ID: 1156267839

View in Genome Browser
Species Human (GRCh38)
Location 18:35504339-35504361
Sequence TACTGCTTTGCAAAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156267837_1156267839 23 Left 1156267837 18:35504293-35504315 CCAAACTCATGCAATCTACTCTC No data
Right 1156267839 18:35504339-35504361 TACTGCTTTGCAAAGTCTGAAGG No data
1156267838_1156267839 -10 Left 1156267838 18:35504326-35504348 CCTCAACAGATAATACTGCTTTG No data
Right 1156267839 18:35504339-35504361 TACTGCTTTGCAAAGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156267839 Original CRISPR TACTGCTTTGCAAAGTCTGA AGG Intergenic
No off target data available for this crispr