ID: 1156260923

View in Genome Browser
Species Human (GRCh38)
Location 18:35444482-35444504
Sequence CTGTGTCTGCACATCAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156260923_1156260932 27 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260932 18:35444532-35444554 GAGCTGGACAGAAGGAGAGGTGG 0: 1
1: 1
2: 2
3: 84
4: 850
1156260923_1156260930 19 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260930 18:35444524-35444546 AGGCTTGAGAGCTGGACAGAAGG 0: 1
1: 0
2: 1
3: 39
4: 348
1156260923_1156260926 -1 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260926 18:35444504-35444526 GGAGCTGTGTGCTGGCCCTTAGG 0: 1
1: 0
2: 2
3: 33
4: 204
1156260923_1156260927 11 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260927 18:35444516-35444538 TGGCCCTTAGGCTTGAGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 140
1156260923_1156260933 28 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260933 18:35444533-35444555 AGCTGGACAGAAGGAGAGGTGGG 0: 1
1: 1
2: 3
3: 45
4: 592
1156260923_1156260925 -9 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260925 18:35444496-35444518 CAGACACAGGAGCTGTGTGCTGG 0: 1
1: 1
2: 3
3: 38
4: 336
1156260923_1156260931 24 Left 1156260923 18:35444482-35444504 CCAAGGTTGATGTGCAGACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1156260931 18:35444529-35444551 TGAGAGCTGGACAGAAGGAGAGG 0: 1
1: 0
2: 2
3: 52
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156260923 Original CRISPR CTGTGTCTGCACATCAACCT TGG (reversed) Intronic
900613935 1:3555945-3555967 CTGTGGCTGCAAGTCCACCTAGG + Intronic
901702410 1:11052782-11052804 CTGTTTCAGCAGATCATCCTGGG + Intergenic
902626256 1:17678100-17678122 CTGTGCCTGCCCACCACCCTGGG - Intronic
902761740 1:18585411-18585433 GTGTGACTGCACTTCAGCCTGGG + Intergenic
903929037 1:26851684-26851706 CTGTGACTGGGCACCAACCTTGG - Intronic
904082956 1:27883498-27883520 CTGTGGCTGCCCATCATCATGGG + Intronic
904261278 1:29289077-29289099 CTTTGCCTGCACCTCCACCTGGG - Intronic
904293205 1:29500860-29500882 CTTTGCCTGCACCTCCACCTGGG + Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905302550 1:36995694-36995716 GTGTGGCTGCACACCAACCCAGG - Intronic
905607983 1:39320923-39320945 GTGTCACTGCACTTCAACCTGGG + Intronic
907533925 1:55130590-55130612 CTGTTTCTCCAGAGCAACCTAGG - Intronic
908287645 1:62624926-62624948 CTGTCTCTGCACTCCAGCCTGGG + Intronic
908552021 1:65218119-65218141 CTGAGTCTGCACTTTAACCAAGG - Intronic
912454053 1:109786045-109786067 CTGGGTCTGCCCCCCAACCTGGG - Intergenic
912683784 1:111746080-111746102 CTGTGATTAGACATCAACCTTGG + Intronic
912773779 1:112490530-112490552 CTGCCTCTGCACTCCAACCTGGG - Intronic
914822330 1:151114298-151114320 CTGCCACTGCACACCAACCTGGG + Intronic
915764754 1:158351461-158351483 CTGTGGCTGCACTGCAGCCTGGG + Intergenic
915936668 1:160093711-160093733 CAGCGTCTGCACATCCACGTGGG + Exonic
916063935 1:161121067-161121089 CTGTGTCTGGACATCGCCTTTGG + Exonic
916842962 1:168619079-168619101 CTGAGTCTGCACATCATCGTTGG + Intergenic
918144635 1:181744718-181744740 CAGTGACTGCACATTAATCTTGG + Intronic
