ID: 1156265124

View in Genome Browser
Species Human (GRCh38)
Location 18:35480988-35481010
Sequence GTGGTGTCATGGAGATTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156265124 Original CRISPR GTGGTGTCATGGAGATTATG AGG (reversed) Intronic
900762393 1:4481959-4481981 GTGGTTTCCTAGAGATCATGGGG + Intergenic
903735191 1:25525497-25525519 GTTGAGTCACTGAGATTATGGGG - Intergenic
905523876 1:38622124-38622146 GTGGTTTCATGGAGTTGAGGAGG - Intergenic
905592887 1:39180098-39180120 GGAGGGTGATGGAGATTATGGGG - Intronic
906613617 1:47220167-47220189 GTGGGGACCTGGAGATTAGGAGG + Exonic
910489134 1:87748669-87748691 GAGGTGTCATGAAGATTACATGG - Intergenic
911947159 1:104126297-104126319 GTGATGACATGTAGTTTATGAGG - Intergenic
912355139 1:109048671-109048693 GTGTTTTAAGGGAGATTATGAGG - Intergenic
916864942 1:168846413-168846435 GTGGCGTCATGGAGAACATCAGG - Intergenic
917611051 1:176689372-176689394 GTGTTCTCATGGAGATTTAGGGG + Intronic
918363752 1:183785149-183785171 CTGGGGCAATGGAGATTATGGGG - Intronic
918880003 1:190106178-190106200 CTGGTGTAATGAATATTATGGGG - Intronic
1063178938 10:3578766-3578788 GTGGTGTCCTGGAGATTTTTGGG + Intergenic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1065652870 10:27911819-27911841 CTGCTGTCATGGAGATTACATGG - Intronic
1065973540 10:30823676-30823698 TTGGGGTCATGGAGAGCATGGGG - Intronic
1067232948 10:44424816-44424838 GTTGTGTCCTGGTCATTATGGGG - Intergenic
1069619262 10:69826414-69826436 GTGGTGGCATGGGGGTGATGTGG + Intronic
1070747240 10:78941507-78941529 GTGGGGCCATGGAGAGTCTGGGG + Intergenic
1071774496 10:88770142-88770164 GTGGGGTCTTGGAGCTTCTGGGG - Intronic
1073485415 10:103814796-103814818 CTGTTGTCATGGAGCTTATATGG + Intronic
1077844191 11:6006883-6006905 GTGGGGCCAAGGAAATTATGAGG - Intergenic
1077967877 11:7155277-7155299 TTGGTTTCATTGAGATGATGTGG - Intergenic
1079732820 11:23957125-23957147 GTTATGTAATGGAGATTATCAGG + Intergenic
1079840296 11:25388776-25388798 GTGGGGCCATGGAGATAATGGGG - Intergenic
1080750914 11:35149307-35149329 GTGGTGTAATGAAGATGAGGAGG + Intronic
1083969043 11:66061386-66061408 ATGATGTCATGGAATTTATGAGG + Intronic
1090135347 11:124192285-124192307 GTGGTGTCATGGAATCTAGGAGG - Intergenic
1090411696 11:126513686-126513708 ATGGTAACATGCAGATTATGGGG + Intronic
1091580128 12:1781294-1781316 GAGGGGTCATGGTGAGTATGAGG + Intronic
1092325037 12:7522030-7522052 GTGGGGGCAGGGAGATTATTAGG - Intergenic
1094590529 12:31815274-31815296 GTGGTGGCAGGGAGCTTATCAGG - Intergenic
1094799688 12:34018813-34018835 TGGGGATCATGGAGATTATGGGG + Intergenic
1095332825 12:40989501-40989523 ATGGAGTGATGGATATTATGTGG + Intronic
1098213187 12:68187674-68187696 GTCATGTCATTGAGATAATGTGG + Intergenic
1098500585 12:71187434-71187456 GTTGTGTCATGTAGGTTGTGAGG - Intronic
1102469094 12:113149574-113149596 GTGGTGCAATGGAGAGGATGGGG - Intergenic
1108302815 13:49096789-49096811 GTGCTATGATGGAGTTTATGTGG + Intronic
1108351819 13:49594945-49594967 TTGGTGTCAGGGTGATTATTTGG - Intergenic
1108920600 13:55668911-55668933 GTGGGATTATGGGGATTATGAGG + Intergenic
1110499688 13:76212790-76212812 GTGGTTTCAAGGATATCATGAGG + Intergenic
