ID: 1156257056

View in Genome Browser
Species Human (GRCh38)
Location 18:35408858-35408880
Sequence GAGACCAGGACCAAAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156257056_1156257062 9 Left 1156257056 18:35408858-35408880 CCCACAGTTTTGGTCCTGGTCTC No data
Right 1156257062 18:35408890-35408912 CTGCCAGCAGTGGAGAACAGAGG No data
1156257056_1156257060 -1 Left 1156257056 18:35408858-35408880 CCCACAGTTTTGGTCCTGGTCTC No data
Right 1156257060 18:35408880-35408902 CAGCTTGGTCCTGCCAGCAGTGG No data
1156257056_1156257064 12 Left 1156257056 18:35408858-35408880 CCCACAGTTTTGGTCCTGGTCTC No data
Right 1156257064 18:35408893-35408915 CCAGCAGTGGAGAACAGAGGCGG No data
1156257056_1156257065 18 Left 1156257056 18:35408858-35408880 CCCACAGTTTTGGTCCTGGTCTC No data
Right 1156257065 18:35408899-35408921 GTGGAGAACAGAGGCGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156257056 Original CRISPR GAGACCAGGACCAAAACTGT GGG (reversed) Intergenic
No off target data available for this crispr