918281200 1:183007997-183008019 CTGTCACTGCACTTCAGCCTGGG - Intergenic
920535284 1:206733136-206733158 CTGTTTCTCCACAACAGCCTGGG + Exonic
1064440490 10:15349118-15349140 CTGTGTTTTCACAGCAAGCTAGG + Intronic
1066565290 10:36715678-36715700 CTGCCACTGCACTTCAACCTGGG + Intergenic
1068071957 10:52206926-52206948 TGGTGTCTGCACATCAGCTTGGG + Intronic
1072908667 10:99480190-99480212 ACCTGTCTGGACATCAACCTTGG + Intergenic
1074515990 10:114170368-114170390 CTCTGACTGCACTCCAACCTGGG - Intronic
1074629670 10:115238318-115238340 CTGAATCTGCATATCAAGCTGGG + Intronic
1074734824 10:116419188-116419210 CTGTTTTTGCACATGAAACTAGG + Intergenic
1075964995 10:126603664-126603686 CTTCGCCTTCACATCAACCTGGG - Intronic
1079697274 11:23497697-23497719 CTGTCACTGCACTCCAACCTGGG - Intergenic
1080684213 11:34502226-34502248 CAGTGCCTGCCCATGAACCTGGG + Intronic
1080703322 11:34664752-34664774 ATATTTCTGCACATCAAACTTGG + Intergenic
1082109008 11:48252531-48252553 ATCATTCTGCACATCAACCTTGG - Intergenic
1082786540 11:57320389-57320411 CTGGGGCTGCACATCGAGCTGGG + Exonic
1083417271 11:62533817-62533839 CTGGGTCTCCACATCCACATTGG + Exonic
1085329499 11:75636176-75636198 CTGAATCTGCCCAACAACCTTGG + Intronic
1088491132 11:110388975-110388997 ATGTCACTGCACTTCAACCTGGG - Intergenic
1091961565 12:4699435-4699457 ATGTCACTGCACTTCAACCTGGG + Intronic
1092222104 12:6721450-6721472 CTGTCTCTGCACTTCCGCCTGGG - Intergenic
1092247376 12:6871265-6871287 CTGTGTGTGCGCCACAACCTGGG - Exonic
1094297597 12:28925869-28925891 CTGTGTCTGCCCATCAGCACAGG - Intergenic
1094384611 12:29880693-29880715 CTGCCACTGCACTTCAACCTGGG - Intergenic
1095183988 12:39179825-39179847 ATGTCTCTGCACTCCAACCTGGG - Intergenic
1095445844 12:42281397-42281419 CTGTATCTTCACATTTACCTAGG - Intronic
1099671131 12:85694072-85694094 ATGTCACTGCACTTCAACCTCGG + Intergenic
1100628093 12:96357409-96357431 CTGTGACTGCACTCCAACCTGGG + Intronic
1100866240 12:98860291-98860313 CTGTGTCAGCTCTTCAAACTGGG + Intronic
1101410076 12:104460182-104460204 CTGTCTCTCCAGATCACCCTGGG + Intronic
1105327786 13:19385787-19385809 CTGTGTCTTCACTTCAACAGTGG + Intergenic
1105864116 13:24443894-24443916 CTGTGTCTTCACTTCAACAGTGG - Intronic
1106412283 13:29518953-29518975 GTGTCTCTGAACATCAACCTAGG + Intronic
1109325512 13:60862634-60862656 CTGTATCTGGCCATCAGCCTAGG + Intergenic
1109391631 13:61702664-61702686 GTGTCACTGCACACCAACCTGGG + Intergenic
1110183614 13:72646359-72646381 CTCTGTCTGCACTCCAGCCTGGG + Intergenic
1110785451 13:79519643-79519665 CTGAATCTCCACAACAACCTAGG - Intronic
1115609406 14:35037101-35037123 ATGTCTCTGCACTCCAACCTGGG - Intergenic
1117564011 14:56975484-56975506 CTGTCGCTGCACCCCAACCTAGG - Intergenic
1118422754 14:65625021-65625043 GTGTGACTGCACTTCAGCCTGGG + Intronic
1120793999 14:88611166-88611188 GTGTGACTGCACTCCAACCTGGG - Intronic
1122033533 14:98931274-98931296 CTGGCTCTGCACATGCACCTGGG - Intergenic
1122903053 14:104789821-104789843 CTGGGTCTGCACATCTAACAGGG - Intronic
1125363276 15:38887253-38887275 CTGAGTCTACACCTCAACCCAGG + Intergenic