1113349241 13:109512332-109512354 GTGGTGTCATGGAGAACAAAGGG - Intergenic
1113384667 13:109837573-109837595 GTGGAGAAATGGAGATTATTGGG - Intergenic
1113574231 13:111382756-111382778 GTGGGGTTATGGAGATGGTGGGG + Intergenic
1114084358 14:19228785-19228807 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1114402067 14:22419227-22419249 CTGGAGAGATGGAGATTATGGGG + Intergenic
1115377405 14:32693154-32693176 GTCTTGTCAAGGATATTATGAGG + Intronic
1116543645 14:46134697-46134719 GTGGGGTCCTGGAGATTAACTGG - Intergenic
1121025223 14:90610691-90610713 ATGGTGTAATGGAGAATGTGGGG - Intronic
1122898178 14:104770754-104770776 GTGGTGTGATGGTGATCATCTGG + Exonic
1202895964 14_GL000194v1_random:10646-10668 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1129667256 15:77586245-77586267 GTGGAGGCAGGGAGACTATGAGG + Intergenic
1132853506 16:2034960-2034982 GTGGGGCCCTGGAGATTTTGGGG + Intronic
1134570623 16:15287766-15287788 GTGGCGTCATGCAGATGAAGTGG - Intergenic
1134731759 16:16468290-16468312 GTGGCGTCATGCAGATGAAGTGG + Intergenic
1134935690 16:18243711-18243733 GTGGCGTCATGCAGATGAAGTGG - Intergenic
1136928511 16:34397079-34397101 GTGCTGACAGGCAGATTATGTGG - Intergenic
1136976063 16:35014725-35014747 GTGCTGACAGGCAGATTATGTGG + Intergenic
1140340096 16:74149586-74149608 CTGTTGACATGGAGATTATGAGG - Intergenic
1140540636 16:75753563-75753585 TTGGAAACATGGAGATTATGAGG - Intronic
1142505217 17:358848-358870 GTGGTGTCAGGGAGGCCATGAGG - Intronic
1144312490 17:14025571-14025593 GTGGTGGCATGGAGAGCCTGGGG - Intergenic
1144332262 17:14235754-14235776 GTGGTGGCATGGAGAGCCTGGGG + Exonic
1147167283 17:38600391-38600413 CAGGGGTCATGGACATTATGAGG - Intronic
1149067951 17:52502893-52502915 TGGGGATCATGGAGATTATGGGG - Intergenic
1152629441 17:81403652-81403674 ATCGTGTCATGGAGTTAATGAGG - Intronic
1154994093 18:21623398-21623420 TTGGTGGAATGGGGATTATGAGG + Intronic
1156265124 18:35480988-35481010 GTGGTGTCATGGAGATTATGAGG - Intronic
1161732085 19:5967258-5967280 CTGGTCTCATGGAGATTATGGGG + Intronic
1163838490 19:19591273-19591295 GGGGTGTCATGGTGCTCATGGGG - Intronic
1167742845 19:51334638-51334660 GTGATGTGATAGAGATAATGGGG + Intronic
1167824987 19:51964263-51964285 GTGGTCTCCTGGAGAGTTTGTGG - Intergenic
927126260 2:20014315-20014337 GGGGAGTAATTGAGATTATGAGG + Intergenic
928253363 2:29701065-29701087 GTGGTGTTATGGAGAATAGCTGG - Intronic
932967060 2:76488877-76488899 GTGGTGGCGGGCAGATTATGTGG - Intergenic
938741457 2:134236331-134236353 GAGGTTTCATGGAGATCCTGTGG - Intronic
938889973 2:135694391-135694413 GTGGTATCAGGGACAATATGAGG + Intronic
939289632 2:140177245-140177267 GGGGTGTCATCGACATTTTGAGG - Intergenic
940084866 2:149847959-149847981 ATGGTGGCAGGGAGATCATGCGG - Intergenic
941755617 2:169182537-169182559 GTGGTGTCATGTAGAAAATACGG + Intronic
944311450 2:198238009-198238031 GTGCTGTGCTAGAGATTATGAGG + Intronic
944314712 2:198272090-198272112 CCGCTGTCATGGAGTTTATGAGG + Intronic
945053540 2:205848457-205848479 TTGGTGTGATGGAAATTCTGTGG - Intergenic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
