ID: 1156267818

View in Genome Browser
Species Human (GRCh38)
Location 18:35504139-35504161
Sequence TGCCACTCGGCACTGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156267818_1156267824 -3 Left 1156267818 18:35504139-35504161 CCTCCTGGCAGTGCCGAGTGGCA No data
Right 1156267824 18:35504159-35504181 GCACATCTGCTTGGGCAGGTTGG No data
1156267818_1156267823 -7 Left 1156267818 18:35504139-35504161 CCTCCTGGCAGTGCCGAGTGGCA No data
Right 1156267823 18:35504155-35504177 AGTGGCACATCTGCTTGGGCAGG No data
1156267818_1156267825 -2 Left 1156267818 18:35504139-35504161 CCTCCTGGCAGTGCCGAGTGGCA No data
Right 1156267825 18:35504160-35504182 CACATCTGCTTGGGCAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156267818 Original CRISPR TGCCACTCGGCACTGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr