ID: 1156268051

View in Genome Browser
Species Human (GRCh38)
Location 18:35505980-35506002
Sequence CATATTTCTAACACCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156268051_1156268053 9 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268053 18:35506012-35506034 ATCACAGAAACCCACGAGTGAGG No data
1156268051_1156268054 15 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268054 18:35506018-35506040 GAAACCCACGAGTGAGGCCTTGG No data
1156268051_1156268055 18 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268055 18:35506021-35506043 ACCCACGAGTGAGGCCTTGGTGG No data
1156268051_1156268057 19 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268057 18:35506022-35506044 CCCACGAGTGAGGCCTTGGTGGG No data
1156268051_1156268059 20 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268059 18:35506023-35506045 CCACGAGTGAGGCCTTGGTGGGG No data
1156268051_1156268062 29 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG No data
1156268051_1156268061 26 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268061 18:35506029-35506051 GTGAGGCCTTGGTGGGGACAGGG No data
1156268051_1156268060 25 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268060 18:35506028-35506050 AGTGAGGCCTTGGTGGGGACAGG No data
1156268051_1156268063 30 Left 1156268051 18:35505980-35506002 CCACCACAGGTGTTAGAAATATG No data
Right 1156268063 18:35506033-35506055 GGCCTTGGTGGGGACAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156268051 Original CRISPR CATATTTCTAACACCTGTGG TGG (reversed) Intergenic
No off target data available for this crispr