1130785799 15:87094646-87094668 GTGCCTCTGCACTTCAACCTGGG - Intergenic
1131112443 15:89773813-89773835 CTGTCACTGCACTCCAACCTGGG + Intronic
1132674359 16:1115526-1115548 CTGTGCCTGGACCTCAAGCTTGG + Intergenic
1134089050 16:11380865-11380887 CTGTGGCTCCACAGGAACCTCGG - Intronic
1134794102 16:17018828-17018850 CTGTGTCTGTACATCTACGTGGG + Intergenic
1139095569 16:63701266-63701288 GTGCGACTGCACACCAACCTGGG - Intergenic
1144945834 17:18969073-18969095 CTGTTTGTGCACATCTGCCTGGG + Exonic
1145020633 17:19427734-19427756 GTGTCTCTGCACTCCAACCTGGG + Intergenic
1146084158 17:29812324-29812346 GTGTGACTGCACCCCAACCTGGG - Intronic
1146845576 17:36179647-36179669 CTGTGTCCGCCCATCCACGTGGG + Intronic
1146873793 17:36391488-36391510 CTGTGTCCGCCCATCCACGTGGG + Intronic
1146881150 17:36442578-36442600 CTGTGTCCGCCCATCCACGTGGG + Intergenic
1147065597 17:37921383-37921405 CTGTGTCCGCCCATCCACGTGGG - Intergenic
1147421086 17:40322519-40322541 CTGTGTGTACACACCTACCTTGG + Intronic
1148952045 17:51321639-51321661 CTGTCACTGCACTTCAGCCTGGG + Intergenic
1149544464 17:57493081-57493103 CAGTGTCTGGACAGCCACCTTGG - Intronic
1150274266 17:63885798-63885820 CTGTTTCTGCAGACCAACCACGG + Intergenic
1152411732 17:80128014-80128036 TTGAGTCTGTACATCAACCTGGG + Intergenic
1152998226 18:428218-428240 CTGTCACTGCACTTCAGCCTGGG + Intronic
1153041609 18:817953-817975 CTGAATCTGCACAATAACCTTGG + Intergenic
1153524198 18:5979318-5979340 CTGTGTGTCCACATGAGCCTGGG - Intronic
1154947933 18:21180798-21180820 CTGTGCCTGCTTATCTACCTGGG - Intergenic
1156260923 18:35444482-35444504 CTGTGTCTGCACATCAACCTTGG - Intronic
1157092362 18:44651323-44651345 CTGTGTTTGTAGATCATCCTTGG + Intergenic
1157393019 18:47318705-47318727 GTGCCACTGCACATCAACCTGGG + Intergenic
1159108503 18:64029524-64029546 CAGTTTCTTCACATCATCCTGGG + Intergenic
1160929183 19:1561692-1561714 CTGTGACTGCACTCCAGCCTGGG - Intronic
1162161528 19:8721423-8721445 CTCTGTCTGCACACAGACCTTGG + Intergenic
1164424999 19:28133282-28133304 CTGTGTCTCCAAATCCACATGGG - Intergenic
1164445000 19:28309364-28309386 CTGTGTGCTCACATCAGCCTGGG + Intergenic
1166149809 19:40864367-40864389 ATGTGGCTGCACCTCAGCCTGGG + Intronic
1167131486 19:47588974-47588996 CTGAGCCTGCACTCCAACCTGGG + Intergenic
1167654572 19:50755242-50755264 CTCTGCCTGCACCTCACCCTCGG + Intergenic
1167656264 19:50766373-50766395 CTCTGTCTGCACCTCACCCTTGG + Intergenic
928294183 2:30068647-30068669 TGGTTTCTGCACATCAACCCAGG - Intergenic
929900815 2:46001895-46001917 CAGTGTCTGAACTTCACCCTTGG + Intronic
929917683 2:46149897-46149919 ATGCGACTGCACTTCAACCTGGG - Intronic
930489332 2:52048122-52048144 CTGAGTCTGCAGATCAGCTTGGG - Intergenic
936069336 2:109354790-109354812 CTGTGTTTTCACTTCCACCTGGG - Intronic
936903073 2:117505941-117505963 GTGTCTCTGCACTTCAGCCTGGG + Intergenic
937598417 2:123697827-123697849 ATGTCACTGCACTTCAACCTGGG + Intergenic
938149671 2:128871322-128871344 CTGTGGCTCCTCAGCAACCTCGG + Intergenic
939359588 2:141151741-141151763 CTGAGTCTAGACATCAAGCTTGG - Intronic