947744606 2:232501077-232501099 GGGCTGTCATGGGGTTTATGAGG + Intergenic
948316935 2:237035158-237035180 TTGGTGTCCTGGAGAAGATGGGG + Intergenic
1172765562 20:37348926-37348948 GTGCTGTCATGGAGAATCAGTGG + Intronic
1174072246 20:47907533-47907555 GGGTTGTCATGGAGATCAGGTGG - Intergenic
1175822842 20:61919924-61919946 GTGGTGTCACGGTGATTGCGTGG + Intronic
1175822854 20:61920071-61920093 GTGGTGTCACGGTGATTGCGTGG + Intronic
1175822864 20:61920190-61920212 GTGGTGTCATGGTGACTGCGTGG + Intronic
1175822880 20:61920381-61920403 GTGGTGTCGCGGTGATTGTGTGG + Intronic
1175822889 20:61920495-61920517 AGCGTGTCATGGTGATTATGTGG + Intronic
1175822915 20:61920783-61920805 GTGGTATCATGGTGATTGCGTGG + Intronic
1175822924 20:61920882-61920904 GTGGTGTCATGGTGATTGCATGG + Intronic
1175822942 20:61921113-61921135 GTGGTGTCACGGTGATTGTGTGG + Intronic
1175822957 20:61921296-61921318 GTGGTGTCATGGTGATTGCATGG + Intronic
1176012949 20:62909968-62909990 ATGGTTTCATGGCGATTGTGTGG - Exonic
1176615653 21:9026698-9026720 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1178644128 21:34370969-34370991 GAATTTTCATGGAGATTATGTGG + Exonic
1179559746 21:42207818-42207840 GTGATGTCATGAAGACCATGTGG - Intronic
1180293614 22:10864417-10864439 GTGCAGGCATGGAGATTCTGGGG - Intergenic
1180496419 22:15893832-15893854 GTGCAGGCATGGAGATTCTGGGG - Intergenic
951422354 3:22502337-22502359 GTGGTGTCATGGAAGTCAAGAGG + Intergenic
952080139 3:29748050-29748072 GGGGTGTAATAGAGAGTATGGGG + Intronic
954084111 3:48230557-48230579 GTGGAGTTTTGGAGACTATGTGG + Intergenic
954858002 3:53663415-53663437 GTGGGGCCATGGAGAGGATGGGG + Intronic
956430198 3:69178717-69178739 GTGGTGGGATGGGGATTCTGGGG - Intronic
960851483 3:122059386-122059408 GTGGTGTCATAGAAATCAAGTGG + Intronic
961420354 3:126798123-126798145 GTGGTGTGCTGGAGGTTCTGCGG + Intronic
964122128 3:153195960-153195982 CTGTGTTCATGGAGATTATGGGG + Intergenic
966155701 3:176913950-176913972 GTGGTGTGATGAAGAATAAGAGG - Intergenic
967122264 3:186392682-186392704 GTTGTGGTTTGGAGATTATGTGG - Intergenic
969855468 4:9995632-9995654 GTGATGTCAAGGTGATGATGAGG + Intronic
970247128 4:14075338-14075360 GTGATCTCATGGAGTTGATGGGG - Intergenic
970447112 4:16133446-16133468 TTGGAGACATTGAGATTATGAGG - Intergenic
972716272 4:41649506-41649528 GTGCTGTTATGGAGATTTTATGG - Intronic
975488626 4:74964056-74964078 GTGGTGTCAGGGAGTTTGAGTGG + Intronic
978129601 4:105179136-105179158 TGGGTATTATGGAGATTATGGGG + Intronic
978771411 4:112460105-112460127 GTTGTTTTATGGCGATTATGTGG - Intergenic
982816195 4:159888003-159888025 GTGATCTCATGGATATAATGAGG + Intergenic
985012637 4:185599982-185600004 GTGATGTCTAGGAGATTCTGCGG - Intronic
985222881 4:187726527-187726549 GTGATGTCAGGGAGAGCATGAGG - Intergenic
986029693 5:3882695-3882717 GTGGGGTCATGGGGATGAGGTGG + Intergenic
987681611 5:21143548-21143570 TGGGTATTATGGAGATTATGGGG - Intergenic
988487119 5:31676461-31676483 GGGGTATGATGGAGATTGTGGGG + Intronic
988631926 5:32940696-32940718 GTGGTGGAATGGAGAATATTTGG - Intergenic
990638835 5:57760029-57760051 GTGGTGGCAGGGAGATCATTTGG + Intergenic
