGAGCAGATCACCAGG + Intergenic
1139703773 16:68726287-68726309 GGTCAGGGGAGCAGGTGACCAGG - Intergenic
1142322830 16:89395470-89395492 GCTTCTGTGAGCATGCGCCCAGG + Intronic
1142562545 17:819384-819406 GCTCAGGTGAGCAGGTTTCCAGG + Intronic
1144255302 17:13461784-13461806 GCTAAGGTGAGTTTGTGGCCTGG + Intergenic
1148450473 17:47774518-47774540 GCAAAGGCGGGCATGTGACCAGG + Intergenic
1151662496 17:75526085-75526107 GCTTAGGAGAGCAGGAGAACAGG + Intronic
1152235990 17:79139192-79139214 CCTTAGGTGAGTGTGTGAACTGG - Intronic
1152419363 17:80183831-80183853 GGGTAGGTGAGCAGGTGAGCAGG - Intronic
1154177249 18:12093656-12093678 GCTGAGGTGCGCATGTGCCCTGG + Intergenic
1156248994 18:35332701-35332723 GCTTAGGTGAGCATGTGACCAGG - Exonic
1162066548 19:8129223-8129245 GCACAGGTGAGCATGCCACCTGG - Exonic
1165372449 19:35417759-35417781 TCTTAGGTGCTCATGTGTCCGGG + Intergenic
1166794024 19:45415400-45415422 GCTGAGGTGAGCAGATCACCAGG + Intronic
1167095494 19:47373096-47373118 GCTCAGGACAGCATGTGCCCAGG + Intronic
1167879380 19:52443515-52443537 GCTGAGGTGGGCATATCACCAGG + Intronic
1168525875 19:57088504-57088526 GCTTAGGCGAGCAGGTGAGCAGG + Intergenic
925822459 2:7813683-7813705 GCTGATGTGAGCATGGGAGCAGG - Intergenic
928338226 2:30417371-30417393 ACACAGCTGAGCATGTGACCAGG + Intergenic
935291960 2:101618574-101618596 GCTTAGGTGATAAAGTGAACTGG + Intergenic
939175319 2:138741196-138741218 GCTTTGTTGAGGATGGGACCAGG + Intronic
940927709 2:159385138-159385160 GGTCAGGTGAGCATATGCCCAGG - Exonic
943029122 2:182666150-182666172 ACTTAGGTAAGCATGTGACATGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945764472 2:213958083-213958105 CACTAGGTGAGCATGTGTCCTGG - Intronic
948728559 2:239949372-239949394 GATGAGATCAGCATGTGACCTGG + Intronic
1169219089 20:3810913-3810935 GCCTAGGTGGGCAGGTCACCAGG + Intergenic
1171397347 20:24844709-24844731 GCTGAGGTGGGCAGGTCACCAGG - Intergenic
1174526548 20:51176395-51176417 GCTCAGGCGTGCATGTGCCCAGG + Intergenic
1180859667 22:19070571-19070593 TCTTTGGTGCCCATGTGACCTGG - Intronic
1183108865 22:35633872-35633894 GCTTATGTAAGCATGTGCCTGGG + Intronic
1183320338 22:37161531-37161553 GGGAAAGTGAGCATGTGACCAGG + Intronic
1183320360 22:37161649-37161671 GGGAAAGTGAGCATGTGACCAGG + Intronic
953879459 3:46684082-46684104 GGGTAGGTGAGCATCTGGCCTGG - Intronic
954124175 3:48518992-48519014 GCTTAGGGGAGCTGGTGGCCAGG - Exonic
963093915 3:141515389-141515411 CCTTAGGTGAGCATGACCCCAGG + Intronic
968503321 4:961062-961084 GCTGAGATGATCATGTGCCCCGG + Exonic
972161649 4:36235114-36235136 GCTTAGGCTAGGATGTGAGCAGG - Intronic
976911460 4:90312277-90312299 GCAGAGGTGAGCAGGTGAACAGG + Intronic