940262128 2:151792033-151792055 CTGTGTTTGCACTCCAGCCTAGG - Intronic
940611848 2:156003305-156003327 CCCTTTCTGCACATCTACCTGGG + Intergenic
943662670 2:190575811-190575833 CTGTCACTGCACTTCAGCCTGGG + Intergenic
945943390 2:215971857-215971879 CTGTGTTTCAACATCAACCAAGG + Intronic
946220689 2:218223604-218223626 CTCAGTCTTCACACCAACCTGGG + Intronic
947772876 2:232684860-232684882 GTGCCACTGCACATCAACCTGGG + Intergenic
1170296357 20:14831009-14831031 CTGTTTCTGCACATTTCCCTCGG + Intronic
1170960386 20:21020277-21020299 CTGTGTCTGCACATCCAAGGCGG - Intergenic
1174433133 20:50485508-50485530 GTGTCACTGCACCTCAACCTGGG - Intergenic
1174491321 20:50898414-50898436 CTGTGTCTGCTCTTCAATCCAGG + Intronic
1174596012 20:51684140-51684162 ATGTCTCTGCACAACAACCTGGG + Intronic
1175682331 20:60998680-60998702 CTCTCTCTGCAAAGCAACCTTGG - Intergenic
1177908082 21:26996533-26996555 GTTTGTTTCCACATCAACCTTGG - Intergenic
1178077095 21:29022495-29022517 CTATGACTGCACTTCAGCCTGGG + Intergenic
1180235514 21:46457276-46457298 CTGTGACTGCACTCCAGCCTGGG - Intergenic
1181175800 22:21034366-21034388 CTGTCACTGCACTTCAGCCTAGG + Intergenic
1182139899 22:27944898-27944920 CTGTCACTGCACTTCAGCCTGGG + Intergenic
1182353128 22:29710071-29710093 CTGTGTGTGCACATCCACCCTGG + Intergenic
1182540452 22:31037736-31037758 GTGTGACTGCACCCCAACCTGGG + Intergenic
1182743421 22:32585601-32585623 CTGCATCTTCACATCATCCTTGG - Intronic
1183054918 22:35299490-35299512 CTGTGACTGCACACCTACCCTGG - Intronic
1185318995 22:50191792-50191814 CTGTCACTGCACTCCAACCTGGG - Intronic
949525694 3:4901199-4901221 CTGCCACTGCACATCAGCCTGGG - Intergenic
951356818 3:21677284-21677306 CTGTGTTTTCTCATTAACCTTGG - Intronic
952568812 3:34688429-34688451 GTCTGTCCTCACATCAACCTGGG - Intergenic
953164330 3:40451303-40451325 CTGTGACTGCACTCCAGCCTGGG + Intergenic
953654342 3:44837217-44837239 CCTTGTCTGCACATCTTCCTTGG - Intronic
954383841 3:50234107-50234129 CTGTCTCTGCACTCCACCCTGGG - Intronic
958893628 3:99806585-99806607 CTGTGCCTGCACTCCAGCCTAGG + Intergenic
960655742 3:120002379-120002401 GTGTGACTGCACAACAGCCTGGG - Intronic
961824148 3:129590005-129590027 CTGCGTCTCCACAGCAACCATGG + Intronic
965422537 3:168480079-168480101 CTGTTGCTGCACAGCATCCTTGG - Intergenic
966319242 3:178682256-178682278 CTTTATCTCCACAACAACCTTGG - Intronic
967578232 3:191122742-191122764 GTGCTTCTGCACTTCAACCTGGG - Intergenic
967811623 3:193765750-193765772 CTGTGGCTGCCCCTCAACCTGGG - Intergenic
968693536 4:2008907-2008929 CTGTGGCTGCACAACAAGCTGGG - Exonic
969216411 4:5726076-5726098 CTGTGTCAGCACCTCAAATTAGG + Intronic
969528532 4:7716757-7716779 CAGTGGTTGCACATCCACCTGGG + Intronic
970007427 4:11425109-11425131 CTGAATCTTCACAGCAACCTTGG - Intronic
977414136 4:96709570-96709592 GTGTCACTGCACTTCAACCTGGG - Intergenic
980294731 4:130897110-130897132 GTGTCACTGCACTTCAACCTGGG + Intergenic
980515269 4:133850050-133850072 GTGTCACTGCACTTCAACCTGGG - Intergenic
981960404 4:150530716-150530738 CTGTTTCAGCATCTCAACCTGGG + Intronic
983124725 4:163936657-163936679 CTGTGTGTGCACATCAAGGCTGG + Intronic
