ID: 1156250425

View in Genome Browser
Species Human (GRCh38)
Location 18:35346896-35346918
Sequence GCTTGTAAGCAGCTAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156250421_1156250425 12 Left 1156250421 18:35346861-35346883 CCTTGGGATCTTCCCAGAAGATG No data
Right 1156250425 18:35346896-35346918 GCTTGTAAGCAGCTAGTGCAAGG No data
1156250422_1156250425 0 Left 1156250422 18:35346873-35346895 CCCAGAAGATGAGTGCATGAGAG No data
Right 1156250425 18:35346896-35346918 GCTTGTAAGCAGCTAGTGCAAGG No data
1156250423_1156250425 -1 Left 1156250423 18:35346874-35346896 CCAGAAGATGAGTGCATGAGAGG No data
Right 1156250425 18:35346896-35346918 GCTTGTAAGCAGCTAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156250425 Original CRISPR GCTTGTAAGCAGCTAGTGCA AGG Intergenic
No off target data available for this crispr