978375543 4:108071881-108071903 GCTCAGGTGAGCATGTGAGTGGG - Intronic
984398050 4:179225935-179225957 GCTTAGTTGATGATGTGACTCGG - Intergenic
985304919 4:188528959-188528981 GCTTACAGAAGCATGTGACCAGG - Intergenic
989565467 5:42896908-42896930 GTTTAGGTGAACATGTGTCATGG - Intergenic
990202039 5:53386497-53386519 CCTTTGGTGAGCCTGTGCCCTGG - Intergenic
991777388 5:70098410-70098432 ACTTAGGAGAGTATGTGGCCAGG + Intergenic
991856676 5:70973854-70973876 ACTTAGGAGAGTATGTGGCCAGG + Intronic
995603954 5:113830625-113830647 GCTTTGGTGAGCCTGTGTTCTGG - Intergenic
1001652965 5:173328372-173328394 TCTCCGGAGAGCATGTGACCAGG + Exonic
1003397915 6:5769438-5769460 GCTTGGGTGGGCATGGTACCTGG + Intronic
1005072835 6:21878205-21878227 GCTGAGGTGAGCAGATCACCAGG + Intergenic
1006592870 6:35171002-35171024 GCTTAGGTGACCCTGTGGCCTGG - Intergenic
1006714204 6:36104247-36104269 GCTTAGGTTTGCATCTGCCCTGG + Intronic
1012332946 6:98016773-98016795 GATAAGGGGAGCAAGTGACCAGG + Intergenic
1015401120 6:132789182-132789204 TCTGAACTGAGCATGTGACCTGG + Intronic
1022175811 7:27870638-27870660 CCTTTGCTGAGTATGTGACCTGG - Intronic
1035731137 8:1854212-1854234 TCTGAGGTGAGCATGGGGCCGGG - Intronic
1036061939 8:5332359-5332381 GCTAGGGTGAGCTTGTAACCTGG + Intergenic
1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG + Intronic
1038055590 8:23854631-23854653 GCTTAGGTGAGGATTTGATGAGG + Exonic
1041732819 8:61079464-61079486 GCTTAGGTGAAAATGTGCCAAGG + Intronic
1043880746 8:85539653-85539675 GCTGAGGTGAGCTAGTGACTTGG - Intergenic
1044604651 8:94038164-94038186 GCTTTGGTGAGGGTGGGACCTGG + Intergenic
1045084730 8:98670267-98670289 GCTGAGGCGAGCAGGTGCCCAGG + Intronic
1046145249 8:110149923-110149945 ACTTAGGTGAACATGTGCCATGG + Intergenic
1047760412 8:127950141-127950163 GATTAGAAGAGCATGTGCCCCGG - Intergenic
1049564342 8:143330519-143330541 ACTCAGGTGTGCATGTGACTCGG + Intronic
1049981674 9:909451-909473 GCTTAGGTGAGCTTGGGAACAGG + Intronic
1058593251 9:106587693-106587715 GCTCAGATGAGCAAGTTACCTGG + Intergenic
1060801529 9:126548538-126548560 GCAAAGGTGAGCCTGTGCCCTGG - Intergenic
1185456323 X:312635-312657 GCTGCGGTGAGCACGTGCCCAGG - Intronic
1186881650 X:13872554-13872576 GCCTAGGTGACCATATGTCCTGG - Intronic
1187591959 X:20726370-20726392 GCTTCGGTGAGCCTGGGATCGGG + Intergenic
1199172283 X:144745680-144745702 GCTGAGGTGTGCAGGGGACCAGG - Intergenic
1200112738 X:153750419-153750441 CCTCAGGGGAGCATGTGCCCCGG - Intergenic
1200841098 Y:7782553-7782575 GCTGAGGTGAGCATATCATCAGG + Intergenic
1201223036 Y:11789776-11789798 CCTTAGCTGAGCATCTGAGCTGG + Intergenic
1202108035 Y:21390764-21390786 GCTGAGGTGAGCATATCACGAGG + Intergenic