983601569 4:169535278-169535300 ATGTCTCTGCACTTCAGCCTGGG + Intronic
983789316 4:171775917-171775939 GTGTCACTGCACATCAGCCTGGG + Intergenic
984729749 4:183056879-183056901 GTGTGACTGCACTCCAACCTAGG - Intergenic
985161413 4:187048339-187048361 CTGTTTGTTCAAATCAACCTCGG + Intergenic
986819287 5:11447297-11447319 CTGTCACTGCACTTCAGCCTGGG + Intronic
988504796 5:31812479-31812501 GTGTGACTGCACTTCAGCCTGGG - Intronic
991284971 5:64962997-64963019 CTGTGCCTGCACTCCAGCCTGGG - Intronic
992450284 5:76869978-76870000 CTGTCACTGCACTTCAGCCTGGG + Intronic
992916852 5:81463809-81463831 CTGTCACTGCACTCCAACCTAGG - Intronic
995107718 5:108394047-108394069 CTGTGACTGCACTCCAGCCTGGG - Intergenic
995287549 5:110408545-110408567 CTGTGTCTGCACTCCAGCCCGGG + Intronic
997482842 5:134201521-134201543 TTTTGTGTGCACATCTACCTAGG + Intronic
998144198 5:139716928-139716950 CTGTGTCTCCCCATCAAACTAGG - Intergenic
998743119 5:145227785-145227807 CTGAGCCTGCACTTCAGCCTGGG - Intergenic
999281033 5:150366075-150366097 CTGTGCCTGCACTCCAGCCTGGG + Intronic
999728285 5:154455263-154455285 CTGTGACTGCACCCCAGCCTAGG - Intronic
999753860 5:154649795-154649817 TTGTCACTGCACTTCAACCTAGG - Intergenic
1000900530 5:166906544-166906566 CTGGGTCTGCCCACCAACTTGGG + Intergenic
1001242356 5:170080364-170080386 CTGTGTCTACACAACAAAGTGGG + Intronic
1005176713 6:23054983-23055005 CTATGTCTGCTCAAAAACCTAGG + Intergenic
1006087482 6:31606725-31606747 CTGTCACTGCACACCAGCCTGGG + Intergenic
1006256025 6:32832848-32832870 CTGTCTTTGCACATCAGCCCTGG - Intronic
1006283242 6:33073112-33073134 CTGGGTCTGGACTTCAAACTTGG + Intronic
1007507944 6:42351303-42351325 ATGTCTCTGCACATAAATCTTGG - Intronic
1007548294 6:42710187-42710209 CTGTGTCTCCCCATCAGACTGGG + Intronic
1008002632 6:46376644-46376666 CTGTGGCTGCACACCAGCCTGGG + Intronic
1008467656 6:51848553-51848575 CAGTGTCAGGACATAAACCTAGG + Intronic
1011753034 6:90472473-90472495 CTGGGGCTGCACTTCAGCCTGGG + Intergenic
1011856538 6:91700024-91700046 CTGTGTCTTTATATCAACCCTGG + Intergenic
1014207559 6:118672721-118672743 GTGTCTCTGCACTCCAACCTGGG + Intronic
1015501450 6:133937590-133937612 CTGTGGCTCCACTGCAACCTGGG + Intergenic
1015696314 6:135983913-135983935 GTGTGTTTGCACACCAAGCTGGG + Intronic
1016154118 6:140782376-140782398 ATGCGACTGCACTTCAACCTGGG - Intergenic
1016830531 6:148429333-148429355 CTATGACTGCACTCCAACCTAGG + Intronic
1017141543 6:151195213-151195235 CTCTGTCTGCAGACCAGCCTGGG + Intergenic
1019191000 6:170250742-170250764 CGGTGTCTCCATTTCAACCTGGG - Intergenic
1023518876 7:41031002-41031024 GTGTCACTGCACACCAACCTGGG - Intergenic
1024669722 7:51583490-51583512 CTCTCTCTTCACATCTACCTTGG - Intergenic
1025614516 7:63106482-63106504 CTGTCTCTGCCCACCAGCCTCGG - Intergenic
1027197010 7:76037562-76037584 CTGTGTCTGCTCAACACCCAGGG + Intronic
1028631180 7:92935728-92935750 CTGAGTGTGCACTCCAACCTGGG - Intergenic
1029404519 7:100366651-100366673 CTGTGTCTGCCCTCCAGCCTTGG - Intronic
1030269634 7:107656356-107656378 GTGTCACTGCACTTCAACCTGGG + Intergenic