994127463 5:96184494-96184516 GTGGTGTCAGGGAGAGTGTCAGG - Intergenic
995949095 5:117688159-117688181 ATGATGTCTTGGAGATTCTGTGG + Intergenic
996914214 5:128693007-128693029 CTGGTGTCATTGAGATTATAAGG - Intronic
997576836 5:134985398-134985420 GTGGTATAATGGACATTGTGGGG + Intronic
997884293 5:137616388-137616410 GAGGTGTTATGGAGATTAACTGG + Intergenic
997893347 5:137694625-137694647 GGGGTGTCATGGAGGTCATTTGG - Intronic
1000124309 5:158228390-158228412 GTGGTGTGCTGGAAATGATGGGG + Intergenic
1000245681 5:159446862-159446884 GTGGTGGCCTGGAGACTCTGAGG - Intergenic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1002178174 5:177414301-177414323 GCGGTGGCATGGATATTAGGTGG + Intronic
1002208075 5:177577984-177578006 GAGGAGTGATGGAGATTATGAGG - Intergenic
1004806714 6:19210895-19210917 GTGGTGGCATGGAGGTTGGGAGG + Intergenic
1005288093 6:24350397-24350419 GTGGAGTCATGCAGAGTGTGTGG - Intronic
1006473717 6:34242306-34242328 AGGGTGTCATGGAGATTAAATGG - Intronic
1011014525 6:82740270-82740292 GAGTTGTCATGGTGATGATGAGG - Intergenic
1011366347 6:86586389-86586411 GGCGTGTCATGTAGACTATGGGG + Intergenic
1012716174 6:102673799-102673821 GTTGTGGCATGGAGATGCTGAGG - Intergenic
1017068180 6:150549305-150549327 GTGGTGTCATGGGGTGGATGGGG - Intergenic
1018157265 6:160997240-160997262 GTGGTGGGACAGAGATTATGGGG - Intronic
1021624357 7:22578068-22578090 GTGCTTTCATGGTGATTATACGG + Intronic
1024852778 7:53740967-53740989 GTGGCGGCATGGAGATGAGGTGG - Intergenic
1025794780 7:64729440-64729462 GTGGTGTCATGCAGGTTGTCAGG + Intergenic
1033995239 7:147337654-147337676 GAGTTGTGATGGAGACTATGTGG - Intronic
1035276260 7:157749681-157749703 GGGGTGTCAGGGTGATTCTGAGG + Intronic
1037472074 8:19220520-19220542 GTTGACACATGGAGATTATGGGG + Intergenic
1038026483 8:23595522-23595544 GTGGGGTTATTGAAATTATGAGG + Intergenic
1039646153 8:39285274-39285296 CTGGGGTCATGGGGAGTATGAGG - Intergenic
1039810514 8:41044032-41044054 GTTGTGTCATGCAGATTGTTAGG + Intergenic
1042759655 8:72257138-72257160 GTGGTGCCAGGGAGATTGGGTGG + Intergenic
1044339928 8:91035398-91035420 TTAGTGTCATGGAGATCATTAGG - Intronic
1045066462 8:98451127-98451149 TTGTTGTTATGGTGATTATGTGG + Intronic
1047616346 8:126565466-126565488 GAGGTGTCAGAGAGGTTATGGGG - Intergenic
1049054723 8:140226911-140226933 GGGGTTTCTTGGAGATTTTGAGG - Intronic
1050877105 9:10651945-10651967 GTGGTGGCATGGTAAGTATGAGG - Intergenic
1052263544 9:26545836-26545858 CTGGTGTCATGGGGATTTGGTGG - Intergenic
1053843602 9:42212770-42212792 ATGGTGTCATGAAAATTGTGTGG + Intergenic
1055741113 9:79390614-79390636 GTGCTGTCATTGAGATTTGGGGG + Intergenic
1057970803 9:99555483-99555505 CTGGTCTCAAAGAGATTATGAGG + Intergenic
1059744656 9:117188396-117188418 AAGGTGTCATGTAGTTTATGGGG + Intronic
1187722084 X:22161645-22161667 GTGGTAACATGGTGATTAGGTGG + Intronic
1196095202 X:111791380-111791402 TTGGTGTCAGGGTGATTATCTGG - Intronic
1201149041 Y:11085353-11085375 GTGCAGGCATGGAGATTCTGGGG + Intergenic
1201524957 Y:14922587-14922609 GTGGTGTTAGGGTGATTCTGAGG + Intergenic
1201673546 Y:16552887-16552909 GTGGTGTCTTTGAGAATTTGTGG - Intergenic