1030455004 7:109761415-109761437 CTGTGTCTACTCAGCCACCTTGG + Intergenic
1030475416 7:110026423-110026445 CTGAGCCTCCACATCAACTTTGG - Intergenic
1030832171 7:114237930-114237952 CTGTCACTGCACTTCAGCCTGGG + Intronic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031625849 7:123991953-123991975 CTGTCTCTGCACTCCAGCCTGGG + Intergenic
1032705571 7:134418810-134418832 CTTTGTCTGCACACCAGCCATGG + Intergenic
1033119196 7:138652092-138652114 CTGTCTCTGCACTCCAGCCTGGG - Intronic
1033164988 7:139032053-139032075 CTGTCTCTGCACTCCAGCCTGGG + Intronic
1033448049 7:141439067-141439089 CTTTGTCTGCAGGTCAAGCTGGG + Intronic
1033518950 7:142140270-142140292 TTGTGTTTGCATATCAGCCTAGG - Intronic
1033880010 7:145869324-145869346 CTTTGTTTGCACTTCAACCAGGG + Intergenic
1034538564 7:151741168-151741190 CTGCCACTGCACATCAGCCTGGG + Intronic
1037186971 8:16076547-16076569 CTGTGACTGCACTCCAGCCTGGG - Intergenic
1039399116 8:37253631-37253653 CTGAGGCTGCACACCAGCCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040959227 8:53013310-53013332 CTGTGTCTGCACAGCAGTCTAGG + Intergenic
1042460162 8:69056440-69056462 CTGTCACTGCACTCCAACCTGGG - Intergenic
1043633400 8:82364756-82364778 CTGTGTATACACAGCAACTTCGG - Intergenic
1045494777 8:102699197-102699219 ATGTGTCTGCAATTCAGCCTTGG + Intergenic
1050681545 9:8117433-8117455 CTGACTATGCCCATCAACCTGGG + Intergenic
1052793214 9:32897577-32897599 GTGTGTCTGTGCATTAACCTGGG + Intergenic
1053485525 9:38452105-38452127 GTGTGTGTGCACATGTACCTGGG - Intergenic
1058256576 9:102773413-102773435 CTATGACTGCACTTCAGCCTGGG - Intergenic
1058378279 9:104350209-104350231 CTTTCTCTTCACATGAACCTTGG + Intergenic
1058961517 9:109996769-109996791 CTGTGTGTGCACATGCACATGGG + Intronic
1059687051 9:116647853-116647875 GTGTCACTGCACTTCAACCTGGG - Intronic
1060959518 9:127670154-127670176 CTGTCACTGCACCTCAGCCTGGG - Intronic
1062014072 9:134282535-134282557 CTGTGTCTCCACCACAGCCTAGG - Intergenic
1062052516 9:134454971-134454993 CTGTATCGGCTCATCATCCTGGG + Intergenic
1062270349 9:135705413-135705435 CTGTGTGTGCATGTGAACCTGGG + Intronic
1062641640 9:137521661-137521683 CTGGCTCTGCACAACTACCTCGG - Exonic
1186313309 X:8343105-8343127 CTGCCACTGCACTTCAACCTGGG + Intergenic
1186446819 X:9637029-9637051 CTGTGTCTGGAAATAGACCTAGG - Intronic
1186663698 X:11696627-11696649 ATGTCTTTGCACATCAACTTTGG + Intergenic
1189417897 X:40831354-40831376 TTGTGGCTGCACATCACACTAGG - Intergenic
1189634831 X:42995806-42995828 CTGTCTCTGCACCTCAAATTTGG - Intergenic
1189705999 X:43759540-43759562 CTGTGTATGGACCTCATCCTTGG + Intergenic
1191454193 X:60981317-60981339 CTATATCTTCACATCAAACTTGG + Intergenic
1191478765 X:61310618-61310640 CTATATCTTCACATCAAACTTGG + Intergenic
1195004188 X:100670426-100670448 CTGTGTATGCACATCATACATGG - Intronic
1197871377 X:131065731-131065753 CTGGGTCAGCACCTCATCCTGGG - Intronic
1198450247 X:136760108-136760130 CTGTATCTGCATTTCAACATGGG - Intronic
1198708415 X:139475094-139475116 CTGTGTCTGAAAATCACCCTGGG + Intergenic
1201473918 Y:14360812-14360834 CTGTGTCTGCTCATCCACACAGG + Intergenic